Periodontopathogens around the surface of mini-implants removed from orthodontic patients

Transcription

1 Originl Article Periodontopthogens round the surfce of mini-implnts removed from orthodontic ptients André Tortmno ; Gldys Cristin Dominguez b ; An Cristin Sores Sntos Hddd c ; Fbio Dums Nunes d ;Mônic Nco e ; Cmillo More f ABSTRACT Objective: To verify if mini-implnt mobility is ffected by the presence of periodontopthogens, frequently ssocited with peri-implntitis. Mterils nd Methods: The surfces of 31 mini-implnts used for skeletl nchorge in orthodontic ptients were evluted. Polymerse chin rection ws used for identifiction of the presence of DNA from three different periodontopthogens (P. intermedi [Pi ], A. ctinomycetemcomitns [A], nd P. gingivlis [Pg]) in 16 mini-implnts without mobility (control group) nd 15 mini-implnts with mobility (experimentl group). Results: The results showed tht Pi ws present in 100% of the smples, from both groups: A ws found in 31.3% of the control group nd in 13.3% of the experimentl group. Pg ws detected in 37.4% of the control group nd in 33.3% of the experimentl group. The Fisher exct test nd the odds rtio (OR) vlues for A nd Pg (OR ; 95% confidence intervl [CI]: nd OR ; 95% CI: , respectively) showed no significnt ssocition (P..05) between the periodontopthogens studied nd the mobility of the mini-implnts. Conclusions: It cn be concluded tht the presence of A, Pi, nd Pg round mini-implnts is not ssocited with mobility. (Angle Orthod. 2012;82: ) KEY WORDS: Anchorge control; Microbiology; PCR nlysis INTRODUCTION In the pst decde, the clinicl use of mini-implnts s temporry nchoring devices hs been widespred. This is due, mong other fctors, to the possibility of bsolute orthodontic nchorge nd the ese of Assistnt Professor, Deprtment of Orthodontics, School of Dentistry, University of São Pulo, São Pulo, Brzil. b Associte Professor, Deprtment of Orthodontics, School of Dentistry, University of São Pulo, São Pulo, Brzil. c PhD student, Deprtment of Orthodontics, School of Dentistry, University of São Pulo, São Pulo, Brzil. d Associte Professor, Deprtment of Orl Pthology, School of Dentistry, University of São Pulo, São Pulo, SP, Brzil. e Former grdute student, Deprtment of Orthodontics, School of Dentistry, University of São Pulo, São Pulo, Brzil. f Postdoctorl Fellow, Deprtment of Orthodontics, School of Dentistry, University of São Pulo, São Pulo, SP, Brzil. Corresponding uthor: Dr An Hddd, Fculdde de Odontologi d Universidde de São Pulo, Deprtmento de Ortodonti, Av. Prof. Lineu Prestes, 2227 CEP: , São Pulo, SP Brzil (e-mil: ncssntos@usp.br) Accepted: November Submitted: August Published Online: Jnury 17, 2012 G 2012 by The EH Angle Eduction nd Reserch Foundtion, Inc. instlltion nd removl of these devices. 1 Miniimplnts re routinely used to nchor retrction of the nterior segment, mesiodistl movement of the posterior teeth, symmetricl tooth movement, intrusive mechnics, nd orthopedic corrections. 2 4 Severl studies hve demonstrted the stbility of miniimplnts ginst orthodontic lods, which my vry between 50 nd 250 gf during tretment. 5 However, fter instlltion, some mini-implnts show mobility before or during lod ppliction, which cn led to their removl or clinicl filure s n bsolute nchoring device. 6 The filure rte of mini-implnts vries from 6.6% to 16.1%, which is higher thn tht of dentl implnts (3%) nd other temporry nchoring devices, such s mini-pltes (2.6 to 7.3%). 2,7 11 The mechnism tht leds to mobility, nd consequently to the clinicl filure of mini-implnts, is still unknown. 1,11,12 Some fctors hve been suggested s cuses, such s incorrect positioning nd proximity to dentl root. 10 However, Ku et l. 13 hve verified, using tomogrphy, the contct of mini-implnts with the periodontl ligment in 65.2% of cses. Kim et l. 14 did not suggest tht root proximity is n isolted cusl fctor for the loss of mini-implnt stbility. DOI: /

2 592 TORTAMANO, DOMINGUEZ, HADDAD, NUNES, NACAO, MOREA Figure 1. Flow digrm showing distribution of cses nd controls. Some uthors, in retrospective studies, hve identified co-fctors tht could increse the rte of success or filure of mini-implnts. 7,8 Among the contributing fctors for mini-implnt filure is the coloniztion of the surfces by pthogenic bcteri, which still needs to be investigted. 15 Apel et l. 16 conducted n nlysis of the microflor collected round the hed of orthodontic mini-implnts with nd without mobility nd did not observe cuse-effect reltionship between the observed bcteri nd clinicl filure of the implnts. However, severl studies hve observed tht the microflor of peri-implntitis, which leds to implnt mobility nd loss, is similr to tht found in periodontitis. This microflor is chrcterized predominntly by bcilli colonies, such s P. intermedi (Pi ), P. gingivlis (Pg), nd A. ctinomycetemcomitns (A). 15,17 20 In vitro studies using scnning electron microscopy hve lso showed dhesion of these bcteri to titnium surfces. 21,22 Therefore, this study verifies whether mini-implnt mobility is ffected by the presence of periodontopthogens, frequently ssocited with peri-implntitis. MATERIALS AND METHODS The smple consisted of 41 consecutive ptients (11 men nd 30 women) ged 16 to 40 yers (verge, 20.0 yers). All subjects met the following inclusion criteri: (1) dignosis of dentolveolr biprotusion with convex fcil profile, (2) treted with orthodontic brces (Victory-MBT, 3M Unitek, Monrovi, Clif) for retrction of the nterior segment fter extrction of the first premolrs, (3) nonsmoker, nd (4) nondibetic. Ptients were followed monthly during the orthodontic tretment. This study ws pproved by the ethics committee of the School of Dentistry, University of São Pulo (project number 112/70). Ptients signed n informed consent greeing to prticipte in this reserch. Mini-implnts were instlled by the sme surgicl dentist in ll ptients, in the superior rch nd/or inferior to the region between the second premolrs nd first molrs, using surgicl guide mde of crylic resin. 23 The mini-implnts were plced ner the mucogingivl line. After insertion, ptients were instructed to rinse, by swishing, with 0.12% chlorhexidine gluconte (PerioGrd, Colgte-Plmolive, São Pulo, SP, Brzil) three times dily for week nd dvised to void trum to the mini-implnt during tooth brushing. A totl of 136 mini-implnts were inserted. After heling period of 3 weeks, distl ligture ttched to n elstic hook ctivted for rch retrction ws ttched to the mini-implnt, in ll cses by the sme orthodontist so tht the elstic ws doubled in size. The mini-implnts used were Toms (Denturum, Inspringen, Germny), 8 mm in length nd 1.6 mm in dimeter. In this prospective cse-control study, 31 removed mini-implnts were sent for nlysis (Figure 1). All mini-implnts tht filed (n 5 15) constituted the experimentl group, wheres the first consecutive 16 mini-implnts used successfully were removed nd used s controls. The mtching ws crried out considering the success or filure of the mini-implnts integrtion to the tissues. The observed prmeters were presence or bsence of mobility nd clinicl presence or bsence of inflmmtion (exudte, swelling, redness, pin): N Cses: Mini-implnts with mobility nd with clinicl signs of inflmmtion

3 PERIODONTOPATHOGENS AROUND MINI-IMPLANTS 593 Tble 1. Polymerse Chin Rection Primer Sequences Trget Gene Primers (59 39) Tm, uc Amplicon, bp A F: AAACCCATCTCTGAGTTCTTCTTC R: ATGCCAACTTGACGTTAAAT Pg F: AGGCAGCTTGCCATACTGCG R: ACTGTTAGCAACTACCGATGT Pi F: CCGCATACGTTGCGTGCACTAAG R: CGTGCCAGCAGCCGCGGTATTAGG Tm indictes melting temperture. N Controls: Mini-implnts without mobility nd without clinicl signs of inflmmtion The mini-implnts of the experimentl group were removed becuse of mobility fter periods tht vried between 7 nd 731 dys. The control mini-implnts (successfully used) were removed fter use for skeletl nchorge without mobility, without inflmmtion of peri-implnt tissues, nd without pin fter period rnging from 169 to 1023 dys. Ech mini-implnt removed ws plced in seprte microcentrifuge tube with 500 ml of buffer (1 M NCl, 1 M Tris-HCl ph 8.0, 0.5 M EDTA ph 8.0, 10% SDS, H 2 O up to 100 ml) nd the smples stored t 220uC until DNA extrction. Polymerse chin rection (PCR) nlysis ws performed t the Lbortory of Moleculr Pthology, Deprtment of Stomtology, School of Dentistry, University of São Pulo. After centrifugtion t 14,000 g for 10 min, DNA ws extrcted nd purified using the ChrgeSwitch Forensic DNA Purifiction kit (CS11200, Invitrogen, Crlsbd, Clif), ccording to the mnufcturer s instructions. After eluting DNA from the beds, superntnt contining the DNA ws stored t 220uC until use. Positive controls of the bcteri A, Pi, nd Pg were supplied by the Anerobic Lbortory in the Deprtment of Microbiology t the Institute of Biomedicl Sciences of the University of São Pulo. Ech bcteril smple ws mixed with 500 ml of sterile wter nd wshed twice t 12,000 g for 10 minutes. Pellets were resuspended in 500 ml of sterile wter nd boiled for 10 minutes. After centrifugtion (14,000 g, 10 minutes), the superntnt ws trnsferred to new microcentrifuge tube nd used s control. 24 Primer sequences were obtined ccording to Ashimoto et l. 25 (Tble 1), from Invitrogen. Primers were resuspended in TE buffer (10 mm Tris-HCl ph 7.4, 1 mm EDTA ph 8.0) nd stored t 220uC. The Pltinum Tq DNA polymerse kit ( , Invitrogen) ws used for PCR. PCR mplifiction of the smples nd positive controls ws performed in 25 ml volume, contining 2.5 ml 103 de Buffer PCR Solution (200 mm Tris-HCl, ph 8.4; 500 mm KCl), 0.5 ml 10 mm dntps (2.5 mm datp, 2.5 mm dttp, 2.5 mm dctp, 2.5 mm dgtp; , Invitrogen), 1.5 ml MgCl 2 (50 mm), 2 ml (10 mm) of ech primer, 0.25 ml of Tq DNA polymerse 5 U/mL, 2.0 ml of DNA templte, nd Milli-Q wter to 25 ml. PCR mplifiction ws performed in DNA therml cycler (PTC-100, MJ Reserch Inc, Wtertown, Mss) with the following cycles nd temperture prmeters: (1) initition t 94uC for 3 minutes, (2) denturtion t 94uC for 1 minutes 30 seconds, (3) melting temperture (Tm) s per Tble 1, (4) extension t 72uC for 2 minutes, nd (5) finl extension t 72uC for 10 minutes. Cycles 2 to 4 were repeted 40 times. Amplifiction products were verified by bromophenol blue (103 Blue Juice gel loding Buffer, , Invitrogen; 65% w/v sucrose, 10 mm Tris-HCl ph 7.5, 10 mm EDTA, nd 0.3% w/v bromophenol blue) by horizontl electrophoresis (90 V nd 100 ma; Sub- Cell, Bio-Rd Lbortories Inc, Hercules, Clif) in 2% grose gel ( , UltrPure Agrose, Invitrogen) stined with ethidium bromide 10 mg/ml ( , Invitrogen) in 13 TAE (2M Tris-cette ph 8.3; 50 mm EDTA; , Invitrogen). Gels were photogrphed using n Olympus SP-500U2 (Olympus Imging Americ Inc, Center Vlley, Penn), in UV trnsillumintor (model no , Foto/Prep, Fotodyne Incorported, Hrtlnd, Wis). Product size ws compred using the Low DNA mss ldder ( , Low DNA mss ldder, Invitrogen). The ssocition between the presence of studied periodontopthogens nd the filure of mini-implnts ws determined using the Fisher exct test (P vlues,,.05), complemented by odds rtio (OR) vlues with 95% confidence intervls (CIs). Sttisticl nlysis ws performed using STATA softwre (Stt 9, SttCorp, College Sttion, Tex). RESULTS Pi DNA ws mplified in ll smples of both groups. Pg ws detected in four of 15 smples of the experimentl group (33.33%) nd in six of 16 control smples (37.4%). A ws present in two of the 15 experimentl smples (13.33%) nd five of the 16 control group smples (31.25%).

4 594 TORTAMANO, DOMINGUEZ, HADDAD, NUNES, NACAO, MOREA Tble 2. Sttisticl Anlysis of the Frequency of A in the Studied Groups A (Expected Frequency) OR Group Presence Absence Totl P Vlue (95% CI) Experimentl 2 (3.4) 13 (11.6) 15 (15.0) Control 5 (3.6) 11 (12.4) 16 (16.0) ( ) Totl 7 (7.0) 24 (24.0) 31 (31.0) 5.05, Fisher exct test. OR indictes odds rtio; CI, confidence intervl. Tble 3. Sttisticl Anlysis of the Frequency of Pg in the Studied Groups Pg (Expected Frequency) OR Group Presence Absence Totl P Vlue (95% CI) Experimentl 4 (4.8) 11 (10.2) 15 (15.0) Control 6 (5.2) 10 (10.8) 16 (16.0) ( ) Totl 10 (10.0) 21 (21.0) 31 (31.0) 5.05, Fisher exct test. OR indictes odds rtio; CI, confidence intervl. Sttisticl nlysis showed no ssocition between the presence or bsence of A (P 5.39) nd Pg (P 5.70) nd the success or filure of the mini-implnts. The OR vlues with their respective 95% CI vlues lso showed no ssocition between the presence of A (OR ; 95% CI: ) nd Pg (OR ; 95% CI: ) nd the clinicl performnce of the mini-implnts (Tbles 2 nd 3). DISCUSSION This prospective study evluted the presence of bcteri round mini-implnts removed fter being used, successfully or not, s orthodontic nchorge. No ssocition between mini-implnt mobility nd infection by the bcteri ws found. The smple size my be considered low for certin comprisons. However, it ws higher thn tht of the previous study. 16 In ddition, the totl number of miniimplnts tht were plced ws high (136), but fortuntely, the filure rte ws low (11%), nd it hs determined the smple size. Regrding the nture of the filure, the only mobile mini-implnt tht we suspect to know the etiology of the filure ws the cse tht filed fter 731 dys, which suffered trum. However, we believe it ws relevnt to include this cse in the smple since the presence of bcteri could be dded to the trum. The remining cses hve unknown etiology, nd this ws the reson to perform this reserch. Besides tht, this study points out tht the loss of stbility my be observed t ny time during orthodontic tretment, nd it seems to be ssocited with the lck of primry stbility (trum or root proximity). Studies evluting the microflor ssocited with mini-implnts re scrce. Apel et l. 16 evluted the presence of 20 different bcteril species present in the peri-implnt sulcus surrounding eight mini-implnts with mobility nd four control mini-implnts, wheres the present study imed to detect lower number of bcteril species present in the mini-screw region, which is in contct with bone tissue. Different findings were observed by Apel et l. 16 for the sme bcteri studied here: A nd Pg were not observed in ny of the smples, nd Pi ws observed in one experimentl cse (12.5%) nd in one control cse (25%). The difference in findings between the two studies my be tht Apel et l. 16 used pper cones for smple collection, while in this study, the mini-implnts were removed nd immeditely immersed in buffer. The collection method used here provides greter sensitivity since the pper cones my not hve come into contct with ll the bcteri present in the sulcus nd is n dditionl step before DNA extrction. Their conclusions tht the microflor present in mini-implnts with mobility showed no specific ggressive chrcteristics coincide with the findings of this study. However, dditionl informtion ws presented by Apel et l. 16 regrding the bsence of A. viscosus nd C. grcilis in seven of the eight filed cses, while being lmost lwys present in the controls ws remrkble becuse s both species re more prominent mrkers for periodontl helth thn disese, their bsence in the sulcus surrounding filed screws could be interpreted s first symptom of chnging microflor. This study presents gret dvntge: the selection of 41 individuls with similr initil conditions, miniimplnt instlltion by the sme surgeon in the sme loction (mucogingivl line between the second premolrs nd first molrs with the use of guide 23 ), nd ctivtion of the distl ligtures by the sme orthodontist in ll cses. These procedures minimize differences nd possible confounding fctors. PCR is the method of choice for detecting DNA of micro-orgnisms, since orl bcteri, including A, Pi, nd Pg, re difficult to cultivte. 16 However, PCR is unble to detect whether the bcteri were ctive or inctive t the time of mini-implnt removl. PCR, therefore, cnnot determine whether the ptient s immune system ws cpble of controlling bcteril growth, keeping bcteril levels sttic, or if the bcteri were still ctive t the time of mini-implnt removl. Another limittion of this study refers to the numbers of bcteril species studied. This study focused on the nlysis of bcteril microfilms, often ssocited with peri-implntitis, but the role of the presence of other bcteril species round mini-implnts s protectors or perpetrtors remins to be investigted.

5 PERIODONTOPATHOGENS AROUND MINI-IMPLANTS 595 The results presented here showed tht the presence of A, Pg, nd Pi ws not the primry cusl fctor for the mobility of the mini-implnts. Bcteril infection responsible for peri-implntitis begins in soft tissues due to poor orl hygiene nd slowly extends over the implnts, cusing mobility nd consequently clinicl filure. 26 Since progression of peri-implntitis s well s chronic periodontitis is usully slow nd often tkes severl yers, peri-implnt inflmmtion my not be so importnt from prcticl point of view in determining the clinicl effectiveness of temporry nchorge device, considering the short function time of the mini-implnts. Since the lck of primry stbility cn be responsible for erly filures lso for implnts, this seems to be more implicted to mini-implnt mobility thn bcteril coloniztion. CONCLUSIONS N Sttisticl nlysis showed no ssocition between the presence of the studied periodontopthogens (Pi, Pg,orA) nd mini-implnt mobility. The presence of these prticulr bcteri ws not relted to the mobility tht cused filure of the mini-implnts. N Peri-implnt bcteril coloniztion my not be so importnt in determining the clinicl effectiveness of temporry nchorge device. ACKNOWLEDGMENTS The uthors would like to thnk Ktiúci Btist Silv Piv for PCR nlysis support nd Toni Ricrdo Eugênio dos Sntos for sttisticl nlysis. REFERENCES 1. Reynders R, Ronchi L, Bipt S. Mini-implnts in orthodontics: systemtic review of the literture. Am J Orthod Dentofcil Orthop. 2009;135:564.e1 564.e Prk HS, Lee SK, Kwon OK. Group distl movement of teeth using miniscrew implnt nchorge. Angle Orthod. 2005;75: Prbhu J, Cousley RRJ. Current products nd prctice: bone nchorge devices in orthodontics. J Orthod. 2006;33: Leung MT, Lee TCL, Rbie ABM, Wong RW. Use of miniscrews nd minipltes in orthodontics. J Orl Mxillofc Surg. 2008;66: Liou EJ, Pi BCJ, Lin JCY. Do miniscrews remin sttionry under orthodontic forces? Am J Orthod Dentofcil Orthop. 2004;126: Luzi C, Vern C, Melsen B. Immedite loding of orthodontic mini-implnts: histomorphometric evlution of tissue rection. Eur J Orthod. 2009;31: Antoszewsk J, Ppdopoulos MA, Prk HS, Ludwig B. Five-yer experience with orthodontic miniscrew implnts: retrospective investigtion of fctors influencing success rtes. Am J Orthod Dentofcil Orthop. 2009;136:158.e1 158.e Chen YJ, Chng HH, Lin HY, Li EH, Hung HC, Yo CC. Stbility of minipltes nd miniscrews used for orthodontic nchorge: experience with 492 temporry nchorge devices. Clin Orl Implnts Res. 2008;19: Miywki S, Koym I, Inoue M, Mishim K, Sughr T, Tkno-Ymmoto T. Fctors ssocited with the stbility of titnium screws plced in the posterior region for orthodontic nchorge. Am J Orthod Dentofcil Orthop. 2003;124: More C, Domínguez GC, Tortmno A, Vigorito JW. Frequency nd cuse of filure of miniscrews for orthodontic bsolute nchorge. Eur J Orthod. 2007;29:e27 e Schätzle M, Rolnd M, Zwhlen M, Lng N. Survivl nd filure rtes of orthodontic temporry nchorge devices: systemtic review. Clin Orl Implnts Res. 2009;20: Feldmnn I, Bondemrk L. Orthodontic nchorge: systemtic review. Angle Orthod. 2006;76: Ku CH, English JD, Muller-Delgrdo MG, Hmid H, Ellis RK, Winklemnn S. Retrospective cone-bem computed tomogrphy evlution of temporry nchorge devices. Am J Orthod Dentofcil Orthop. 2010;137:166.e1 166e Kim SH, Kng SM, Choi YS, Kook YA, Chung KR, Hung JC. Cone-bem computed tomogrphy evlution of miniimplnts fter plcement: is root proximity mjor risk fctor for filure? Am J Orthod Dentofc Orthop. 2010;138: Pye AD, Lockhrt DE, Dwson MP, Murry CA, Smith AJ. A review of dentl implnts nd infection. J Hosp Infect. 2009; 72: Apel S, Apel C, More C, Tortmno A, Dominguez GC, Conrds G. Microflor ssocited with successful nd filed orthodontic mini-implnts. Clin Orl Implnts Res. 2009;20: Becker W, Becker BE, Newmn MG, Nymn S. Clinicl nd microbiologic findings tht my contribute to dentl implnt filure. Int J Orl Mxillofc Implnts. 1990;5: Mombelli A, Vn Oosten MAC, Schürch E, Lng NP. The microbiot ssocited with successful or filing osseointegrted titnium implnts. Orl Microbiol Immunol. 1987;2: Rms TE, Link CC Jr. Microbiology of filing dentl implnts in humns: electron microscopic observtions. J Orl Implntol. 1983;11: Rosenberg ES, Torosin JP, Slots J. Microbil differences in 2 cliniclly distinct types of filure of osseointegrted implnts. Clin Orl Implnts Res. 1991;2: Kuul H, Könönen E, Lountm K, Konttinen YT, Könönen M. Attchment of orl grm-negtive nerobic rods to smooth titnium surfce: n electron microscopy study. Int J Orl Mxillofc Implnts. 2004;19: Otke E, Sultn N, Doğn B, Asikinen S. Bcteril dhesion of Actinobcillus ctinomycetemcomitns serotypes to titnium implnts: SEM evlution. A preliminry report. J Periodontol. 1999;70: More C, Domínguez GD, Wuo AV, Tortmno A. Surgicl guide for optiml positioning of mini-implnts. J Clin Orthod. 2005;39: Ávil-Cmpos MJ. PCR detection of four periodontopthogens from subgingivl clinicl smples. Brz J Microbiol. 2003;34: Ashimoto A, Chen C, Bkker I, Slots J. Polymerse chin rection detection of 8 puttive periodontl pthogens in subgingivl plque of gingivitis nd dvnced periodontitis lesions. Orl Microbiol Immunol. 1996;11: Lindhe J, Meyle J. Peri-implnt diseses: consensus report of the sixth Europen workshop on Periodontology. J Clin Periodontol. 2008;35: