* * A3027. A4623 e A3507 A3507 A3507
|
|
|
- Florence Berry
- 5 years ago
- Views:
Transcription
1 a c L A327 d e A37 A37 A37 Supplementary Figure 1. Clinical manifestations of individuals with mutations. (a) Renal ultrasound of right kidney in A327 reveals small renal cysts, loss of corticomedullary differentiation, and increased echogenicity, rendering the renal pattern righter than the liver s (L). () Cranial MRI of depicts pachygyria with few road coarse gyri (asterisks) and dilated Virchow-Roin spaces (arrowheads). (c) Renal histology of A37 shows diffuse mesangial sclerosis (H&E stain). Scale ar, 1 mm. (d) Renal histology of A37 shows tuular cysts, interstitial firosis and infiltrations. Scale ar, 1 mm. (e) Brain MRI of A37 after VA shunt implantation in the right ventricle shows dilation of the lateral ventricles (asterisks) and an area of hemorrhage (arrowhead).
2 Cell Index amled amled sirna#2 Undifferentiated Differentiated a c Podocyte ACTIN Podocyte (differentiated) ACTIN Podocyte Migration Assay (undifferentiated) amled (+ Serum) amled (No Serum) (+ Serum) sirna#2 (+ Serum) Time (hr) Supplementary Figure 2. knockdown in cultured human podocytes and in renal epithelial cells. (a) Undifferentiated cultured human podocytes do not express endogenously, whereas differentiated cultured podocytes express. () sirnas did not have any effect on migration in undifferentiated podocytes ecause undifferentiated podocytes do not express. Error ars are shown in one direction only for clarity and indicate SDs for e indipendent expreiments. (c) knockdown y sirnas ( and sirna#2) in differentiated podocytes significantly reduced protein.
3 a CDC42 PD 2 RHOA PD Relative intensity (a.u.) Relative intensity (a.u.) Relative intensity (a.u.) 2 RAC1 2 RHOA 2 CDC42 5% input 26 5% input 2 26 RAC1 4 Actin 4 Actin c d e 1 CDC42 RAC1 1 RHOA Supplementary Figure 3. Effects of knockdown on RHO GTPases activity in differentiated cultured human podocytes. (a) Active GTP-ound RAC1 and CDC42 precipitated from differentiated podocytes transfected with scramled or sirna using a GST-PAK1 (CRIB) pulldown assays. Compared to control podocytes, podocytes transfected with sirna exhiited a significant decrease in relative RAC1 and CDC42 46% and 28%, respectively). The efficiency of knockdown y sirna was confirmed y immunolotting with an anti- antiody (second to lowest panel). a and represent 3 experiments each. () Active GTP-ound RHOA precipitated from differentiated podocytes transfected with scramled () or sirna using a GST-rhotekin (RBD) pulldown assay. Cells transfected with scramled control sirna versus FAT sirna exhiited no significant difference in relative RHOA activity. (c-e) Quantification of CDC42 (c), RAC1 (d), and RHOA (e) in -depleted cells compared to control cells. Error ars indicate the standard deviaion for three independent experments. <.5, t-test. GTPound GTPound GTPound
4 a Cell Index Podocyte Migration Assay (Differentiated) Time (hr) amled (+ Serum) amled (No serum) amled + CDC42-T17N (+ Serum) (+ Serum) sirna+ CDC42-T17N (+ Serum) Area under curve amled amled + CDC42-T17N + CDC42-T17N n.s. c FLAG-CDC42-T17N CDC42 (FLAG) ACTIN Supplementary Figure 4. Effects of dominant negative CDC42 and knockdown on podocyte migration. (a) To overexpress of CDC42-T17N in differentiated podocytes, plenti-cmv-blast-cdc42- T17N and lentiviral packaging vectors were used. Overexpression of CDC42-T17N resulted in decreased migration in differentiated podocytes (lue). However, overexpression of CDC42-T17N failed to further decrease migration in podocytes with knockdown (red vs. green). Each cell index value corresponds to the average of more than triplicates and standard deviation is in only one direction for clarity. () Bar graphs represent the area under curved of (a), and data represent the mean + stand deviation of three independent experiments. n.s., not significant, t-test. (c) Western lot to examine efficiency of knockdown and CDC42-T17N overexpression in differentiated cultured human podocytes. c represent 3 experiments.
5 a c d e f g h i j k Supplementary Figure 5. Podocyte-specific deletion disrupts podocyte differentiation in developing mice. (a) Conditional targeting strategy for the mouse locus. Asterisks indicate the locations of 5' and 3' external proes used for Southern analysis to confirm targeting. Neo selection cassette was removed y flippase-mediated recomination. () Breeding pod-cre and f/f mice results in podocyte specific deletion. (c-e) PAS stains show normal nephron and glomerular development, and no significant difference in nephrogenic zone etween wild type and mutants. (f-h) Transmission electron micrograph of renal glomeruli from wild type and mutant mice. (i-k) Inset of panels f-h. (f, i) Wild type glomeruli show normal ultrastructure including split immature GBM (arrow). (j) +/- glomeruli show foot process effancement (red arrow), tight junctions (yellow arrows) and some slit diaphragms (lue arrows). (k) -/- glomeruli show complete foot process effancement (red arrows), normal endothelium and GBM. Scale ars = 1 mm (d-e) and 2 mm (g-i). Pod, podocyte; cap, capillary.
6 a Ac-a-TUBULIN CEP164 c Control d Control e % of ciliated cells n.s. Control Supplementary Figure 6. A truncating mutation in does not cause defects in cilia. (a,) Firolasts from control and affected individuals were grown on coverslips, serum starved for 48 hr, then fixed and processed for immunofluorescence with antiodies against acetylated-a-tuulin and CEP164 antiodies to stain ciliary axoneme and centrosome, respectively. There was no defect in ciliation. Scale ar: 1 mm. (c,d) Transmission electron microscopy (TEM) images of firolasts from healthy control and who carries a homozygous c.393_396del:p.p132cfs11 mutation in. Firolasts were serum-starved for 48 hours efore proceeding for TEM. Note that the cilium in firolasts does not have any appreciale structural defect. Scale ar:.5 mm. (e) The aility of cells to form cilia, in cells with a unique rod like acetylated-a-tuulin staining was quantified from images. Graphs show the mean + standard deviation of three independent experiments, in which at least 6 cells were counted. n.s., not significant, t-test.
7 Relative intensity (a.u.) amled shrna #1 shrna #2 shrna #3 shrna #4 Relative intensity (a.u.) a 1 RHOA ACTIN c 1 1 CDC GTPound GTPound d Relative intensity (a.u.) 1 1 RAC1 GTPound Supplementary Figure 7. Effects of knockdown on RHO GTPase activity in cells. (a) Stale knockdown of in using lentivirus-mediated shrnas demonstrates efficient knockdown y all four shrnas. (-c) Quantification of RHOA (), CDC42 (c), and RAC1 (d) in -depleted cells compared to control cells. Error ars indicate the standard deviaion for three independent experments for RHOA and four independent experiment for CDC42 and RAC1. <.5, t-test.
8 Undifferentiated Differentiated amled amled sirna#2 Firolasts Cont Serum starvation Firolasts Cont Serum starvation Ponceau S staining : RHOA Ponceau S staining : CDC42 : RAC1 Podocyte Podocyte (differentiated) Supplementary Figure 8a. Full scans of Western lot data corresponding to Fig 2a, 4e, 4f, Supplementary Fig. 2a and 2c..
9 amled shrna #1 shrna #2 shrna #3 shrna #4 amled shrna #1 shrna #2 shrna #3 shrna #4 Ponceau S staining : RAC1 : CDC FLAG-CDC42-T17N Ponceau S staining : RHOA FLAG-CDC42-T17N FLAG-CDC42-T17N : CDC42(FLAG) Supplementary Figure 8. Full scans of Western lot data corresponding to Supplementary Fig. 3a, 3, 4c and 7a.
10
11 Supplementary Tale 2. Oligonucleotide sequences used in this study Target sequences of sirnas # sirna GGAAGGAATTGGAATCGTT sirna#2 CAAGATGGGTGTTTACATT sirna TCACATGATTGGAGTAATA sirna CAAGGAAGCTCGTTCACAA Target sequences of shrnas GCCGAGGGAATAGGTATTATT shrna #2 CCACCCAATTACTCAGTGAAA shrna #3 GCCACGTCATTCGCTATGTTA shrna #4 CGCCACGATTACTCTCAATAA #For, a pool of the listed four sirnas was transfected into cultured podocytes, whereas for sirna#2, a single sirna was transfected.
Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42
Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42 Gina L. Razidlo, Kevin M. Burton, and Mark A. McNiven SUPPORTING INFORMATION Figure S1. IL-6 promotes
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
Supplementary Information
Supplementary Information CEP41 is mutated in Joubert syndrome and is required for tubulin glutamylation at the cilium Ji Eun Lee, Jennifer L. Silhavy, Maha S. Zaki, Jana Schroth, Stephanie L. Bielas,
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +
FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP
Loss of RhoA promotes skin tumor formation. Supplementary Figure 1. Loss of RhoA does not impair F-actin organization.
Supplementary Figure Legends Supplementary Figure 1. Loss of RhoA does not impair F-actin organization. a. Representative IF images of F-actin staining of big and small control (left) and RhoA ko tumors
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
Supplementary Figure 1. MLN8237 treatments show an unusual camel-back response pattern.
Supplementary Figure 1. MLN8237 treatments show an unusual camel-ack response pattern. NCI-H1819 cells were treated with serial concentrations of MLN8237 and four days after treatment, cell viaility was
Supplementary Information
1 Supplementary Information A role for primary cilia in glutamatergic synaptic integration of adult-orn neurons Natsuko Kumamoto 1,4,5, Yan Gu 1,4, Jia Wang 1,4, Stephen Janoschka 1,2, Ken-Ichi Takemaru
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects
a 0,8 Figure S1 8 h 12 h y = 0,036x + 0,2115 y = 0,0366x + 0,206 Labeling index Labeling index ctrl shrna Time (h) Time (h) ctrl shrna S G2 M G1
(GFP+ BrdU+)/GFP+ Labeling index Labeling index Figure S a, b, y =,x +, y =,x +,,,,,,,, Time (h) - - Time (h) c d S G M G h M G S G M G S G h Time of BrdU injection after electroporation (h) M G S G M
A. Generation and characterization of Ras-expressing autophagycompetent
Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in
(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Supplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Supplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation
Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal
Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal hydrocephalus Fadel TISSIR, Yibo QU, Mireille MONTCOUQUIOL, Libing ZHOU, Kouji KOMATSU, Dongbo SHI, Toshihiko FUJIMORI,
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3076 Supplementary Figure 1 btrcp targets Cep68 for degradation during mitosis. a) Cep68 immunofluorescence in interphase and metaphase. U-2OS cells were transfected with control sirna
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
Supplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
Phosphoinositides Regulate Ciliary Protein Trafficking to Modulate Hedgehog Signaling
Developmental Cell Supplemental Information Phosphoinositides Regulate Ciliary Protein Trafficking to Modulate Hedgehog Signaling Francesc R. Garcia-Gonzalo, Siew Cheng Phua, Elle C. Roberson, Galo Garcia
Ctrl CCT7 CCT2 GAPDH * * ** ** * Ctrl Size of LC3 dots (a.u.) mrfp GFP mrfp-gfp-lc3 CCT5 KD CCT7 KD
CCT7 Size of dots (a.u.) CCT7 CCT7 /GAPH deitometry (a.u.) /GAPH deitometry (a.u.) a CCT7 Primary cortical neuro 55 CCT5 55 CCT7 55 CCT7 55 55 55 c 3 25 2 DMSO 2 8 Bafilomycin A 5 6 4 5 2 2 3 2 3 d mrfpgfp
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
RENAL HISTOPATHOLOGY
RENAL HISTOPATHOLOGY Peter McCue, M.D. Department of Pathology, Anatomy & Cell Biology Sidney Kimmel Medical College There are no conflicts of interest. 1 Goals and Objectives! Goals Provide introduction
Supplementary Information
Supplementary Information Concerted action of cellular JNK and Pin1 restricts HIV1 genome integration to activated CD4 T lymphocytes Lara Manganaro 1, Marina Lusic 1,#, Maria Ines Gutierrez 1, Anna Cereseto
Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain.
Supplementary Figure 1 PICALM expression in brain capillary endothelium in human brain and in mouse brain. a, Double immunostaining for PICALM (red, left) and lectin positive endothelial profiles (blue,
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage
Primary Cilia Can Both Mediate and Suppress Hedgehog Pathway- Dependent Tumorigenesis (Supplementary Figures and Materials)
Primary Cilia Can Both Mediate and Suppress Hedgehog Pathway- Dependent Tumorigenesis (Supplementary Figures and Materials) Sunny Y. Wong, Allen D. Seol, Po-Lin So, Alexandre N. Ermilov, Christopher K.
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
Supplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
Supplemental information
Supplemental information PI(3)K p11δ controls the sucellular compartmentalization of TLR4 signaling and protects from endotoxic shock Ezra Aksoy, Salma Taoui, David Torres, Sandrine Delauve, Aderrahman
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
SUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade
The topic of normal vascular and glomerular anatomy is introduced
Normal Vascular and Glomerular Anatomy Arthur H. Cohen Richard J. Glassock The topic of normal vascular and glomerular anatomy is introduced here to serve as a reference point for later illustrations of
SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.
Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used
Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
Overview of glomerular diseases
Overview of glomerular diseases *Endothelial cells are fenestrated each fenestra: 70-100nm in diameter Contractile, capable of proliferation, makes ECM & releases mediators *Glomerular basement membrane
Sirt1 Hmg20b Gm (0.17) 24 (17.3) 877 (857)
3 (0.17) 24 (17.3) Sirt1 Hmg20 Gm4763 877 (857) c d Suppl. Figure 1. Screen validation for top candidate antagonists of Dot1L (a) Numer of genes with one (gray), two (cyan) or three (red) shrna scored
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding
Supplemental Information. Supernumerary Centrosomes. Nucleate Extra Cilia and Compromise. Primary Cilium Signaling. Current Biology, Volume 22
Current Biology, Volume 22 Supplemental Information Supernumerary Centrosomes Nucleate Extra Cilia and Compromise Primary Cilium Signaling Moe R. Mahjoub and Tim Stearns Supplemental Inventory 1. Supplemental
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11700 Figure 1: RIP3 as a potential Sirt2 interacting protein. Transfected Flag-tagged Sirt2 was immunoprecipitated from cells and eluted from the Sepharose beads using Flag peptide.
Supplemental Figures
Supplemental Figures Supplemental Figure 1. Fasting-dependent regulation of the SREBP ortholog SBP-1 and lipid homeostasis mediated by the SIRT1 ortholog SIR-2.1 in C. elegans. (A) Wild-type or sir-2.1(lof)
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
supplementary information
DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin
Supplementary Figure S1
Supplementary Figure S1 Supplementary Figure S1. PARP localization patterns using GFP-PARP and PARP-specific antibody libraries GFP-PARP localization in non-fixed (A) and formaldehyde fixed (B) GFP-PARPx
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/3/8/e1700521/dc1 Supplementary Materials for Functional vascularized lung grafts for lung bioengineering N. Valerio Dorrello, Brandon A. Guenthart, John D. O Neill,
Supplementary Figure 1
Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
Supplementary Figure 1 a OD c. 1. 1... Time [min] 1 p effects on organ development. a-f, Eye and wing discs with clones of ε j2b10 show no
Supplementary Figure 1. Loss of function clones of 14-3-3 or 14-3-3 show no significant effects on organ development. a-f, Eye and wing discs with clones of 14-3-3ε j2b10 show no obvious defects in Elav
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
tom tom 24hpf tom tom 48hpf tom 60hpf tom tom 72hpf tom
a 24hpf c 48hpf d e 60hpf f g 72hpf h i j k ISV ISV Figure 1. Vascular integrity defects and endothelial regression in mutant emryos. (a,c,e,g,i) Bright-field and (,d,f,h,j) corresponding fluorescent micrographs
Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the
Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)
Supplementary Materials for VAMP4 directs synaptic vesicles to a pool that selectively maintains asynchronous neurotransmission
Supplementary Materials for VAMP4 directs synaptic vesicles to a pool that selectively maintains asynchronous neurotransmission Jesica Raingo, Mikhail Khvotchev, Pei Liu, Frederic Darios, Ying C. Li, Denise
Tankyrase 1 regulates centrosome function by controlling CPAP stability
Manuscript EMBOR-2011-35655 Tankyrase 1 regulates centrosome function by controlling CPAP stability Mi Kyung Kim, Charles Dudognon and Susan Smith Corresponding author: Susan Smith, The Skirball Institute
Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
SUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
Supplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
Bone Marrow Pop. (% Total) Mature Pool (Absolute %) Immature Pool (Absolute %) A10 EC Control A10 EC Control A10 EC Control
Bone Marrow Pop. (% Total) Mature Pool (Asolute %) Immature Pool (Asolute %) A10 EC A10 EC A10 EC Myeloid 50.7 57.5 37.5 46.2 13.2 11.3 Erythroid 38.3 23.2 33.3 16.8 9.3 6.3 Lymphocytes 13.8 19.0 - - -
Probe. Hind III Q,!?R'!! /0!!!!D1"?R'! vector. Homologous recombination
Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!
p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
Nature Medicine doi: /nm.2860
Supplemental Figure Legends Supplemental Figure 1: Hypomorphic expression of IFT88 results in olfactory signaling proteins no longer localizing to the ciliary layer. (a) ACIII localizes to the cilia and
(a-r) Whole mount X-gal staining on a developmental time-course of hearts from
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Supplementary Figure 1 (a-r) Whole mount X-gal staining on a developmental time-course of hearts from Sema3d +/- ;Ephb4 LacZ/+ and Sema3d -/- ;Ephb4 LacZ/+ embryos.
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Díaz et al., http://www.jcb.org/cgi/content/full/jcb.201209151/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Hypoxia induces invadopodia formation in different epithelial
293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell
Supplementary Figure 1
Supplementary Figure 1 Kif1a RNAi effect on basal progenitor differentiation Related to Figure 2. Representative confocal images of the VZ and SVZ of rat cortices transfected at E16 with scrambled or Kif1a
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±
Nature Immunology: doi: /ni.3866
Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin
Nature Immunology doi: /ni.3268
Supplementary Figure 1 Loss of Mst1 and Mst2 increases susceptibility to bacterial sepsis. (a) H&E staining of colon and kidney sections from wild type and Mst1 -/- Mst2 fl/fl Vav-Cre mice. Scale bar,
Supplementary Information
Supplementary Information Supplementary Figure 1: Luminal localization of CCM-3. (a) The CCM-3::GFP fusion protein localizes along the apical (luminal) surface of the pharynx (b) as well as the lumen of
a Anti-Dab2 RGD Merge
a Anti-Da Merge *** ** Percentage of cells adhered 8 6 4 RGE RAD RGE RAD Supplementary Figure Da are localized at clusters. (a) Endogenous Da is localized at clusters. (), ut not RGE nor RAD peptides can
Expanded View Figures
PEX13 functions in selective autophagy Ming Y Lee et al Expanded View Figures Figure EV1. PEX13 is required for Sindbis virophagy. A, B Quantification of mcherry-capsid puncta per cell (A) and GFP-LC3
Supplementary Figure 1. Mother centrioles can reduplicate while in the close association
C1-GFP distance (nm) C1-GFP distance (nm) a arrested HeLa cell expressing C1-GFP and Plk1TD-RFP -3 s 1 2 3 4 5 6 7 8 9 11 12 13 14 16 17 18 19 2 21 22 23 24 26 27 28 29 3 b 9 8 7 6 5 4 3 2 arrested HeLa
Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR
Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR and LRRK2 WD40 GST fusion proteins (5 µg) were loaded
Supplementary Information. Supplementary Figure 1
Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
Surgical Pathology Report
Louisiana State University Health Sciences Center Department of Pathology Shreveport, Louisiana Accession #: Collected: Received: Reported: 6/1/2012 09:18 6/2/2012 09:02 6/2/2012 Patient Name: Med. Rec.
Supplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
Neocortex Zbtb20 / NFIA / Sox9
Neocortex / NFIA / Sox9 Supplementary Figure 1. Expression of, NFIA, and Sox9 in the mouse neocortex at. The lower panels are higher magnification views of the oxed area. Arrowheads indicate triple-positive