GW(g)/BW(g) GW(g)/BW(g) Con Dex Con Dex. GW(g)/BW(g) Relative mrna levels. Atrogin-1 Murf-1. Atrogin-1 Murf-1. Soleus
|
|
- Agnes Woods
- 5 years ago
- Views:
Transcription
1 a b c GW(g) GW(g) GW(g) Den * ** GW(g)/BW(g) Den Dex Dex GW(g)/BW(g) d 0.00 Fasting GW(g) e 0.15 Cancer Cachexia f GW(g) Young ** Old g GW(g)/BW(g) Young Old Relative mir-29b level Atrogin-1 Murf-1 TA Atrogin-1 Murf-1 Soleus Atrogin-1 Murf-1 Supplementary Figure 1. Multiple types of muscle atrophy in vivo (a) Gastrocnemius muscle weight (GW) and gastrocnemius muscle weight/body weight (GW/BW) ratio were reduced in denervation (Den) mice compared to control () group (n=5 per group). (b) GW and GW/BW ratio were reduced in dexamethasone (Dex)-treated mice compared to control group (n=5 per group). (c) GW was reduced in fasting mice compared to control group (n=5 per group). (d) GW was reduced in cancer cachexia mice compared to control group (n=5 per group). (e) GW and GW/BW ratio were reduced in ageing (Old) mice compared to control (Young) mice (n=4 per group). (f) qrt-pcr analysis of mir-29b expression in gastrocnemius muscle from denervation rat at day 3, 5, 7, and 14, compared to controls (n=5 per group). (g) qrt-pcr analysis showed increased Atrogin-1, Murf-1, and mir-29b expressions in tibialis anterior (TA), soleus, and extensor digitorum longus (EDL) from denervation mice compared to controls (n=5 per group). Error bars, SEM. An unpaired, two-tailed Student s t test was used for comparisons between two groups (a-e, g). One-way ANOVA test was performed to compare multiple groups followed by Bonferroni's post hoc test (f). *, P<0.05. **, P<0.01. EDL Relative mir-29b level TA Soleus EDL
2 a TNF-α Relative diameter of myotube TNF-α Relative mir-29b level Atrogin-1 Murf-1 TNF-α b H 2 O 2 Relative diameter of myotube H 2 O 2 Relative mir-29b level Atrogin-1 Murf-1 H 2 O 2 Supplementary Figure 2. mir-29b is increased in muscle atrophy cell models (a) TNF-α (100 ng/ml) induced muscle atrophy in C2C12 myotubes as evidenced by reduced myotube diameter, accompanied with increased Atrogin-1, Murf-1, and mir-29b expression levels (n=4 per group, scale bar: 100 μm). (b) H 2 O 2 (400 μm) induced muscle atrophy in C2C12 myotubes as evidenced by reduced myotube diameter, accompanied with increased Atrogin-1, Murf-1, and mir-29b expression levels (n=4 per group, scale bar: 100 μm). Error bars, SEM. An unpaired, two-tailed Student s t test was used for comparisons between two groups. *, P<0.05. **, P<0.01.
3 a Relative mir-29b level Fugw Fugw-miR-29b b Fugw Fugw-miR-29b Relative diameter of myotube Fugw Fugw-miR-29b c Fugw Fugw-miR-29b Atrogin-1 * * Murf-1 Supplementary Figure 3. mir-29b is sufficient to induce muscle atrophy in vitro (a) qrt-pcr analysis showed increased mir-29b expression in C2C12 myotubes transfected with FugwmiR-29b compared to Fugw control (n=6 per group). (b) Immunofluorescent staining for C2C12 myotubes showed reduced myotube diameter when transfected with Fugw-miR-29b (n=4 per group, scale bar: 100 μm). (c) qrt-pcr analysis showed up-regulated Atrogin-1 and Murf-1 expressions in C2C12 myotubes transfected with Fugw-miR-29b (n=6 per group). Error bars, SEM. An unpaired, two-tailed Student s t test was used for comparisons between two groups. *, P<0.05. **, P<0.01.
4 a b CK(ng/mL) NC-i+TNF-α mir-29b-i+tnf-α NC-i+H 2 O 2 mir-29b-i+h 2 O 2 CK(ng/mL) Atrogin-1 Atrogin-1 Murf-1 Murf-1 Relative diameter of myotube Relative diameter of myotube Supplementary Figure 4. mir-29b is necessary for muscle atrophy in vitro (a) mir-29b inhibition attenuated TNF-α (100 ng/ml) induced muscle atrophy in C2C12 myotubes as determined by myotube diameter (n=4 per group, scale bar: 100 μm), creatine kinase (CK) activity (n=6 per group), and Atrogin-1 and Murf-1 expressions (n=6 per group). (b) mir-29b inhibition attenuated H 2 O 2 (400 μm) induced muscle atrophy in C2C12 myotubes as determined by myotube diameter (n=4 per group, scale bar: 100 μm), creatine kinase (CK) activity (n=6 per group), and Atrogin-1 and Murf-1 expressions (n=6 per group). Error bars, SEM. One-way ANOVA test was performed to compare multiple groups followed by Bonferroni's post hoc test. *, P<0.05. **, P<0.01.
5 a Dex TNF-α H 2 O 2 b Relative to Relative to Relative to * * H 2 O 2 Den Dex Fasting Relative to Relative to Relative to * ** Fasting Supplementary Figure 5. and are reduced in muscle atrophy (a) Western blot showed that and were down-regulated in dexamethasone (Dex)-, TNF-α-, and H 2 O 2 -induced muscle atrophy in vitro (n=3 per group). (b) Western blot showed that and were down-regulated in denervation (Den)-, Dex-, and fasting-induced muscle atrophy in vivo (n=3 per group). Error bars, SEM. The presented blots are representative samples of three independent experiments. An unpaired, two-tailed Student s t test was used for comparisons between two groups. *, P<0.05. **, P<0.01.
6 a (S473) T-AKT (S253) T-FOXO3A Den P-mTOR T-mTOR P-P70S6K T-P70S6K Den Relative protein levels b Dex Dex (S473) T-AKT (S253) T-FOXO3A P-mTOR T-mTOR P-P70S6K T-P70S6K Relative protein levels c (S473) T-AKT (S253) T-FOXO3A Fasting P-mTOR T-mTOR P-P70S6K T-P70S6K Fasting Relative protein levels Supplementary Figure 6. -AKT Signaling is decreased in muscle atrophy (a) Western blot showed that the -AKT signaling (AKT, FOXO3A, mtor, and P70S6K phosphorylation levels) was down-regulated in denervation (Den)-induced muscle atrophy mouse model (n=3 per group). (b) Western blot showed that the -AKT signaling was down-regulated in dexamethasone (Dex)-induced muscle atrophy mouse model (n=3 per group). (c)western blot showed that the -AKT signaling was down-regulated in fasting-induced muscle atrophy mouse model (n=3 per group). Error bars, SEM. An unpaired, two-tailed Student s t test was used for comparisons between two groups. *, P<0.05.
7 a b c NC agomir mir-29b agomir % Distribution typei typeiia typeiib d f Myod Myog Myf5 e g IL-1α IL-1β IL-6 h NC agomir mir-29b agomir Relative to PI3K(P85α) i ( S473) T-AKT (S253) T-FOXO3A NC agomir mir-29b agomir (S473)/AKT (S253)/FOXO3A P-mTOR T-mTOR P-P70S6K T-P70S6K NC agomir mir-29b agomir P-mTOR/mTOR P-P70S6K/P70S6K * Supplementary Figure 7. mir-29b is sufficient to induce muscle atrophy in vivo (a) Cross sections of gastrocnemius were stained with MHC antibodies to identify type I (blue), type IIA
8 (green), and type IIB (red) muscle fibers, and to quantify myofiber type distribution in NC agomir and mir- 29b agomir treated mice (n=3 per group, scale bar: 50 μm). (b-e) qrt-pcr analysis of other ubiquitin ligases-related genes (b), autophagy-related genes (c), degeneration/regeneration-related genes (d), and inflammation-related genes (e) in the gastrocnemius from mice treated with mir-29b agomir (n=5 per group). (f)qrt-pcr analysis showed up-regulated transcriptional markers of denervation (Musk, Achra, Achre, Achrg, Cpla2, Ncam, andrunx1) in the gastrocnemius from denervated (Den) mice compared to controls (n=5 per group). (g) qrt-pcr analysis showed up-regulated transcriptional markers of denervation (Achre and Cpla2) in the gastrocnemius from mice treated with mir-29b agomir (n=5 per group). (h) Western blot showed that and were down-regulated in mir-29b agomir treated mice (n=3 per group). (i)western blot showed that the -AKT signaling (AKT, FOXO3A, mtor, and P70S6K phosphorylation levels) was down-regulated in mir-29b agomir treated mice (n=3 per group). Error bars, SEM. An unpaired, two-tailed Student s t test was used for comparisons between two groups. *, P<0.05. **, P<0.01.
9 a PI3K(p85a)/ / b (S473) T-AKT (S253) T-FOXO3A (S473)/AKT (S253)/FOXO3A P-mTOR T-mTOR P-P70S6K T-P70S6K P-mTOR/mTOR P-P70S6K/P70S6K Supplementary Figure 8. mir-29b is necessary for muscle atrophy in vivo (a) Western blot analysis showed that and were up-regulated in the gastrocnemius from mice treated with mir-29b sponge compared to Fugw control in the presence or absence of denervation (Den) (n=3 per group). (b)western blot analysis showed increased phosphorylation levels of AKT, FOXO3A, mtor, and P70S6K in the gastrocnemius from mice treated with mir-29b sponge compared to Fugw control in the presence or absence of denervation (Den) (n=3 per group). Error bars, SEM. One-way ANOVA test was performed to compare multiple groups followed by Bonferroni's post hoc test.*, P<0.05.
10 a GW(g) d GW(g)/BW(g) b Atrogin-1 e Murf-1 c Relative mir-29b level Relative mir-29b level TA Soleus EDL Relative mir-29b levels f TA Soleus EDL Fugw+sham Fugw+Imo mir-29b sponge +sham mir-29b sponge +Imo g h Fugw+Sham Fugw+Imo i 85KD mir-29b sponge+sham mir-29b sponge+imo Feret Diameter Atrogin-1 Murf-1 / / GW(g) GW(g)/BW(g) Supplementary Figure 9. mir-29b in immobilization-induced muscle atrophy (a) Gastrocnemius muscle weight (GW) and Gastrocnemius muscle weight/body weight (GW/BW) ratio
11 were reduced in immobilization mice compared to control group (n=6 per group). (b) qrt-pcr showed that Atrogin-1 and Murf-1 were up-regulated in the gastrocnemius from immobilization mice (n=6 per group). (c) qrt-pcr showed that mir-29b was up-regulated in the gastrocnemius from immobilization mice (n=6 per group). (d) qrt-pcr analysis showed increased Atrogin-1, Murf-1, and mir-29b expressions in the tibialis anterior (TA), soleus, and extensor digitorum longus (EDL) from immobilization mice compared to controls (n=6 per group). (e) qrt-pcr showed that mir-29b sponge significantly decreased mir-29b expression in the gastrocnemius (n=5 per group). (f) Gastrocnemius muscle morphology, GW, and GW/BW ratio showed that mir-29b sponge at least partly blocked immobilization-induced muscle atrophy (n=5 per group, scale bar: 1 cm). (g) qrt-pcr analysis showed that Atrogin-1 and Murf-1 were no longer up-regulated in immobilization mice treated with mir-29b sponge (n=5 per group). (h) Hematoxylin-eosin (HE) staining showed that the reduction in muscle fiber diameter in immobilization mice was partly attenuated by mir- 29b sponge (n=5 per group, scale bar: 50 μm). (i) Western blot analysis showed that the down-regulation of and expression levels in immobilization mice were blocked by mir-29b sponge (n=3 per group). Age and sex matched mice were used for experiments randomly. Error bars, SEM. An unpaired, twotailed Student s t test was used for comparisons between two groups (a-d). One-way ANOVA test was performed to compare multiple groups followed by Bonferroni's post hoc test (e-i). *, P<0.05. **, P<0.01.
12 Supplementary Figure 10. Uncropped scans of Western blots Western blots for Fig.5b 26KD 26KD Western blots for Fig.5c Western blots for Fig.5d (T308) (T308) (S473) (S473) T-AKT T-AKT (S253) (T32) (S253) T-FOXO3A (T32) T-FOXO3A P-mTOR 250KD T-mTOR 250KD P-mTOR 315KD 250KD P-P70S6K T-mTOR 315KD 250KD T-P70S6K P-P70S6K P-4EBP1 T-P70S6K P-4EBP1 T-4EBP1 T-4EBP1
13 Western blots for Fig.7d Western blots for Fig.8i 130KD YY1 65KD Ubiquitin 43KD YY1 65KD Western blots for Fig.8k YY1 65KD Myosin/ MHC 250KD 180KD 227KD Western blots for Fig.8l P62 62KD LC3-I LC3-II 18KD 16KD
14 Western blots for Sup Fig.5a Western blots for Sup Fig.5b 26KD 26KD 26KD 26KD 26KD
15 Western blots for Sup Fig.6a (S473) P-mTOR 250KD T-AKT T-mTOR 250KD (S253) P-P70S6K T-P70S6K T-FOXO3A Western blots for Sup Fig.6b P-mTOR 250KD (S473) T-mTOR 250KD T-AKT P-P70S6K (S253) T-P70S6K T-FOXO3A
16 Western blots for Sup Fig.6c (S473) P-mTOR 315KD T-AKT T-mTOR 315KD (S253) P-P70S6K T-FOXO3A T-P70S6K Western blots for Sup Fig.7h 26KD
17 Western blots for Sup Fig.7i ( S473) P-mTOR 315KD T-AKT T-mTOR 315KD (S253) P-P70S6K T-FOXO3A T-P70S6K Western blots for Sup Fig.8a
18 Western blots for Sup Fig.8b (S473) P-mTOR 315KD 250KD T-AKT T-mTOR 315KD 250KD (S253) P-P70S6K T-FOXO3A T-P70S6K Western blots for Sup Fig.9i 85KD 26KD
19 Supplementary Table 1.Aberrant expressed micrornas in denervated muscle MicroRNA Regulation Fold change P value mir-130b up mir-21 up mir-29b up mir-212 up mir-672 up mir-223 up mir-222 up mir-221 up mir-203 up mir-132 up mir-511* up mir-146b up mir-133a* down mir-1949 up mir-326 up
20 Supplementary Table 2. sirna sequences used in this study Gene mmu-yy1 Sequence (5'-3') GCCCTCATAAAGGCTGCAC CCCTAAGCAACTGGCAGAA mmu- GCCTTCCAACTCAATTATT GCCTCTGTGACTTCTTGAA
21 Supplementary Table 3. Primer sequences for qrt-pcrs used in this study Gene Forward primer(5'-3') Reverse primer(5'-3') rno-atrogin-1 TTCCATCAGGAGAAGTGGATCT GGCAGTCGAGAAGTCCAGTC rno-murf-1 CACGAAGACGAGAAAATCAACA TGTCCTTGGAAGATGCTTTGTA rno-18s TCAAGAACGAAAGTCGGAGG GGACATCTAAGGGCATCAC mmu-mhc GAGGGTGGCTCTCACACATTC TTGGCCTTCGTAAGCAAACTG mmu-myod CCACTCCGGGACATAGACTTG AAAAGCGCAGGTCTGGTGAG mmu-myog GAGACATCCCCCTATTTCTACCA GCTCAGTCCGCTCATAGCC mmu-myf5 AAGGCTCCTGTATCCCCTCAC TGACCTTCTTCAGGCGTCTAC mmu-il-1α CGAAGACTACAGTTCTGCCATT GACGTTTCAGAGGTTCTCAGAG mmu-il-1β GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT mmu-il-6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC mmu-yy1 CAGTGGTTGAAGAGCAGATCAT AGGGAGTTTCTTGCCTGTCAT mmu-traf6 AAAGCGAGAGATTCTTTCCCTG ACTGGGGACAATTCACTAGAGC
22 mmu-nedd4 TCGGAGGACGAGGTATGGG GGTACGGATCAGCAGTGAACA mmu-mul1 CTGGGCACCAGTTCGATGG GACAGCATAAGGCACACACTT mmu-znf216 CCCATGCTGTGTAGTACAGGA GCTCATTCTGCCACTATTCTGC mmu-fbxo40 CGTCTCCTGCCTGGTGATAAG GTATGCTCTGACTCTTTGCACAT mmu-murf2 AAAGCAACTGATCTGTCCCATC TGTGGGTAAGTACGGGTTAGAG mmu-murf3 GGAGAAGCAGCTCATTTGCC CCTCCTGAAGACACCGTTGTG mmu-cblb GGTCGCATTTTGGGGATTATTGA TTTGGCACAGTCTTACCACTTT mmu-atg7 GTTCGCCCCCTTTAATAGTGC TGAACTCCAACGTCAAGCGG mmu-map1-lc3 CACTGCTCTGTCTTGTGTAGGTTG TCGTTGTGCCTTTATTAGTGCATC mmu-cathepsinl GTGGACTGTTCTCACGCTCAAG TCCGTCCTTCGCTTCATAGG mmu-gabarapl1 CATCGTGGAGAAGGCTCCTA ATACAGCTGGCCCATGGTAG mmu-bnip3 TTCCACTAGCACCTTCTGATGA GAACACCGCATTTACAGAACAA mmu-bnip3l TTGGGGCATTTTACTAACCTTG TGCAGGTGACTGGTGGTACTAA mmu-atg12 TCCGTGCCATCACATACACA TAAGACTGCTGTGGGGCTGA
23 mmu-vps34 TGTCAGATGAGGAGGCTGTG CCAGGCACGACGTAACTTCT mmu-beclin TGAATGAGGATGACAGTGAGCA CACCTGGTTCTCCACACTCTTG mmu-atg4b ATTGCTGTGGGGTTTTTCTG AACCCCAGGATTTTCAGAGG mmu-tbp TGTGAATACTGGTGCTGAG GGCATGAGACAAGACCTATA mmu-musk TTCAGCGGGACTGAGAAACT TGTCTTCCACGCTCAGAATG mmu-achra TCCCTTCGATGAGCAGAACT GGGCAGCAGGAGTAGAACAC mmu-achre GTGTCTGGATTGGCATTGACT ACACCTGCAAAATCGTCCTTG mmu-achrg GACCAACCTCATCTCCCTGA GAGAGCCACCTCGAAGACAC mmu-cpla2 GACAGCTCCGACAGTGATGA CGTCCTTCTCGGGTATTGAA mmu-ncam AAGGGGAAGGCACTGAATTT TCTCCTGCCACTTGACACAG mmu-runx1 AGCCTGGCAGTGTCAGAAGT TGGCATCTCTCATGAAGCAC mmu-myh1 GCGAATCGAGGCTCAGAACAA GTAGTTCCGCCTTCGGTCTTG mmu-myh2 AAGTGACTGTGAAAACAGAAGCA GCAGCCATTTGTAAGGGTTGAC mmu-myh4 CTTTGCTTACGTCAGTCAAGGT AGCGCCTGTGAGCTTGTAAA
24 mmu-myh7 ACTGTCAACACTAAGAGGGTCA TTGGATGATTTGATCTTCCAGGG muu-atrogin-1 CAGCTTCGTGAGCGACCTC GGCAGTCGAGAAGTCCAGTC Mmu- GTGGGGGCTCGTGTTTCTC GATCACCGTGCAGTTTTCCA mmu-murf-1 GTGTGAGGTGCCTACTTGCTC GCTCAGTCTTCTGTCCTTGGA mmu-18s TCAAGAACGAAAGTCGGAGG GGACATCTAAGGGCATCAC
Supplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationSupplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationSupplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
More informationSupplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated
Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationInsulin and IGF-1 receptors regulate FoxOmediated signaling in muscle proteostasis
Insulin and IGF-1 receptors regulate FoxOmediated signaling in muscle proteostasis Brian T. O Neill,, K. Sreekumaran Nair, C. Ronald Kahn J Clin Invest. 2016;126(9):3433-3446. https://doi.org/10.1172/jci86522.
More informationSUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationSerum cytokine levels in control and tumor-bearing male and female mice at day 15.
Supplementary Table 1. Serum cytokine levels in control and tumor-bearing male and female mice at day 15. Male Female Cytokine Control C-26 Control C-26 IL-1β 2.0 ± 0.8 9.6 ± 1.5* 1.8 ± 0.2 6.8 ± 1.4*
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationSupplementary Figure 1. Satellite cell contribution to myofibers in whole. gastrocnemius/plantaris/soleus, diaphragm, and EOM of 12 or 20 month
Keefe et al. p. 1 Supplementary Figure 1. Satellite cell contribution to myofibers in whole muscles. (a-l) Representative cross-sections through whole TA/EDL, gastrocnemius/plantaris/soleus, diaphragm,
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationSupplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
More informationSupplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
More informationSupplementary Figure 1
Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationSupplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
More informationSupplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression
More informationFigure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with
Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with isografts (control) at the 2nd week, 4th and 8th week by RT-PCR. At the advanced stage, the expression of these three
More informationTRAF6 regulates satellite stem cell self-renewal and function during regenerative myogenesis
The Journal of Clinical Investigation TRAF6 regulates satellite stem cell self-renewal and function during regenerative myogenesis Sajedah M. Hindi and Ashok Kumar Department of Anatomical Sciences and
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationmir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons
Supplemental Material mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons Antoine de Chevigny, Nathalie Coré, Philipp Follert, Marion Gaudin, Pascal
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationA Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis NTD Number of embryos % among NTD Embryos Exencephaly 52 74.3% Craniorachischisis 6 8.6% Spina bifida 5 7.1% Microcephaly 7 1% B Normal
More informationSupplementary Table 1.
Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA
More informationNature Medicine: doi: /nm.4324
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression
More informationInhibition of Stat3 signaling ameliorates atrophy of the soleus muscles in mice lacking the vitamin D receptor
Gopinath Skeletal Muscle (17) 7: DOI 1.1186/s1339-17-11- RESEARCH Open Access Inhibition of Stat3 signaling ameliorates atrophy of the soleus muscles in mice lacking the vitamin D receptor Suchitra D.
More information9/16/2009. Fast and slow twitch fibres. Properties of Muscle Fiber Types Fast fibers Slow fibers
Muscles, muscle fibres and myofibrils Fast and slow twitch fibres Rat hindlimb muscle ATPase staining at different ph and NADH Muscle fibre shortening velocity lengths/second Properties of Muscle Fiber
More informationInsights into the role and regulation of TCTP in skeletal muscle
/, 2017, Vol. 8, (No. 12), pp: 18754-18772 Insights into the role and regulation of TCTP in skeletal muscle Craig A. Goodman 1,2,3, Allison M. Coenen 1, John W. Frey 1, Jae-Sung You 1, Robert G. Barker
More informationAutophagy-regulating TP53INP2 mediates muscle wasting and is repressed in diabetes
Autophagy-regulating TP53INP2 mediates muscle wasting and is repressed in diabetes David Sala,, Antonio L. Serrano, Antonio Zorzano J Clin Invest. 2014;124(5):1914-1927. https://doi.org/10.1172/jci72327.
More informationE3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination
E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments
More informationMuscles, muscle fibres and myofibrils
Muscles, muscle fibres and myofibrils Properties of Muscle Fiber Types Fast fibers Slow fibers Characteristic IIb IIx IIa Type I V max (speed of shortening) Highest Intermediate Low Resistance to fatigue
More informationSupplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationSupplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b.
Supplementary Figure 1 Cell line TRIB2 status. TRIB2 protein expression to determine endogenous expression and to determine the effectiveness of each of our TRIB2 knockdown constructs. Supplementary Figure
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationThe Effect of Cancer Cachexia Severity and Eccentric Muscle Contractions on Selected Myofiber Metabolic Properties in Mouse Skeletal Muscle
University of South Carolina Scholar Commons Theses and Dissertations 1-1-2013 The Effect of Cancer Cachexia Severity and Eccentric Muscle Contractions on Selected Myofiber Metabolic Properties in Mouse
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationSupplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists
Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists of: (i) the YPet domain (an enhanced YFP); (ii) the
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationSupplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
More informationUrolithin B, a newly identified regulator of skeletal muscle mass
Journal of Cachexia, Sarcopenia and Muscle (2017) Published online in Wiley Online Library (wileyonlinelibrary.com) ORIGINAL ARTICLE Urolithin B, a newly identified regulator of skeletal muscle mass Julie
More informationTitle: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events
Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Pu Yang 1, 3, radley M. Schmit 1, Chunhua Fu 1, Kenneth DeSart 1, S. Paul
More informationSchwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis
Schwarz et al Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis and Sorting Pathway Supplemental Data Supplemental Fie 1: AMPARs undergo activity-mediated ubiquitination
More informationSUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171
SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationSupplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream signals in in vitro Symbol Gene ID RefSeqID Clone ID
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More informationSupplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.
1 Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. (a) Survival curves. WT Sham (n=5), WT CLP or WT CLP antibiotic
More informationmm Distance (mm)
b a Magnet Illumination Coverslips MPs Objective 2575 µm 1875 µm 1575 µm 1075 µm 875 µm 545 µm 20µm 2 3 0.5 0.3mm 1 1000 100 10 1 0.1 1000 100 10 1 0.1 Field Induction (Gauss) 1.5 0 5 10 15 20 Distance
More informationA. Generation and characterization of Ras-expressing autophagycompetent
Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in
More informationSupplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Long-term protection studies. 45 minutes of ischemia was induced in wild type (S1pr2 +/+ ) and S1pr2 -/- by MCAO. A) 5 days later brains were harvested
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
More informationSupplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation
Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,
More informationSupplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
More informationJunB Transcription Factor Maintains Skeletal Muscle Mass and Promotes Hypertrophy
JunB Transcription Factor Maintains Skeletal Muscle Mass and Promotes Hypertrophy The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters.
More informationSupplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationLai et al 2008 JCI RG-Revision 2
Lai et al 2008 JCI 36612-RG-Revision 2 Suppmentary Table 1. Epitope specific dystrophin antibodies Name Epitope Dilution Source Dys-3* Hinge 1 1:20 Novocastra Dys-1 Repeats 6-8 1:100 Novocastra Mandys8
More informationSUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
More informationHSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)
Supplementary Figure 1. Impaired insulin action in HSP72 deficient muscle and myotubes in culture cannot be explained by altered myogenesis or reduced total GLUT4 expression. Genes associated with myogenesis
More informationFigure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
More informationSupporting Information
Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,
More informationSupplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
More informationGFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
More informationNutrients, insulin and muscle wasting during critical illness
32 nd annual meeting of the Belgian Society of Intensive Care Medicine June 15, 212 Nutrients, insulin and muscle wasting during critical illness Sarah Derde Introduction Critical illness: feeding-resistant
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More informationhemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and
More informationThe Regulation of Skeletal Muscle Protein Turnover During the Progression of Cancer Cachexia in the Apc Min/+ Mouse
University of South Carolina Scholar Commons Faculty Publications Chemistry and Biochemistry, Department of 9-19-2011 The Regulation of Skeletal Muscle Protein Turnover During the Progression of Cancer
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta
More informationSupplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).
More informationSupplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationEPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationTcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W
A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary
More informationActivation of calcium signaling through Trpv1 by nnos and peroxynitrite as a key trigger of skeletal muscle hypertrophy
Activation of calcium signaling through Trpv y nnos and peroxynitrite as a key trigger of skeletal muscle hypertrophy Naoki Ito, Urs T. Ruegg, Akira Kudo, Yuko Miyagoe-Suzuki, and Shin ichi Takeda Supplementary
More informationHIGH-FAT DIET INDUCED OBESITY INCREASES SERUM MYOSTATIN, BUT DOES NOT ACCELERATE SKELETAL MUSCLE ATROPHY. Steven L. Roseno.
HIGH-FAT DIET INDUCED OBESITY INCREASES SERUM MYOSTATIN, BUT DOES NOT ACCELERATE SKELETAL MUSCLE ATROPHY by Steven L. Roseno Director of Thesis: Jeffrey J. Brault June, 2013 Major Department: Kinesiology
More informationSupplementary. limb. bars
Figure 1. CD163 -/- mice exhibit a similar phenotype ass WT mice in the absence of ischemic injury. a, Laser Doppler analysiss with perfusion quantitation at baseline (n= =10 per group). b, Immunostaining
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationSupplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast
More informationSupplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration
Supplementary Materials for c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Saurav Brahmachari, Preston Ge, Su Hyun Lee, Donghoon Kim, Senthilkumar S. Karuppagounder, Manoj
More informationSupplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
More informationRescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
More information