Autosomal-dominant Meesmann epithelial corneal dystrophy without an exon mutation in the keratin-3 or keratin-12 gene in a Chinese family

Transcription

1 Case Report Autosomal-dominant Meesmann epithelial corneal dystrophy without an exon mutation in the keratin-3 or keratin-12 gene in a Chinese family Journal of International Medical Research 41(2) ! The Author(s) 2013 Reprints and permissions: sagepub.co.uk/journalspermissions.nav DOI: / imr.sagepub.com Wei Cao 1, Ming Yan 2, QianYun Hao 2, ShuLin Wang 1, LiHua Wu 1, Qing Liu 1, MingYan Li 1, Fred G Biddle 3,4 and Wei Wu 1,5 Abstract Meesmann epithelial corneal dystrophy (MECD) is a dominantly inherited disorder, characterized by fragility of the anterior corneal epithelium and formation of intraepithelial microcysts. It has been described in a number of different ancestral groups. To date, all reported cases of MECD have been associated with either a single mutation in one exon of the keratin-3 gene (KRT3) or a single mutation in one of two exons of the keratin-12 gene (KRT12). Each mutation leads to a predicted amino acid change in the respective keratin-3 or keratin-12 proteins that combine to form the corneal-specific heterodimeric intermediate filament protein. This case report describes a fourgeneration Chinese kindred with typical autosomal-dominant MECD. Exon sequencing of KRT3 and KRT12 in six affected and eight unaffected individuals (including two spouses) did not detect any mutations or nucleotide sequence variants. This kindred demonstrates that single mis-sense mutations may be sufficient but are not required in all individuals with the MECD phenotype. It provides a unique opportunity to investigate further genomic and functional heterogeneity in MECD. Keywords Meesmann epithelial corneal dystrophy, KRT3, KRT12, autosomal dominant 1 Clinical Research Centre, People s Hospital of Zhengzhou, Zhengzhou, Henan, China 2 Medical School, Zhengzhou University, Zhengzhou, Henan, China 3 Department of Medical Genetics, University of Calgary, Calgary, Alberta, Canada 4 Department of Biological Sciences, University of Calgary, Calgary, Alberta, Canada 5 Department of Pathology and Experimental Medicine, University of Calgary, Calgary, Alberta, Canada Corresponding author: Dr Wei Cao, Clinical Research Centre, People s Hospital of Zhengzhou, 33 Yellow River Road, Zhengzhou, Henan 45003, China. caoweiyu@hotmail.com

2 512 Journal of International Medical Research 41(2) Date received: 20 November 2012; accepted: 2 December 2012 Introduction Meesmann epithelial corneal dystrophy (MECD) (OMIM ) is a dominantly inherited disorder of the corneal epithelium, characterized by intraepithelial microcysts of uniform size and shape. It was first reported in three families in northern Germany by Meesmann and Wilke 1 in 1939 and was later described in Irish, 2 Polish, 3 Swiss, 4 British, 5 American, 6 9 Japanese, 10 Taiwanese 11 and Chinese 12 families. MECD is a rare disease and registries of affected cases have not been established, therefore the prevalence and expected incidence of new cases are unknown. The clinical presentation of MECD is variable, ranging from mild to recurrent epithelial erosions, leading to lacrimation, photophobia and deterioration in visual acuity. Slit-lamp examination is considered to be the standard method for diagnosis, showing the typical corneal changes of surface irregularities and epithelial cysts, concentrated most commonly in the interpalpebral zone. Currently there is no specific therapy for MECD; treatment involves palliative relief and prevention of deterioration in visual acuity. Genetic studies have associated MECD with specific coding variations in the keratin-3 gene (KRT3) or the keratin-12 gene (KRT12). A protein heterodimer, composed of keratin-3 (a type II keratin) and keratin- 12 (a type I keratin), is expressed specifically in the corneal epithelium and is important for keratocyte stability. 13,14 Patterns of kinship-specific mutations in KRT3 or KRT12 have been demonstrated in patients with MECD (Table 1). Substitution mutations have only been reported in exon 7 of KRT3, 2,3,11 affecting the helix-termination domain of the keratin-3 protein, but mutational hotspots appear in both exon 1 1,2,5,7 10,12,14 19 and exon 6 4,6,7,10,11,20 of KRT12, affecting the helix-initiation and helix-termination domains, respectively, of the keratin-12 protein; in addition, an insertion mutation has been described in the helix-termination domain of the keratin-12 protein. 7 The only heritable mutations in MECD are mis-sense mutations that give rise to amino acid substitutions, in what are relatively specific domains of the keratin-3 and keratin-12 proteins. Direct sequencing of the coding exons of KRT3 and KRT12 appears to be an effective strategy to confirm the genetic cause of dominant MECD. Sequencing both KRT3 and KRT12 exons is critical, since sequence variants do not always co-segregate with MECD within a kinship. For example, a KRT12 exon mutation was detected in one family but did not co-segregate with the MECD phenotype; instead an exon 7 mutation in KRT3 co-segregated with the MECD trait and was considered to be the causative mutation. 3 There is therefore the potential for genomic heterogeneity to be uncovered in MECD, but to date only a few, rare, dominant-negative mutations appear to cosegregate with the MECD phenotype. The present case report describes a fourgeneration Chinese kindred with MECD but no detectable exon mutation of either KRT3 or KRT12, suggesting that this rare dominant-negative genetic disorder may have undefined genetic variants in a noncoding region, or in regulatory elements, that will require further genomic analysis. Case report A four-generation Chinese family including six living individuals with MECD was studied (Figure 1). The proband was a 20- year-old male (IV-4) who presented to the People s Hospital of Zhengzhou, Zhengzhou, Henan, China, in May 2011

3 Cao et al. 513 Table 1. Meesmann epithelial corneal dystrophy (MECD) kindreds reported in the literature. Reference Sex of patients with MECD Proband Reported KRT3/KRT12 mutation ancestry Male, n Female, n Gene Exon Nucleotide Codon Meesmann and Wilke German KRT G >C R135T Ehlers et al KRT G >C R135T Corden et al German KRT G >C R135T Corden et al German KRT A >C Q130P Irvine et al. 17 Unknown German KRT T >G N133K Clausen et al German KRT G >A M129V Irvine et al Irish KRT G >A E509K KRT G >C V143L Szaflik et al Polish KRT A >T E498V Nichini et al Swiss KRT T >G I426S Liao et al British KRT T >C L132P Corden et al American KRT T >C M129T Yoon et al American KRT A >C R135S 0 3 American KRT ins27 400ins- 9ISNLEAQLL Coleman et al American KRT A >G I426V Sullivan et al American KRT G >C A430P Stocker and Holt, American KRT12 1 Not listed R19I Klintworth 9 Nishida et al Japanese KRT A >G R135G 1 2 Japanese KRT G >T R135I 1 1 Japanese KRT T >G Y429D 0 1 Japanese KRT T >G L140R Takahashi et al Japanese KRT G >C A137P Chen et al Taiwanese KRT G >C R503P 2 2 Taiwanese KRT A >G Y429C Wang et al Chinese KRT T >A L132H Current case report 8 0 Chinese No mutation found Total with blurred vision, irritation, tearing and frequent photophobia. Visual acuity was normal (1.2 in both eyes). Multiple small cysts were seen on slit-lamp examination. His father (III-4) had a similar eye problem, which drew the family to clinical attention. Subsequently, the extended four-generation family was assessed. A complete ophthalmological assessment, including slit-lamp examination, was performed in 14 family members (II2, II3, III1, III4, III5, III6, III7, III11, III12, IV2, IV3, IV4, IV5 and IV6). Eight individuals were found to be affected by MECD (Figure 1). All were males and ranged between 20 (IV-4) and 80 (II-2) years old; affected individuals I-1 and III-3 were no longer alive but were identified from family description. Vision was very poor in both eyes for individuals II-2, II-3, III-4, III-6 and III-12. In addition, two individuals who did not have MECD were diagnosed with pathological myopia (III-1 and IV-2). Slit-lamp examination showed multiple fine vesicles (microcysts) within the

4 514 Journal of International Medical Research 41(2) Figure 1. Pedigree of a Chinese family with Meesmann epithelial corneal dystrophy, showing autosomal dominant inheritance. Affected individuals are represented by a solid symbol; the proband is IV-4. corneal epithelia in both eyes (Figure 2) in all affected living individuals, leading to a primary diagnosis of MECD. After obtaining written informed consent according to clinical research guidelines approved by the Institutional Review Board of the People s Hospital of Zhengzhou, Zhengzhou, Henan, China, 3- ml peripheral blood samples were obtained in tubes containing ethylenediamine tetraacetic acid from all six affected living patients (II-2, II-3, III-4, III-6, III-12 and IV-4), six unaffected individuals (III-1, III- 11, IV-2, IV-3, IV-5 and IV-6) and two nongenetic relatives (III-5 and III-7), for the isolation of genomic DNA and assessment of exon mutations in KRT3 and KRT12.The tube was inverted to mix the sample. Blood samples were stored at 4 C and analysed within 8 h of collection. To separate the peripheral blood leucocytes, 1 ml blood of blood was transferred to a 1.5-ml Eppendorf tube. The sample was then centrifuged for 10 min at 1200 r.p.m., at room temperature, (Model 5430, Eppendorf AG, Hamburg, Germany) to pellet red blood cells from plasma. The thin layer of buffy coat was carefully aspirated from between the pelleted red blood cells and plasma, and was transferred to a fresh tube for DNA isolation. Figure 2. Slit-lamp photography of the left eye of patient III-12 with Meesmann epithelial corneal dystrophy. The corneal epithelium has an irregular surface with multiple microcysts, with erupted cysts forming opaque spots. The black arrow indicates a representative cyst within the corneal epithelium. Genomic DNA was isolated from peripheral blood leucocytes by standard procedures using a blood DNA kit (Qiagen, Valencia, CA, USA). Coding regions of KRT3 (NM_057088) and KRT12 (NM_000223) were screened for mutations

5 Cao et al. 515 Table 2. Primers used in polymerase chain reaction amplification for direct sequencing of KRT3 and KRT12 exons. Target Forward primer sequence Reverse primer sequence Product size, bp Tm, C Gene Exon KRT TGGAACAAACTTATTGCCTTG CACCAGGACTGCCCAAGC CAGTCGCAGCCTCTACAACC ACAAACTCCTCAACCCTGGA CGCTGCAAGTGTAGTGTCCT GTGAGGGGGAACTGAATGAA CCCCCAACTAACAGGGAGAT ATAGGCACTGTCCACATCCTG CCGTTCAAGTGGAGACTGGT GTATCAGCCACACCCTGTCC GAATGAGCCTGGAGATGAGG TTTCTGCAACTGAACCACCA CCCTGCTGAAACACAATGC CTCCCCTAGTGCCTCCATCT CACAGGGCAGTATCTCCACA GCAAATGCTTCACCACAAGG CTCCTTGCTACAGCCCAAAG AGCCAATCACTTCCCTCTCC GCTCGTGGTGAACATCCTG AATTCTCGTGACTGGGCTTG GCTTTGGCTCCATCTCTGG AGACGAACTGCCTTTGTTTCA KRT CCACCCAGCTTTCTTTTTCA CGCACCTTATCCAGGTAGGA GTTATGGGGGAAGTGCCTTT TGAAACAACCTGGGATGAGA CCCAGGTTGTTTCACTCCAC TTGAGGTTTAGGACACTGGTAGG CAACAGCAAAAACTGCATCA CCTTAGCAGGAACCACCATC and CCAACTTACCCATTAGGCACA TCCAGGGATTTCTTCTGCAC GCGCAAACAGACGTAGCAT TCCCAGGCATATCTTTACTAGACTT GCCACCTGAACCACCTACTC AGATGGGGTCTCGCTATTTG GGCAAAGCAGAAGGGAAAA TGTTGGAATCAAGGCATACA TGGTGAATGGTGAGGTGGT CCTGACATCTTCATCCCAGTT Tm, melting temperature.

6 516 Journal of International Medical Research 41(2) by direct sequencing, using DNA amplified with the primers shown in Table 2. Polymerase chain reaction (PCR) was performed at 94 C for 5 min followed by 35 cycles at 94 C for 30 s, 57 C for 30 s, 72 C for 30 s and 72 C for 5 min. PCR-amplified products were examined on 1% agarose gels, then sequenced using an ABI Prism Õ 377 DNA sequencer (Applied Biosystems, Foster City, CA, USA) and BigDye Õ termination cycle-sequencing kit version 3.1 (Applied Biosystems). No sequence variants were identified: all individuals were homozygous for the exons of KRT3 and KRT12. Discussion This large Chinese kindred is the first published report of an autosomal-dominant MECD trait that is not associated with an exon mutation in either KRT3 or KRT12. MECD is an autosomal-dominant genetic disorder affecting the corneal epithelium that was first identified in Germany in and subsequently has been reported worldwide (Table 1). The kindred presented here focuses attention on several genetic properties of MECD. First, in autosomal-dominant MECD, equal numbers of affected males and females would be expected, as shown in Table 1. In the kindred presented here, there were eight affected males and no affected females. However, the absence of affected females in this family is not biologically significant, as the sex ratio and the number of affected children produced by the six affected MECD males who did have children did not show a statistical difference from expected values (P ¼ 0.05, using a two-tailed Fisher exact probability test). Secondly, all well-documented and reported MECD cases have an identified dominant-negative exon mutation in one of the two keratin genes, KRT3 or KRT12. Mutations in KRT3 have been identified in three MECD ancestries; mutations in KRT12 have been identified in 22 ancestries (Table 1). Although MECD is rare, the same mutation occurs in all the affected individuals in each reported kindred. Therefore, sequencing the coding exons of KRT3 and KRT12 appeared to be an appropriate genetic test to confirm the clinical diagnosis. However, it is now conceivable that there may be an undefined genomic variation in MECD that is not a KRT3 or KRT12 exon mutation, but is instead a mutation in the noncoding intron or regulatory elements of these genes. Thirdly, despite the presence of a kinshipspecific dominant-negative mutation in various reported MECD families, clinical phenotype can be variable within the kindred. 14 This further suggests that mechanisms unrelated to KRT3 or KRT12 mutations may contribute to the phenotypic expression of the MECD trait. 3,14 Further investigation of the kindred presented here should include sequencing the noncoding regions of KRT3 and KRT12 in affected individuals and genome-wide association analysis. Acknowledgements We thank the members of the Chinese family presented for their enthusiastic participation in this research and their consent for us to publish the results. Declaration of conflicting interest The authors declare that there are no conflicts of interest. Funding This work was supported by the National Natural Science Foundation of China (no ) and the Zhengzhou Science and Technology Programme (121PPTGG494-8).

7 Cao et al. 517 References 1. Meesmann A and Wilke F. Klinische und anatomische Untersuchungen u ber eine bisher unbekannte, dominant vererbte Epithel Dystrophie der Hornhaut. Klin Monatsbl Augenheilkd 1939; 103: (in German). 2. Irvine AD, Corden LD, Swensson O, et al. Mutations in cornea-specific keratin K3 or K12 genes cause Meesmann s corneal dystrophy. Nat Genet 1997; 16: Szaflik JP, Oldak M, Maksym RB, et al. Genetics of Meesmann corneal dystrophy: a novel mutation in the keratin 3 gene in an asymptomatic family suggests genotypephenotype correlation. Mol Vis 2008; 14: Nichini O, Manzi V, Munier FL, et al. Meesmann corneal dystrophy (MECD): report of 2 families and a novel mutation in the cornea specific keratin 12 (KRT12) gene. Ophthalmic Genet 2005; 26: Liao H, Irvine AD, Macewen CJ, et al. Development of allele-specific therapeutic sirna in Meesmann epithelial corneal dystrophy. PloS One 2011; 6: e Coleman CM, Hannush S, Covello SP, et al. A novel mutation in the helix termination motif of keratin K12 in a US family with Meesmann corneal dystrophy. Am J Ophthalmol 1999; 128: Yoon MK, Warren JF, Holsclaw DS, et al. A novel arginine substitution mutation in 1A domain and a novel 27 bp insertion mutation in 2B domain of keratin 12 gene associated with Meesmann s corneal dystrophy. Br J Ophthalmol 2004; 88: Stocker FW and Holt LB. A rare form of hereditary epithelial dystrophy of the cornea: a genetic, clinical, and pathologic study. Trans Am Ophthalmol Soc ; 52: Klintworth GK. Advances in the molecular genetics of corneal dystrophies. Am J Ophthalmol 1999; 128: Nishida K, Honma Y, Dota A, et al. Isolation and chromosomal localization of a cornea-specific human keratin 12 gene and detection of four mutations in Meesmann corneal epithelial dystrophy. Am J Hum Genet 1997; 61: Chen YT, Tseng SH and Chao SC. Novel mutations in the helix termination motif of keratin 3 and keratin 12 in 2 Taiwanese families with Meesmann corneal dystrophy. Cornea 2005; 24: Wang LJ, Tian X, Zhang QS, et al. Analysis of mutation in KRT12 gene in a Chinese family with Meesmann s corneal dystrophy. Zhonghua Yan Ke Za Zhi 2007; 43: (in Chinese, English abstract). 13. Kao WW, Liu CY, Converse RL, et al. Keratin 12-deficient mice have fragile corneal epithelia. Invest Ophthalmol Vis Sci 1996; 37: Ehlers N, Hjortdal J, Nielsen K, et al. Phenotypic variability in Meesmann s dystrophy: clinical review of the literature and presentation of a family genetically identical to the original family. Acta Ophthalmol 2008; 86: Corden LD, Swensson O, Swensson B, et al. Molecular genetics of Meesmann s corneal dystrophy: ancestral and novel mutations in keratin 12 (K12) and complete sequence of the human KRT12 gene. Exp Eye Res 2000; 70: Corden LD, Swensson O, Swensson B, et al. A novel keratin 12 mutation in a German kindred with Meesmann s corneal dystrophy. Br J Ophthalmol 2000; 84: Irvine AD, Coleman CM, Moore JE, et al. A novel mutation in KRT12 associated with Meesmann s epithelial corneal dystrophy. Br J Ophthalmol 2002; 86: Clausen I, Duncker GI and Gru nauer- Kloevekorn C. Identification of a novel mutation in the cornea specific keratin 12 gene causing Meesmann s corneal dystrophy in a German family. Mol Vis 2010; 16:

8 518 Journal of International Medical Research 41(2) 19. Takahashi K, Takahashi K, Murakami A, et al. Heterozygous Ala137Pro mutation in keratin 12 gene found in Japanese with Meesmann s corneal dystrophy. Jpn J Ophthalmol 2002; 46: Sullivan LS, Baylin EB, Font R, et al. A novel mutation of the keratin 12 gene responsible for a severe phenotype of Meesmann s corneal dystrophy. Mol Vis 2007; 13: