Health Benefits of Turmeric/Curcumin
|
|
- Laurence Thomas
- 5 years ago
- Views:
Transcription
1 Health Benefits of Turmeric/Curcumin Shobha Ghosh, PhD, FAHA Professor of Medicine and Physiology Department of Internal Medicine
2
3 Target Disease Clinical Trials with Curcumin # Dose of Curcumin Findings Obesity 2 1 g/day for 4 weeks 500 mg/day for 12 weeks Metabolic syndrome 2 2 g/day for 12 weeks mg/day Diabetes 3 Meriva (200mg/day) for 4 weeks 200 mg/day for 9 months to pre-diabetics 500 mg/day for days Reduced IL-1β, IL-4, VGEF Reduced LDL and lipid peroxidation Reduced LDL, TG No effect Improved blood flow in skin and retina Prevention of diabetes development Reduction in oxidative status Fatty liver disease 2 Meriva (1 g/day) for 8 weeks 70 mg/day for 8 weeks Reduced BMI, waist circumference, and improved liver function Reduced liver fat, improved liver function Cancer 13 6g/day with docetaxel for 6 cycles 2g/day with radiotherapy Dose escalation up to 8 g/day with docetaxel Theracurmin (200 mg 8 g) with Gemcitabine Depression 6 2 g/day along with anti-depressives 500 mg/day Curcumin with Fluoxetine Arthritis 5 Theracurmin (150 mg/day) for 8 weeks Fexofytol (42 mg/day) for 3 months Meriva (200 mg/day) for 3-8 months Curcumin (500 mg/day) with diclofenac Reduced PSA in this resistant population Reduces radiation dermatitis (Breast cancer patients) Increased tolerance to docetaxel and reduced cancer (metastatic breast cancer) Plasma levels in ng/ml range, reduced inflammation and some protection but curcumin well tolerated at these high doses (Abdominal fullness, diarrhea) Reduced cytokines but increased brain derived-neurotropic factor; improved depression scores Faster recovery Reduced knee pain score Reduced pain and plasma cartilage specific marker Reduced arthritis score and plasma CRP; reduced use of painkillers Higher improvement in pain scores
4 One major problem Curcumin is very poorly absorbed even after 8 g/day, only ng levels can be detected in the plasma Therefore, the causal role of curcumin or definitive mechanism of action has not been established by animal studies Most studies demonstrating beneficial effects of curcumin are performed using cells and these effects are observed with much higher concentrations of curcumin than can be detected in the plasma Efforts are, therefore, directed towards making more curcumin available to the target cells We hypothesized that curcumin may be acting in the intestine and therefore, its absorption may not be necessary
5 Rationale for our hypothesis Intestine contains millions of bacteria that produce toxins (LPS) Neither the bacteria nor the toxin is released into the circulation Intestinal wall regulates this process and provides a barrier If this barrier was not present, the amount of bacterial toxins in the gut are enough to kill a human being!! If the intestinal barrier is breached and the intestinal bacteria or the bacterial products are released into the circulation slowly, it will cause inflammation and result in the development of diseases such as diabetes or heart or kidney disease
6 LPS (Active) Dephos. LPS (Inactive)
7 Curcumin protects the Intestinal Barrier No additions +LPS +LPS+Curcumin ZO-1 Claudin-1 Claudin-7 Actin 20 µm AJP (2017)
8 Clinical Trials with Curcumin Chow WD WD+C Work in progress
9 Clinical Trials with Curcumin Work in progress
10 WD Activity Disrupts WD MΦs Inflammation Permeability LPS MΦ infiltration into adipose tissue MΦ Activation MΦ infiltration into artery wall T2DM Atherosclerosis
11 Proposed model for the action of Curcumin PLoS One Sep 24;9(9):e Curcumin Heart Disease Diabetes Kidney disease
12 Thank you for your attention
13
14 Effect of Curcumin on Chronic Kidney Disease Control: Sham surgery NX: 5/6 th Nephrectomy Supplementation with Curcumin or Enalapril Collect Plasma Collect urine Evaluate Kidney Function
15 Supplementation with curcumin attenuates Kidney Disease Nx Animal model for kidney disease Enalapril Currently used drug for kidney disease Ghosh SS et el: Am J Physiol Renal Physiol. 296:F , 2009
16 Effect of Curcumin on Diabetes and Heart Disease LDLR-/- Mice Fed a High Fat High Cholesterol (Western Diet) for 16 weeks with or without oral curcumin Perform Glucose Tolerance test to evaluate diabetes Mice Sacrificed Evaluate Atherosclerosis
17 Supplementation with curcumin attenuates Western Diet-induced Diabetes and heart disease Ghosh SS et al. PLoS One. 9(9):e108577, 2014
18 LPS (EU/ml) Western Diet feeding promotes translocation of bacterial toxin (LPS) to circulation Chow * WD Specific Activity (% Chow Control) Chow * WD 2.5 * FITC (ng/µl) Chow WD
19 Supplementation with curcumin attenuates WD-induced increase in plasma LPS levels
20 Direction of movement of bacteria/bacterial products 4 IAP Anti- Bacterial Proteins LPS (Active) Dephos. LPS (Inactive) Systemic Circulation Lumen Outer Mucin Inner Mucin Cell Layer Goblet Cells Paneth Cells 1 2 3
Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and
Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and Dietetics Tehran University of Medical Sciences Honorary Academic
More informationChapter 18. Diet and Health
Chapter 18 Diet and Health Risk Factors and Chronic Diseases Interrelationships among Chronic Diseases Chronic Disease Heart Disease and Stroke Hypertension Cancer Diabetes The Formation of Plaques in
More informationIndustrialized Food Components and Obesity Risk. Kylie Kavanagh, VMS MS MPH Department of Pathology
Industrialized Food Components and Obesity Risk Kylie Kavanagh, VMS MS MPH Department of Pathology Overview Role of science in policy development Components versus calories Past lessons (trans fat) Present
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationIntestinal Microbiota in Health and Disease
Intestinal Microbiota in Health and Disease February 27, 2015 Master s Course in Gastroenterology Prof. Kathy McCoy 1 Overview Overview of Gut Microbiota Microbiota in Health Microbiota in Disease 2 Gut
More informationHOW THE MICROBIOME AFFECTS OUR HEALTH
HOW THE MICROBIOME AFFECTS OUR HEALTH THE INTESTINAL BARRIER AND INTESTINAL PERMEABILITY Intestinal Barrier: a functional body Defense from translocation of dietary antigens, bacteria or bacterial endotoxins
More informationPro and Cons of Intermittent Fasting
Pro and Cons of Intermittent Fasting Agenda What is intermittent fasting? 2 main types Difference between men and women IF and the gut How to balance all the information for clients Definition Term used
More informationWhat is the evidence that dietary components can act on the microbiome and influence health?
What is the evidence that dietary components can act on the microbiome and influence health? Kristin Verbeke Translational Research in Gastrointestinal Disorders KU Leuven, Leuven, Belgium Diet? health
More informationThe Metabolic Syndrome Update The Metabolic Syndrome Update. Global Cardiometabolic Risk
The Metabolic Syndrome Update 2018 Marc Cornier, M.D. Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine
More informationImproving Access to Quality Medical Care Webinar Series
Improving Access to Quality Medical Care Webinar Series Presented by The Arizona Telemedicine Program and the Southwest Telehealth Resource Center 2015 UA Board of Regents Welcome AZ, UT, CO, NM & NV FLEX
More informationPIEDMONT ACCESS TO HEALTH SERVICES, INC. Guidelines for Screening and Management of Dyslipidemia
PIEDMONT ACCESS TO HEALTH SERVICES, INC. Policy Number: 01-09-021 SUBJECT: Guidelines for Screening and Management of Dyslipidemia EFFECTIVE DATE: 04/2008 REVIEWED/REVISED: 04/12/10, 03/17/2011, 4/10/2012,
More informationINFLAMATION AND CANCER
INFLAMATION AND CANCER NANIALEI GOLDEN, M.D., F.A.C.R.O. RADIATION ONCOLOGY MEDICAL DIRECTOR, HEALTH FIRST CANCER SERVICES ASSISTANT PROFESSOR, UNIVERSITY OF CENTRAL FLORIDA COLLEGE OF MEDICINE PROTO-ONCOGENE
More informationElements for a Public Summary. PhV Page 54/143
VI.2 Elements for a Public Summary PhV-20141675 Page 54/143 VI.2.1 Overview of disease epidemiology Hypercholesterolaemia Hypercholesterolemia (high levels of cholesterol in the blood) is usually discovered
More informationNecrotizing Enterocolitis: The Role of the Immune System
Necrotizing Enterocolitis: The Role of the Immune System Patricia Denning, M.D. Associate Professor in Pediatrics Division of Neonatology Emory University School of Medicine What is NEC? What is NEC? Necrotizing
More informationFeatured Topic: Pomegranate (7 slides)
Featured Topic: Pomegranate (7 slides) Pomegranate polyphenols Seeds, pulp, skin, root, flower and even the bark of the pomegranate tree are high in beneficial polyphenols Polyphenols are disease fighting
More informationDM, NAFLD, and conjugated linoleic acid (omega 6); what is the link
DM, NAFLD, and conjugated linoleic acid (omega 6); what is the link Mona Hegazy Professor of Internal Medicine Hepatology Department Cairo University Egypt Agenda Congugated lionleic fatty acid NAFLD
More informationElevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with
Elevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with Insulin Resistance Mehrnoosh Shanaki, Ph.D. Assistant Professor of Clinical Biochemistry Shahid Beheshti
More informationSUMMARY Coeliac disease is a common food intolerance in Western populations, in which it has a prevalence of about 1%. In early infancy, when the transition is made to a gluten-containing diet (particularly
More informationFeatured Topic: Herbal Cleansing (5 slides)
Featured Topic: Herbal Cleansing (5 slides) Constipation: a Common Problem 16% of Americans and at least 1/3 of people over age 60 experience chronic constipation Constipation (as defined by the National
More informationMOLINA HEALTHCARE OF CALIFORNIA
MOLINA HEALTHCARE OF CALIFORNIA HIGH BLOOD CHOLESTEROL IN ADULTS GUIDELINE Molina Healthcare of California has adopted the Third Report of the National Cholesterol Education Program (NCEP) Expert Panel
More informationA Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationBibliografia Microbiota
Bibliografia Microbiota Systematic Review: Gut Microbiota in Fecal Samples and Detection of Colorectal Neoplasms. The role of the intestinal microbiome in ocular inflammatory disease. The gut microbiome
More information220 SUBJECT INDEX. D Diarrhea and sodium balance, 74 weanling, 161,179,208,212; see also Infection
Subject Index Acid balance, see ph Allergy, food, see also Immunity and beikost, 143-144 and breast milk, 91,143 and formula, 89-90 Antidiuretic hormone, 66 67 Antigens, see also Immunity determinants,
More informationPrinciples of Drug Action. Intro to Pharmacology: Principles of Courework Drug Action Intro to Pharmacology
Principles of Drug Action Intro to Pharmacology: Principles of Courework 102.3 Drug Action Intro to Pharmacology Directions Read the PPT and complete R.E.A.D. Assignment. There are videos embedded within
More informationA real life example In human studies, we quantify ~120 plasma related proteins Monocytes MMP9 Macrophages TNFα IL1ß platelet derived growth factor IFNγ MMP1 MMP8 MMP13 Myeloid Related Protein14 CD40
More information902 Biomed Environ Sci, 2014; 27(11):
902 Biomed Environ Sci, 2014; 27(11): 902-906 Letter to the Editor Curcuminoids Target Decreasing Serum Adipocyte-fatty Acid Binding Protein Levels in Their Glucose-lowering Effect in Patients with Type
More informationGetting into the weed: the endocannabinoid system of the gut-brain axis in energy homeostasis. Keith Sharkey
Getting into the weed: the endocannabinoid system of the gut-brain axis in energy homeostasis Keith Sharkey Department of Physiology & Pharmacology University of Calgary Dr. Keith Sharkey Financial Interest
More informationFructose in Insulin Resistance- Focused on Diabetes 순천향대학교부천병원 내분비내과 정찬희
Fructose in Insulin Resistance- Focused on Diabetes 순천향대학교부천병원 내분비내과 정찬희 Introduction Unique characteristics of Fructose Metabolism Mechanism for Fructose-Induced Insulin Resistance Epidemiological Studies
More informationHOW TO DEFINE GOOD BIOMARKERS OF HEALTH? Suzan Wopereis
HOW TO DEFINE GOOD BIOMARKERS OF HEALTH? Suzan Wopereis My personal objective: identification of biomarkers of (optimal) health Biomarker Definition: a characteristic that is objectively measured and evaluated
More informationKEY COMPONENTS. Metabolic Risk Cardiovascular Risk Vascular Inflammation Markers
CardioMetabolic Risk Poor blood sugar regulation and unhealthy triglyceride and lipoprotein levels often present long before the diagnosis of type 2 Diabetes. SpectraCell s CardioMetabolic and Pre-Diabetes
More informationMetabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk
Metabolic Syndrome Update 21 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes University of Colorado Denver Denver Health Medical Center The Metabolic
More informationObjectives. Objectives. Alejandro J. de la Torre, MD Cook Children s Hospital May 30, 2015
Alejandro J. de la Torre, MD Cook Children s Hospital May 30, 2015 Presentation downloaded from http://ce.unthsc.edu Objectives Understand that the obesity epidemic is also affecting children and adolescents
More information1. Most of your blood cholesterol is produced by: a. your kidneys b. your liver c. your pancreas d. food consumption (Your liver)
I. TEST YOUR KNOWLEDGE OF CHOLESTEROL Choose the correct answer. 1. Most of your blood cholesterol is produced by: a. your kidneys b. your liver c. your pancreas d. food consumption (Your liver) 2. Only
More information2.5% of all deaths globally each year. 7th leading cause of death by % of people with diabetes live in low and middle income countries
Lipid Disorders in Diabetes (Diabetic Dyslipidemia) Khosrow Adeli PhD, FCACB, DABCC Head and Professor, Clinical Biochemistry, The Hospital for Sick Children, University it of Toronto Diabetes A Global
More informationFIBOFIT IS Water soluble fiber
FIBOFIT IS Water soluble fiber Table of nutritional value Per Serving 8 g (1Sachet) 100 g %W/W Wheat Dextrin 8g 100 g 100 % Energy 0.096 kcal Fats & Its Derinatives 0.008 g 0.1 g Protein 0.008 g 0.1 g
More informationTaylor Yohe. Project Advisor: Dr. Martha A. Belury. Department of Human Nutrition at the Ohio State University
Atherosclerosis Development and the Inflammatory Response of Hepatocytes to Sesame Oil Supplementation Taylor Yohe Project Advisor: Dr. Martha A. Belury Department of Human Nutrition at the Ohio State
More informationStudy of Serum Hepcidin as a Potential Mediator of the Disrupted Iron Metabolism in Obese Adolescents
Study of Serum Hepcidin as a Potential Mediator of the Disrupted Iron Metabolism in Obese Adolescents Prof. Azza Abdel Shaheed Prof. of Child Health NRC National Research Centre Egypt Prevalence of childhood
More informationPlasma fibrinogen level, BMI and lipid profile in type 2 diabetes mellitus with hypertension
World Journal of Pharmaceutical Sciences ISSN (Print): 2321-3310; ISSN (Online): 2321-3086 Published by Atom and Cell Publishers All Rights Reserved Available online at: http://www.wjpsonline.org/ Original
More informationOutline. Epidemiology of Pediatric HIV 10/3/2012. I have no financial relationships with any commercial entity to disclose
Nutritional, Metabolic, and Gastrointestinal Complications in Pediatric HIV Infection Tracie L. Miller, MD Department of Pediatrics University of Miami, Miller School of Medicine I have no financial relationships
More informationNiacin Metabolism: Effects on Cholesterol
Niacin Metabolism: Effects on Cholesterol By Julianne R. Edwards For Dr. William R. Proulx, PhD, RD Associate Professor of Nutrition and Dietetics In partial fulfillments for the requirements of NUTR342
More informationBy: Dr Mehrnoosh Shanaki
Resveratrol could partly improve the crosstalk between canonical β-catenin/wnt and FOXO pathways in coronary artery disease patients with metabolic syndrome: A case control study By: Dr Mehrnoosh Shanaki
More informationApplied Nutritional Medicine. Supplement Categories. E.I.Nu.M.
Supplement Categories In this section, we will begin to explain the Metabolomic Academy method of Nutritional Medicine. The step taken by metabolomic studies was to identify seven categories of major nutritional
More informationHMGB1-TLR4 Interactions: Mediators of Kidney Lung Crosstalk?
HMGB1-TLR4 Interactions: Mediators of Kidney Lung Crosstalk? Dept of Emergency and Critical Care Medicine The University of Tokyo Kent Doi, MD. PhD Organ crosstalk in AKI Grams ME, Rabb H. Kidney Int.
More informationThe Impact of High Intensity Interval Training On Lipid Profile, Inflammatory Markers and Anthropometric Parameters in Inactive Women
Brief Report The Impact of High Intensity Interval Training On Lipid Profile, Inflammatory Markers and Anthropometric Parameters in Inactive Women Nasrin Zaer Ghodsi (MSc) Department of Physical Education,
More informationDietary fat supplies essential body tissue needs, both as an energy fuel and a structural material.
Chapter 3 Fats Chapter 3 Lesson 3.1 Key Concepts Dietary fat supplies essential body tissue needs, both as an energy fuel and a structural material. Foods from animal and plant sources supply distinct
More informationΟ ρόλος των τριγλυκεριδίων στην παθογένεια των μικροαγγειοπαθητικών επιπλοκών του σακχαρώδη διαβήτη
Ο ρόλος των τριγλυκεριδίων στην παθογένεια των μικροαγγειοπαθητικών επιπλοκών του σακχαρώδη διαβήτη Κωνσταντίνος Τζιόμαλος Επίκουρος Καθηγητής Παθολογίας Α Προπαιδευτική Παθολογική Κλινική, Νοσοκομείο
More information3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.
U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,
More informationFAT. It s Not All That! A Closer Look at the Two Main Types of Fat in Our Bodies: Visceral and Subcutaneous Fat
Mary-Kate Perrone Capstone Seminar July 14, 2007 Draft #2 Fat Stats FAT. It s Not All That! A Closer Look at the Two Main Types of Fat in Our Bodies: Visceral and Subcutaneous Fat According to the 2003-2004
More informationFat Metabolism, Insulin and MTHFR
Fat Metabolism, Insulin and MTHFR BCAA, SAMe and ACAT Carolyn Ledowsky Overview of This Presentation 1. Fat Metabolism and MTHFR 2. SAMe and Fat Metabolism 3. Acetyl Co A and Fat Metabolism 4. How to Maintain
More informationObesity in the pathogenesis of chronic disease
Portoroz October 16th 2013 Obesity in the pathogenesis of chronic disease Rocco Barazzoni University of Trieste Department of Medical, Surgical and Health Sciences Obesity Trends* Among U.S. Adults BRFSS,
More informationProbiotic action and health and well-being of children. Seppo Salminen Functional Foods Forum Finland
Probiotic action and health and well-being of children Seppo Salminen Functional Foods Forum Finland DEFINITION OF A PROBIOTIC Probiotic:...a living microbial preparation, which beneficially influences
More informationComplementary and Alternative Medicine Presentation by: Terry Chhour Leah Lopez Polly Peru Mark Reyes Rachelle Sebastian
Complementary and Alternative Medicine Presentation by: Terry Chhour Leah Lopez Polly Peru Mark Reyes Rachelle Sebastian Learning Objectives: Provide current research information on the potential scientifically
More informationPharmacokinetics I. Dr. M.Mothilal Assistant professor
Pharmacokinetics I Dr. M.Mothilal Assistant professor DRUG TRANSPORT For a drug to produce a therapeutic effect, it must reach to its target and it must accumulate at that site to reach to the minimum
More informationDiabetes Oral Agents Pharmacology. University of Hawai i Hilo Pre-Nursing Program NURS 203 General Pharmacology Danita Narciso Pharm D
Diabetes Oral Agents Pharmacology University of Hawai i Hilo Pre-Nursing Program NURS 203 General Pharmacology Danita Narciso Pharm D 1 Learning Objectives Understand the role of the utilization of free
More informationEffects of short-term exercise training on intestinal metabolism and gut microbiota
Effects of short-term exercise training on intestinal metabolism and gut microbiota Kumail K. Motiani M. Carmen Collado, Joonas J. Eskelinen, Kirsi A. Virtanen, Eliisa Löyttyniemi, Seppo Salminen, Pirjo
More informationNew news on the dangers of Proton Pump Inhibitors (2 slide)
New news on the dangers of Proton Pump Inhibitors (2 slide) Proton Pump Inhibitors and Increased risk of Death Proton pump inhibitors are used to stop acid production in the stomach Nexium is the fourth
More informationAtherosclerosis is an Inflammatory Disease: Does it Matter? Atherosclerosis is an Inflammatory Disease: Does it Matter?
12 th Annual Cardiovascular Disease Prevention Symposium February 8, 2013 Atherosclerosis is an Inflammatory Disease: Does it Matter? Ira Tabas, M.D., Ph.D. Richard J. Stock Professor of Medicine, Cell
More informationUnderstanding Body Composition
Understanding Body Composition Chapter 7 Body Composition n Body composition is the ratio between fat and fat-free mass n Fat-free mass includes all tissues exclusive of fat (muscle, bone, organs, fluids)
More informationEarly life determinants of Non-Alcoholic Fatty Liver Disease and NASH DR JULIANA MUIVA-GITOBU KENYA PAEDIATRIC ASSOCIATION CONFERENCE APRIL 2016.
Early life determinants of Non-Alcoholic Fatty Liver Disease and NASH DR JULIANA MUIVA-GITOBU KENYA PAEDIATRIC ASSOCIATION CONFERENCE APRIL 2016. Outline Definition NAFLD and NASH Magnitude of the problem
More informationEstablishment of Efficacy of Intervention in those with Metabolic Syndrome. Dr Wendy Russell - ILSI Europe Expert Group
Establishment of Efficacy of Intervention in those with Metabolic Syndrome Dr Wendy Russell - ILSI Europe Expert Group Conflict of interest regarding this presentation: I have no conflict of interest to
More informationSurvival of new probiotic strains with anti-inflammatory & anti-obesity effects used in non-fat yogurt and low-fat Cheddar cheese making
Survival of new probiotic strains with anti-inflammatory & anti-obesity effects used in non-fat yogurt and low-fat Cheddar cheese making Veronique Demers-Mathieu, Ph.D. Department of Microbiology & Medicine
More informationPart 1 Risk Factors and Atherosclerosis. LO1. Define the Different Forms of CVD
Week 3: Cardiovascular Disease Learning Outcomes: 1. Define the difference forms of CVD 2. Describe the various risk factors of CVD 3. Describe atherosclerosis and its stages 4. Describe the role of oxidation,
More information1. Coconut Oil Contains a Unique Combination of Fatty Acids With Powerful Medicinal Properties
ABOUT COCONUT OIL 1. Coconut Oil Contains a Unique Combination of Fatty Acids With Powerful Medicinal Properties Coconut oil has been demonized in the past because it contains saturated fat. In fact, coconut
More informationNot Hard Choices. By Dato Dr. Rajen M. 27 October 2018
Make Choices Not Hard Choices By Dato Dr. Rajen M. 27 October 2018 Key Facts of Cardiovascular Disease 1. What is the burden of cardiovascular disease in Malaysia? 2. What causes cardiovascular disease?
More informationWhy Obese People are Unable to Keep Weight Off After Losing It
Why Obese People are Unable to Keep Weight Off After Losing It Robert E. Ratner, MD Chief Scientific and Medical Officer American Diabetes Association I have no Pertinent Financial Disclosures Change in
More informationARE YOU OBESE?! Aaser Abdelazim
ARE YOU OBESE?! by Aaser Abdelazim Assistant professor of Medical Biochemistry Zagazig University, Egypt University of Bisha, KSA aaserabdelazim@yahoo.com MAN BODY SHAPES 1. Narrow hips and clavicles 2.
More informationEffect of Selenium Supplementation on Glycemic Control and Lipid Profile in Patients with Type 2 Diabetes: A Review on Current Evidence
Effect of Selenium Supplementation on Glycemic Control and Lipid Profile in Patients with Type 2 Diabetes: A Review on Current Evidence Raheleh Kamalzadeh Yazdi 1, Ghazaleh Shakeri 1, Motahareh Hatami
More informationMetabolic Syndrome. Bill Roberts, M.D., Ph.D. Professor of Pathology University of Utah
Metabolic Syndrome Bill Roberts, M.D., Ph.D. Professor of Pathology University of Utah Objectives Be able to outline the pathophysiology of the metabolic syndrome Be able to list diagnostic criteria for
More informationMetabolic Syndrome. Shon Meek MD, PhD Mayo Clinic Florida Endocrinology
Metabolic Syndrome Shon Meek MD, PhD Mayo Clinic Florida Endocrinology Disclosure No conflict of interest No financial disclosure Does This Patient Have Metabolic Syndrome? 1. Yes 2. No Does This Patient
More informationThe role of intestinal microbiota in metabolic disease-a novel therapeutic target.
Michael Connolly Department of Food Biosciences, The University of Reading The role of intestinal microbiota in metabolic disease-a novel therapeutic target. University of Reading 2008 www.reading.ac.uk
More informationExosomes as a. Novel Therapeutic Approach to Gastrointestinal Diseases Rebecca Murray APRN, FNP, CDE
Exosomes as a Novel Therapeutic Approach to Gastrointestinal Diseases Rebecca Murray APRN, FNP, CDE Endocrine Nurse Practitioner Institute for Hormonal Balance Orlando, FL Medical Director Ward-Murray
More informationVitamin D in Cattle: Calcium and Beyond. Corwin D. Nelson, Ph.D. Assistant Professor of Physiology Department of Animal Sciences
OH HO OH Vitamin D in Cattle: Calcium and Beyond Corwin D. Nelson, Ph.D. Assistant Professor of Physiology Department of Animal Sciences Seminar Outline 1. Basics of vitamin D metabolism and genomic actions
More informationFeatured Topic: Acne (4 slides)
Featured Topic: Acne (4 slides) What really causes acne Acne is the most common skin condition in the United States Acne doesn t happen because skin is dirty Acne occurs when sebum (the oil that keeps
More informationCardiovascular Complications of Diabetes
VBWG Cardiovascular Complications of Diabetes Nicola Abate, M.D., F.N.L.A. Professor and Chief Division of Endocrinology and Metabolism The University of Texas Medical Branch Galveston, Texas Coronary
More informationEnvironmental Enteric Dysfunction. Jean Humphrey for the SHINE Trial Research Group
Environmental Enteric Dysfunction Jean Humphrey for the SHINE Trial Research Group Stunting is only partially responsive to current diet and health interventions Normal EED During EED there are abnormal
More informationFIBER HEALTH BENEFITS
FIBER FIBER HEALTH BENEFITS Normal Laxation: Increase stool weight from fiber, water retained by fiber and bacterial mass Eases defecation and prevents or relieves constipation Cereal fibers are best;
More informationPlasma proteins Quantitatively, proteins are the most important part of the soluble components of the blood plasma.
Plasma proteins 42 Plasma proteins Quantitatively, proteins are the most important part of the soluble components of the blood plasma. concentrations of between 60 and 80 g L 1, they constitute approximately
More informationLIPIDS Dr. Latifah Al-Oboudi 2012
LIPIDS Dr. Latifah Al-Oboudi 2012 The Lipid Family Triglycerides Phospholipids Sterols All types of lipids are: soluble in organic solvents such as chloroform, benzene, and ether, but not in water. Differ
More informationNovel Reduction of PCSK9 Expression: Mechanistic Insights into the Anti-Atherosclerotic & Hypolipidemic Effects of Heat Shock Protein 27
Novel Reduction of PCSK9 Expression: Mechanistic Insights into the Anti-Atherosclerotic & Hypolipidemic Effects of Heat Shock Protein 27 Ed O Brien, Jean-Claude Bakala-N Goma, Chunhua Shi Cumming School
More informationLipoprotein Particle Profile
Lipoprotein Particle Profile 50% of people at risk for HEART DISEASE are not identified by routine testing. Why is LPP Testing The Most Comprehensive Risk Assessment? u Provides much more accurate cardiovascular
More informationWHO (World Health Organization) calls for Sugar Intake Reduction
Sugar WHO (World Health Organization) calls for Sugar Intake Reduction WHO has a new recommendation: maximum free sugar intake be reduced to 5 teaspoons daily from the current limit of 10 teaspoons Free
More informationIncreased Circulatory Lipopolysaccharide From a High Fat Diet Aggravates Inflammation and Exacerbates Renal Failure
Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2014 Increased Circulatory Lipopolysaccharide From a High Fat Diet Aggravates Inflammation and Exacerbates
More informationMETABOLISM of ADIPOSE TISSUE
METABOLISM of ADIPOSE TISSUE 2. LF UK Prof. Rudolf Poledne, PhD. TYPES OF ADIPOSE TISSUE brown adipose tissue subcutaneous adipose tissue visceral adipose tissue ADIPOSE TISSUE FUNCTIONS: thermal isolation
More informationObesity. The World Health Organisation state that in 2014 more than 1.9 billion adults were overweight and of those 600 million were obese (1).
Obesity Indications Overweight and obesity is a global problem and is defined as abnormal or excessive fat accumulation that may impair health (1). Even though this is a preventable disease, prevalence
More informationMETABOLIC SYNDROME AND HCV: FROM HCV
METABOLIC SYNDROME AND HCV: FROM THEORY TO PRACTICE HCV Steatosis Insulin resistance Arun J Sanyal M.D. Chairman, Div. of Gastroenterology, Hepatology and Nutrition Virginia Commonwealth University Richmond,
More informationNutrition and gastrointestinal cancer: An update of the epidemiological evidence
Nutrition and gastrointestinal cancer: An update of the epidemiological evidence Krasimira Aleksandrova, PhD MPH Nutrition, Immunity and Metabolsim Start-up Lab Department of Epidemiology German Institute
More informationDysbiosis & Inflammation
MASTERING THE MICROBIOME: Dysbiosis & Inflammation 2017 Tom Fabian, PhD It is reasonable to propose that the composition of the microbiome and its activities are involved in most, if not all, of the biological
More informationClient Report Screening Program Results For: Missouri Western State University October 28, 2013
Client Report For: Missouri Western State University October 28, 2013 Executive Summary PROGRAM OVERVIEW From 1/1/2013-9/30/2013, Missouri Western State University participants participated in a screening
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationSlide 1 MORE ABOUT ZONULIN. Slide 2 Zonulin For Testing Leaky Gut. Slide 3 Zonulin
Slide 1 MORE ABOUT ZONULIN Slide 2 For Testing Leaky Gut There is now a test for zonulin that we can access So understanding more about it may be helpful for you and clients It is important to understand
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationThe New Gold Standard for Lipoprotein Analysis. Advanced Testing for Cardiovascular Risk
The New Gold Standard for Lipoprotein Analysis Advanced Testing for Cardiovascular Risk Evolution of Lipoprotein Testing The Lipid Panel Total Cholesterol = VLDL + LDL + HDL Evolution of Lipoprotein Testing
More informationFROM ABSTRACT Patients with rheumatoid arthritis (RA) improve on a vegetarian diet or supplementation with fish oil.
Anti-inflammatory effects of a low arachidonic acid diet and fish oil in patients with rheumatoid arthritis Rheumatol Int (2003) 23: 27 36 Olaf Adam, Corinna Beringer, Thomas Kless, Christa Lemmen, Alexander
More informationSubject Index. rationale for supplementation in cancer patients 260, 273 surgical cancer patient supplementation
Acute-phase response, cytokine mediation in cachexia 157, 158 ß 2 -Adrenergic agonist, effects on rat tumor models 264 Alcohol breast cancer studies 107, 108, 111, 112, 116 ß-carotene interactions 53 lung
More informationHow much acid in the gut is too much?
81 How much acid in the gut is too much? J.B. Rowe Animal Science, University of New England, Armidale NSW 2351 Summary Introduction Is the gut adapted for acidic conditions? Recent Advances in Animal
More information1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
More informationHeart Disease Genesis
Heart Disease Genesis The Ultimate Lecture on CAD origins Petr Polasek MD FRCPC FACC Copyright 2017 by Sea Courses Inc. All rights reserved. No part of this document may be reproduced, copied, stored,
More information13/09/2012. Dietary fatty acids. Triglyceride. Phospholipids:
CARDIOVASCULAR DISEASES (CVD) and NUTRITION Major cause of morbidity & mortality in Canada & other developed countries e.g., majority of approved health claims on food labels relate to lowering CVD Relation
More informationObesity, Metabolic Syndrome, and Diabetes: Making the Connections
Obesity, Metabolic Syndrome, and Diabetes: Making the Connections Alka M. Kanaya, M.D. Associate Professor of Medicine & Epi/Biostats University of California, San Francisco February 26, 21 Roadmap 1.
More informationThe LiVicordia study
CARDIOVASCULAR HEALTH AND LIFESTYLE: NORDIC-BALTIC COMPARISON The LiVicordia study Zita Kučinskienė On behalf of the LiVicordia group Mortality among men / 100000 from Ischemic heart diseases (410-414).
More information