Health Benefits of Turmeric/Curcumin

Size: px
Start display at page:

Download "Health Benefits of Turmeric/Curcumin"

Transcription

1 Health Benefits of Turmeric/Curcumin Shobha Ghosh, PhD, FAHA Professor of Medicine and Physiology Department of Internal Medicine

2

3 Target Disease Clinical Trials with Curcumin # Dose of Curcumin Findings Obesity 2 1 g/day for 4 weeks 500 mg/day for 12 weeks Metabolic syndrome 2 2 g/day for 12 weeks mg/day Diabetes 3 Meriva (200mg/day) for 4 weeks 200 mg/day for 9 months to pre-diabetics 500 mg/day for days Reduced IL-1β, IL-4, VGEF Reduced LDL and lipid peroxidation Reduced LDL, TG No effect Improved blood flow in skin and retina Prevention of diabetes development Reduction in oxidative status Fatty liver disease 2 Meriva (1 g/day) for 8 weeks 70 mg/day for 8 weeks Reduced BMI, waist circumference, and improved liver function Reduced liver fat, improved liver function Cancer 13 6g/day with docetaxel for 6 cycles 2g/day with radiotherapy Dose escalation up to 8 g/day with docetaxel Theracurmin (200 mg 8 g) with Gemcitabine Depression 6 2 g/day along with anti-depressives 500 mg/day Curcumin with Fluoxetine Arthritis 5 Theracurmin (150 mg/day) for 8 weeks Fexofytol (42 mg/day) for 3 months Meriva (200 mg/day) for 3-8 months Curcumin (500 mg/day) with diclofenac Reduced PSA in this resistant population Reduces radiation dermatitis (Breast cancer patients) Increased tolerance to docetaxel and reduced cancer (metastatic breast cancer) Plasma levels in ng/ml range, reduced inflammation and some protection but curcumin well tolerated at these high doses (Abdominal fullness, diarrhea) Reduced cytokines but increased brain derived-neurotropic factor; improved depression scores Faster recovery Reduced knee pain score Reduced pain and plasma cartilage specific marker Reduced arthritis score and plasma CRP; reduced use of painkillers Higher improvement in pain scores

4 One major problem Curcumin is very poorly absorbed even after 8 g/day, only ng levels can be detected in the plasma Therefore, the causal role of curcumin or definitive mechanism of action has not been established by animal studies Most studies demonstrating beneficial effects of curcumin are performed using cells and these effects are observed with much higher concentrations of curcumin than can be detected in the plasma Efforts are, therefore, directed towards making more curcumin available to the target cells We hypothesized that curcumin may be acting in the intestine and therefore, its absorption may not be necessary

5 Rationale for our hypothesis Intestine contains millions of bacteria that produce toxins (LPS) Neither the bacteria nor the toxin is released into the circulation Intestinal wall regulates this process and provides a barrier If this barrier was not present, the amount of bacterial toxins in the gut are enough to kill a human being!! If the intestinal barrier is breached and the intestinal bacteria or the bacterial products are released into the circulation slowly, it will cause inflammation and result in the development of diseases such as diabetes or heart or kidney disease

6 LPS (Active) Dephos. LPS (Inactive)

7 Curcumin protects the Intestinal Barrier No additions +LPS +LPS+Curcumin ZO-1 Claudin-1 Claudin-7 Actin 20 µm AJP (2017)

8 Clinical Trials with Curcumin Chow WD WD+C Work in progress

9 Clinical Trials with Curcumin Work in progress

10 WD Activity Disrupts WD MΦs Inflammation Permeability LPS MΦ infiltration into adipose tissue MΦ Activation MΦ infiltration into artery wall T2DM Atherosclerosis

11 Proposed model for the action of Curcumin PLoS One Sep 24;9(9):e Curcumin Heart Disease Diabetes Kidney disease

12 Thank you for your attention

13

14 Effect of Curcumin on Chronic Kidney Disease Control: Sham surgery NX: 5/6 th Nephrectomy Supplementation with Curcumin or Enalapril Collect Plasma Collect urine Evaluate Kidney Function

15 Supplementation with curcumin attenuates Kidney Disease Nx Animal model for kidney disease Enalapril Currently used drug for kidney disease Ghosh SS et el: Am J Physiol Renal Physiol. 296:F , 2009

16 Effect of Curcumin on Diabetes and Heart Disease LDLR-/- Mice Fed a High Fat High Cholesterol (Western Diet) for 16 weeks with or without oral curcumin Perform Glucose Tolerance test to evaluate diabetes Mice Sacrificed Evaluate Atherosclerosis

17 Supplementation with curcumin attenuates Western Diet-induced Diabetes and heart disease Ghosh SS et al. PLoS One. 9(9):e108577, 2014

18 LPS (EU/ml) Western Diet feeding promotes translocation of bacterial toxin (LPS) to circulation Chow * WD Specific Activity (% Chow Control) Chow * WD 2.5 * FITC (ng/µl) Chow WD

19 Supplementation with curcumin attenuates WD-induced increase in plasma LPS levels

20 Direction of movement of bacteria/bacterial products 4 IAP Anti- Bacterial Proteins LPS (Active) Dephos. LPS (Inactive) Systemic Circulation Lumen Outer Mucin Inner Mucin Cell Layer Goblet Cells Paneth Cells 1 2 3

Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and

Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and Dietetics Tehran University of Medical Sciences Honorary Academic

More information

Chapter 18. Diet and Health

Chapter 18. Diet and Health Chapter 18 Diet and Health Risk Factors and Chronic Diseases Interrelationships among Chronic Diseases Chronic Disease Heart Disease and Stroke Hypertension Cancer Diabetes The Formation of Plaques in

More information

Industrialized Food Components and Obesity Risk. Kylie Kavanagh, VMS MS MPH Department of Pathology

Industrialized Food Components and Obesity Risk. Kylie Kavanagh, VMS MS MPH Department of Pathology Industrialized Food Components and Obesity Risk Kylie Kavanagh, VMS MS MPH Department of Pathology Overview Role of science in policy development Components versus calories Past lessons (trans fat) Present

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Intestinal Microbiota in Health and Disease

Intestinal Microbiota in Health and Disease Intestinal Microbiota in Health and Disease February 27, 2015 Master s Course in Gastroenterology Prof. Kathy McCoy 1 Overview Overview of Gut Microbiota Microbiota in Health Microbiota in Disease 2 Gut

More information

HOW THE MICROBIOME AFFECTS OUR HEALTH

HOW THE MICROBIOME AFFECTS OUR HEALTH HOW THE MICROBIOME AFFECTS OUR HEALTH THE INTESTINAL BARRIER AND INTESTINAL PERMEABILITY Intestinal Barrier: a functional body Defense from translocation of dietary antigens, bacteria or bacterial endotoxins

More information

Pro and Cons of Intermittent Fasting

Pro and Cons of Intermittent Fasting Pro and Cons of Intermittent Fasting Agenda What is intermittent fasting? 2 main types Difference between men and women IF and the gut How to balance all the information for clients Definition Term used

More information

What is the evidence that dietary components can act on the microbiome and influence health?

What is the evidence that dietary components can act on the microbiome and influence health? What is the evidence that dietary components can act on the microbiome and influence health? Kristin Verbeke Translational Research in Gastrointestinal Disorders KU Leuven, Leuven, Belgium Diet? health

More information

The Metabolic Syndrome Update The Metabolic Syndrome Update. Global Cardiometabolic Risk

The Metabolic Syndrome Update The Metabolic Syndrome Update. Global Cardiometabolic Risk The Metabolic Syndrome Update 2018 Marc Cornier, M.D. Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine

More information

Improving Access to Quality Medical Care Webinar Series

Improving Access to Quality Medical Care Webinar Series Improving Access to Quality Medical Care Webinar Series Presented by The Arizona Telemedicine Program and the Southwest Telehealth Resource Center 2015 UA Board of Regents Welcome AZ, UT, CO, NM & NV FLEX

More information

PIEDMONT ACCESS TO HEALTH SERVICES, INC. Guidelines for Screening and Management of Dyslipidemia

PIEDMONT ACCESS TO HEALTH SERVICES, INC. Guidelines for Screening and Management of Dyslipidemia PIEDMONT ACCESS TO HEALTH SERVICES, INC. Policy Number: 01-09-021 SUBJECT: Guidelines for Screening and Management of Dyslipidemia EFFECTIVE DATE: 04/2008 REVIEWED/REVISED: 04/12/10, 03/17/2011, 4/10/2012,

More information

INFLAMATION AND CANCER

INFLAMATION AND CANCER INFLAMATION AND CANCER NANIALEI GOLDEN, M.D., F.A.C.R.O. RADIATION ONCOLOGY MEDICAL DIRECTOR, HEALTH FIRST CANCER SERVICES ASSISTANT PROFESSOR, UNIVERSITY OF CENTRAL FLORIDA COLLEGE OF MEDICINE PROTO-ONCOGENE

More information

Elements for a Public Summary. PhV Page 54/143

Elements for a Public Summary. PhV Page 54/143 VI.2 Elements for a Public Summary PhV-20141675 Page 54/143 VI.2.1 Overview of disease epidemiology Hypercholesterolaemia Hypercholesterolemia (high levels of cholesterol in the blood) is usually discovered

More information

Necrotizing Enterocolitis: The Role of the Immune System

Necrotizing Enterocolitis: The Role of the Immune System Necrotizing Enterocolitis: The Role of the Immune System Patricia Denning, M.D. Associate Professor in Pediatrics Division of Neonatology Emory University School of Medicine What is NEC? What is NEC? Necrotizing

More information

Featured Topic: Pomegranate (7 slides)

Featured Topic: Pomegranate (7 slides) Featured Topic: Pomegranate (7 slides) Pomegranate polyphenols Seeds, pulp, skin, root, flower and even the bark of the pomegranate tree are high in beneficial polyphenols Polyphenols are disease fighting

More information

DM, NAFLD, and conjugated linoleic acid (omega 6); what is the link

DM, NAFLD, and conjugated linoleic acid (omega 6); what is the link DM, NAFLD, and conjugated linoleic acid (omega 6); what is the link Mona Hegazy Professor of Internal Medicine Hepatology Department Cairo University Egypt Agenda Congugated lionleic fatty acid NAFLD

More information

Elevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with

Elevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with Elevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with Insulin Resistance Mehrnoosh Shanaki, Ph.D. Assistant Professor of Clinical Biochemistry Shahid Beheshti

More information

SUMMARY Coeliac disease is a common food intolerance in Western populations, in which it has a prevalence of about 1%. In early infancy, when the transition is made to a gluten-containing diet (particularly

More information

Featured Topic: Herbal Cleansing (5 slides)

Featured Topic: Herbal Cleansing (5 slides) Featured Topic: Herbal Cleansing (5 slides) Constipation: a Common Problem 16% of Americans and at least 1/3 of people over age 60 experience chronic constipation Constipation (as defined by the National

More information

MOLINA HEALTHCARE OF CALIFORNIA

MOLINA HEALTHCARE OF CALIFORNIA MOLINA HEALTHCARE OF CALIFORNIA HIGH BLOOD CHOLESTEROL IN ADULTS GUIDELINE Molina Healthcare of California has adopted the Third Report of the National Cholesterol Education Program (NCEP) Expert Panel

More information

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China

More information

Bibliografia Microbiota

Bibliografia Microbiota Bibliografia Microbiota Systematic Review: Gut Microbiota in Fecal Samples and Detection of Colorectal Neoplasms. The role of the intestinal microbiome in ocular inflammatory disease. The gut microbiome

More information

220 SUBJECT INDEX. D Diarrhea and sodium balance, 74 weanling, 161,179,208,212; see also Infection

220 SUBJECT INDEX. D Diarrhea and sodium balance, 74 weanling, 161,179,208,212; see also Infection Subject Index Acid balance, see ph Allergy, food, see also Immunity and beikost, 143-144 and breast milk, 91,143 and formula, 89-90 Antidiuretic hormone, 66 67 Antigens, see also Immunity determinants,

More information

Principles of Drug Action. Intro to Pharmacology: Principles of Courework Drug Action Intro to Pharmacology

Principles of Drug Action. Intro to Pharmacology: Principles of Courework Drug Action Intro to Pharmacology Principles of Drug Action Intro to Pharmacology: Principles of Courework 102.3 Drug Action Intro to Pharmacology Directions Read the PPT and complete R.E.A.D. Assignment. There are videos embedded within

More information

A real life example In human studies, we quantify ~120 plasma related proteins Monocytes MMP9 Macrophages TNFα IL1ß platelet derived growth factor IFNγ MMP1 MMP8 MMP13 Myeloid Related Protein14 CD40

More information

902 Biomed Environ Sci, 2014; 27(11):

902 Biomed Environ Sci, 2014; 27(11): 902 Biomed Environ Sci, 2014; 27(11): 902-906 Letter to the Editor Curcuminoids Target Decreasing Serum Adipocyte-fatty Acid Binding Protein Levels in Their Glucose-lowering Effect in Patients with Type

More information

Getting into the weed: the endocannabinoid system of the gut-brain axis in energy homeostasis. Keith Sharkey

Getting into the weed: the endocannabinoid system of the gut-brain axis in energy homeostasis. Keith Sharkey Getting into the weed: the endocannabinoid system of the gut-brain axis in energy homeostasis Keith Sharkey Department of Physiology & Pharmacology University of Calgary Dr. Keith Sharkey Financial Interest

More information

Fructose in Insulin Resistance- Focused on Diabetes 순천향대학교부천병원 내분비내과 정찬희

Fructose in Insulin Resistance- Focused on Diabetes 순천향대학교부천병원 내분비내과 정찬희 Fructose in Insulin Resistance- Focused on Diabetes 순천향대학교부천병원 내분비내과 정찬희 Introduction Unique characteristics of Fructose Metabolism Mechanism for Fructose-Induced Insulin Resistance Epidemiological Studies

More information

HOW TO DEFINE GOOD BIOMARKERS OF HEALTH? Suzan Wopereis

HOW TO DEFINE GOOD BIOMARKERS OF HEALTH? Suzan Wopereis HOW TO DEFINE GOOD BIOMARKERS OF HEALTH? Suzan Wopereis My personal objective: identification of biomarkers of (optimal) health Biomarker Definition: a characteristic that is objectively measured and evaluated

More information

KEY COMPONENTS. Metabolic Risk Cardiovascular Risk Vascular Inflammation Markers

KEY COMPONENTS. Metabolic Risk Cardiovascular Risk Vascular Inflammation Markers CardioMetabolic Risk Poor blood sugar regulation and unhealthy triglyceride and lipoprotein levels often present long before the diagnosis of type 2 Diabetes. SpectraCell s CardioMetabolic and Pre-Diabetes

More information

Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk

Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk Metabolic Syndrome Update 21 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes University of Colorado Denver Denver Health Medical Center The Metabolic

More information

Objectives. Objectives. Alejandro J. de la Torre, MD Cook Children s Hospital May 30, 2015

Objectives. Objectives. Alejandro J. de la Torre, MD Cook Children s Hospital May 30, 2015 Alejandro J. de la Torre, MD Cook Children s Hospital May 30, 2015 Presentation downloaded from http://ce.unthsc.edu Objectives Understand that the obesity epidemic is also affecting children and adolescents

More information

1. Most of your blood cholesterol is produced by: a. your kidneys b. your liver c. your pancreas d. food consumption (Your liver)

1. Most of your blood cholesterol is produced by: a. your kidneys b. your liver c. your pancreas d. food consumption (Your liver) I. TEST YOUR KNOWLEDGE OF CHOLESTEROL Choose the correct answer. 1. Most of your blood cholesterol is produced by: a. your kidneys b. your liver c. your pancreas d. food consumption (Your liver) 2. Only

More information

2.5% of all deaths globally each year. 7th leading cause of death by % of people with diabetes live in low and middle income countries

2.5% of all deaths globally each year. 7th leading cause of death by % of people with diabetes live in low and middle income countries Lipid Disorders in Diabetes (Diabetic Dyslipidemia) Khosrow Adeli PhD, FCACB, DABCC Head and Professor, Clinical Biochemistry, The Hospital for Sick Children, University it of Toronto Diabetes A Global

More information

FIBOFIT IS Water soluble fiber

FIBOFIT IS Water soluble fiber FIBOFIT IS Water soluble fiber Table of nutritional value Per Serving 8 g (1Sachet) 100 g %W/W Wheat Dextrin 8g 100 g 100 % Energy 0.096 kcal Fats & Its Derinatives 0.008 g 0.1 g Protein 0.008 g 0.1 g

More information

Taylor Yohe. Project Advisor: Dr. Martha A. Belury. Department of Human Nutrition at the Ohio State University

Taylor Yohe. Project Advisor: Dr. Martha A. Belury. Department of Human Nutrition at the Ohio State University Atherosclerosis Development and the Inflammatory Response of Hepatocytes to Sesame Oil Supplementation Taylor Yohe Project Advisor: Dr. Martha A. Belury Department of Human Nutrition at the Ohio State

More information

Study of Serum Hepcidin as a Potential Mediator of the Disrupted Iron Metabolism in Obese Adolescents

Study of Serum Hepcidin as a Potential Mediator of the Disrupted Iron Metabolism in Obese Adolescents Study of Serum Hepcidin as a Potential Mediator of the Disrupted Iron Metabolism in Obese Adolescents Prof. Azza Abdel Shaheed Prof. of Child Health NRC National Research Centre Egypt Prevalence of childhood

More information

Plasma fibrinogen level, BMI and lipid profile in type 2 diabetes mellitus with hypertension

Plasma fibrinogen level, BMI and lipid profile in type 2 diabetes mellitus with hypertension World Journal of Pharmaceutical Sciences ISSN (Print): 2321-3310; ISSN (Online): 2321-3086 Published by Atom and Cell Publishers All Rights Reserved Available online at: http://www.wjpsonline.org/ Original

More information

Outline. Epidemiology of Pediatric HIV 10/3/2012. I have no financial relationships with any commercial entity to disclose

Outline. Epidemiology of Pediatric HIV 10/3/2012. I have no financial relationships with any commercial entity to disclose Nutritional, Metabolic, and Gastrointestinal Complications in Pediatric HIV Infection Tracie L. Miller, MD Department of Pediatrics University of Miami, Miller School of Medicine I have no financial relationships

More information

Niacin Metabolism: Effects on Cholesterol

Niacin Metabolism: Effects on Cholesterol Niacin Metabolism: Effects on Cholesterol By Julianne R. Edwards For Dr. William R. Proulx, PhD, RD Associate Professor of Nutrition and Dietetics In partial fulfillments for the requirements of NUTR342

More information

By: Dr Mehrnoosh Shanaki

By: Dr Mehrnoosh Shanaki Resveratrol could partly improve the crosstalk between canonical β-catenin/wnt and FOXO pathways in coronary artery disease patients with metabolic syndrome: A case control study By: Dr Mehrnoosh Shanaki

More information

Applied Nutritional Medicine. Supplement Categories. E.I.Nu.M.

Applied Nutritional Medicine. Supplement Categories. E.I.Nu.M. Supplement Categories In this section, we will begin to explain the Metabolomic Academy method of Nutritional Medicine. The step taken by metabolomic studies was to identify seven categories of major nutritional

More information

HMGB1-TLR4 Interactions: Mediators of Kidney Lung Crosstalk?

HMGB1-TLR4 Interactions: Mediators of Kidney Lung Crosstalk? HMGB1-TLR4 Interactions: Mediators of Kidney Lung Crosstalk? Dept of Emergency and Critical Care Medicine The University of Tokyo Kent Doi, MD. PhD Organ crosstalk in AKI Grams ME, Rabb H. Kidney Int.

More information

The Impact of High Intensity Interval Training On Lipid Profile, Inflammatory Markers and Anthropometric Parameters in Inactive Women

The Impact of High Intensity Interval Training On Lipid Profile, Inflammatory Markers and Anthropometric Parameters in Inactive Women Brief Report The Impact of High Intensity Interval Training On Lipid Profile, Inflammatory Markers and Anthropometric Parameters in Inactive Women Nasrin Zaer Ghodsi (MSc) Department of Physical Education,

More information

Dietary fat supplies essential body tissue needs, both as an energy fuel and a structural material.

Dietary fat supplies essential body tissue needs, both as an energy fuel and a structural material. Chapter 3 Fats Chapter 3 Lesson 3.1 Key Concepts Dietary fat supplies essential body tissue needs, both as an energy fuel and a structural material. Foods from animal and plant sources supply distinct

More information

Ο ρόλος των τριγλυκεριδίων στην παθογένεια των μικροαγγειοπαθητικών επιπλοκών του σακχαρώδη διαβήτη

Ο ρόλος των τριγλυκεριδίων στην παθογένεια των μικροαγγειοπαθητικών επιπλοκών του σακχαρώδη διαβήτη Ο ρόλος των τριγλυκεριδίων στην παθογένεια των μικροαγγειοπαθητικών επιπλοκών του σακχαρώδη διαβήτη Κωνσταντίνος Τζιόμαλος Επίκουρος Καθηγητής Παθολογίας Α Προπαιδευτική Παθολογική Κλινική, Νοσοκομείο

More information

3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.

3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H. U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,

More information

FAT. It s Not All That! A Closer Look at the Two Main Types of Fat in Our Bodies: Visceral and Subcutaneous Fat

FAT. It s Not All That! A Closer Look at the Two Main Types of Fat in Our Bodies: Visceral and Subcutaneous Fat Mary-Kate Perrone Capstone Seminar July 14, 2007 Draft #2 Fat Stats FAT. It s Not All That! A Closer Look at the Two Main Types of Fat in Our Bodies: Visceral and Subcutaneous Fat According to the 2003-2004

More information

Fat Metabolism, Insulin and MTHFR

Fat Metabolism, Insulin and MTHFR Fat Metabolism, Insulin and MTHFR BCAA, SAMe and ACAT Carolyn Ledowsky Overview of This Presentation 1. Fat Metabolism and MTHFR 2. SAMe and Fat Metabolism 3. Acetyl Co A and Fat Metabolism 4. How to Maintain

More information

Obesity in the pathogenesis of chronic disease

Obesity in the pathogenesis of chronic disease Portoroz October 16th 2013 Obesity in the pathogenesis of chronic disease Rocco Barazzoni University of Trieste Department of Medical, Surgical and Health Sciences Obesity Trends* Among U.S. Adults BRFSS,

More information

Probiotic action and health and well-being of children. Seppo Salminen Functional Foods Forum Finland

Probiotic action and health and well-being of children. Seppo Salminen Functional Foods Forum Finland Probiotic action and health and well-being of children Seppo Salminen Functional Foods Forum Finland DEFINITION OF A PROBIOTIC Probiotic:...a living microbial preparation, which beneficially influences

More information

Complementary and Alternative Medicine Presentation by: Terry Chhour Leah Lopez Polly Peru Mark Reyes Rachelle Sebastian

Complementary and Alternative Medicine Presentation by: Terry Chhour Leah Lopez Polly Peru Mark Reyes Rachelle Sebastian Complementary and Alternative Medicine Presentation by: Terry Chhour Leah Lopez Polly Peru Mark Reyes Rachelle Sebastian Learning Objectives: Provide current research information on the potential scientifically

More information

Pharmacokinetics I. Dr. M.Mothilal Assistant professor

Pharmacokinetics I. Dr. M.Mothilal Assistant professor Pharmacokinetics I Dr. M.Mothilal Assistant professor DRUG TRANSPORT For a drug to produce a therapeutic effect, it must reach to its target and it must accumulate at that site to reach to the minimum

More information

Diabetes Oral Agents Pharmacology. University of Hawai i Hilo Pre-Nursing Program NURS 203 General Pharmacology Danita Narciso Pharm D

Diabetes Oral Agents Pharmacology. University of Hawai i Hilo Pre-Nursing Program NURS 203 General Pharmacology Danita Narciso Pharm D Diabetes Oral Agents Pharmacology University of Hawai i Hilo Pre-Nursing Program NURS 203 General Pharmacology Danita Narciso Pharm D 1 Learning Objectives Understand the role of the utilization of free

More information

Effects of short-term exercise training on intestinal metabolism and gut microbiota

Effects of short-term exercise training on intestinal metabolism and gut microbiota Effects of short-term exercise training on intestinal metabolism and gut microbiota Kumail K. Motiani M. Carmen Collado, Joonas J. Eskelinen, Kirsi A. Virtanen, Eliisa Löyttyniemi, Seppo Salminen, Pirjo

More information

New news on the dangers of Proton Pump Inhibitors (2 slide)

New news on the dangers of Proton Pump Inhibitors (2 slide) New news on the dangers of Proton Pump Inhibitors (2 slide) Proton Pump Inhibitors and Increased risk of Death Proton pump inhibitors are used to stop acid production in the stomach Nexium is the fourth

More information

Atherosclerosis is an Inflammatory Disease: Does it Matter? Atherosclerosis is an Inflammatory Disease: Does it Matter?

Atherosclerosis is an Inflammatory Disease: Does it Matter? Atherosclerosis is an Inflammatory Disease: Does it Matter? 12 th Annual Cardiovascular Disease Prevention Symposium February 8, 2013 Atherosclerosis is an Inflammatory Disease: Does it Matter? Ira Tabas, M.D., Ph.D. Richard J. Stock Professor of Medicine, Cell

More information

Understanding Body Composition

Understanding Body Composition Understanding Body Composition Chapter 7 Body Composition n Body composition is the ratio between fat and fat-free mass n Fat-free mass includes all tissues exclusive of fat (muscle, bone, organs, fluids)

More information

Early life determinants of Non-Alcoholic Fatty Liver Disease and NASH DR JULIANA MUIVA-GITOBU KENYA PAEDIATRIC ASSOCIATION CONFERENCE APRIL 2016.

Early life determinants of Non-Alcoholic Fatty Liver Disease and NASH DR JULIANA MUIVA-GITOBU KENYA PAEDIATRIC ASSOCIATION CONFERENCE APRIL 2016. Early life determinants of Non-Alcoholic Fatty Liver Disease and NASH DR JULIANA MUIVA-GITOBU KENYA PAEDIATRIC ASSOCIATION CONFERENCE APRIL 2016. Outline Definition NAFLD and NASH Magnitude of the problem

More information

Establishment of Efficacy of Intervention in those with Metabolic Syndrome. Dr Wendy Russell - ILSI Europe Expert Group

Establishment of Efficacy of Intervention in those with Metabolic Syndrome. Dr Wendy Russell - ILSI Europe Expert Group Establishment of Efficacy of Intervention in those with Metabolic Syndrome Dr Wendy Russell - ILSI Europe Expert Group Conflict of interest regarding this presentation: I have no conflict of interest to

More information

Survival of new probiotic strains with anti-inflammatory & anti-obesity effects used in non-fat yogurt and low-fat Cheddar cheese making

Survival of new probiotic strains with anti-inflammatory & anti-obesity effects used in non-fat yogurt and low-fat Cheddar cheese making Survival of new probiotic strains with anti-inflammatory & anti-obesity effects used in non-fat yogurt and low-fat Cheddar cheese making Veronique Demers-Mathieu, Ph.D. Department of Microbiology & Medicine

More information

Part 1 Risk Factors and Atherosclerosis. LO1. Define the Different Forms of CVD

Part 1 Risk Factors and Atherosclerosis. LO1. Define the Different Forms of CVD Week 3: Cardiovascular Disease Learning Outcomes: 1. Define the difference forms of CVD 2. Describe the various risk factors of CVD 3. Describe atherosclerosis and its stages 4. Describe the role of oxidation,

More information

1. Coconut Oil Contains a Unique Combination of Fatty Acids With Powerful Medicinal Properties

1. Coconut Oil Contains a Unique Combination of Fatty Acids With Powerful Medicinal Properties ABOUT COCONUT OIL 1. Coconut Oil Contains a Unique Combination of Fatty Acids With Powerful Medicinal Properties Coconut oil has been demonized in the past because it contains saturated fat. In fact, coconut

More information

Not Hard Choices. By Dato Dr. Rajen M. 27 October 2018

Not Hard Choices. By Dato Dr. Rajen M. 27 October 2018 Make Choices Not Hard Choices By Dato Dr. Rajen M. 27 October 2018 Key Facts of Cardiovascular Disease 1. What is the burden of cardiovascular disease in Malaysia? 2. What causes cardiovascular disease?

More information

Why Obese People are Unable to Keep Weight Off After Losing It

Why Obese People are Unable to Keep Weight Off After Losing It Why Obese People are Unable to Keep Weight Off After Losing It Robert E. Ratner, MD Chief Scientific and Medical Officer American Diabetes Association I have no Pertinent Financial Disclosures Change in

More information

ARE YOU OBESE?! Aaser Abdelazim

ARE YOU OBESE?! Aaser Abdelazim ARE YOU OBESE?! by Aaser Abdelazim Assistant professor of Medical Biochemistry Zagazig University, Egypt University of Bisha, KSA aaserabdelazim@yahoo.com MAN BODY SHAPES 1. Narrow hips and clavicles 2.

More information

Effect of Selenium Supplementation on Glycemic Control and Lipid Profile in Patients with Type 2 Diabetes: A Review on Current Evidence

Effect of Selenium Supplementation on Glycemic Control and Lipid Profile in Patients with Type 2 Diabetes: A Review on Current Evidence Effect of Selenium Supplementation on Glycemic Control and Lipid Profile in Patients with Type 2 Diabetes: A Review on Current Evidence Raheleh Kamalzadeh Yazdi 1, Ghazaleh Shakeri 1, Motahareh Hatami

More information

Metabolic Syndrome. Bill Roberts, M.D., Ph.D. Professor of Pathology University of Utah

Metabolic Syndrome. Bill Roberts, M.D., Ph.D. Professor of Pathology University of Utah Metabolic Syndrome Bill Roberts, M.D., Ph.D. Professor of Pathology University of Utah Objectives Be able to outline the pathophysiology of the metabolic syndrome Be able to list diagnostic criteria for

More information

Metabolic Syndrome. Shon Meek MD, PhD Mayo Clinic Florida Endocrinology

Metabolic Syndrome. Shon Meek MD, PhD Mayo Clinic Florida Endocrinology Metabolic Syndrome Shon Meek MD, PhD Mayo Clinic Florida Endocrinology Disclosure No conflict of interest No financial disclosure Does This Patient Have Metabolic Syndrome? 1. Yes 2. No Does This Patient

More information

The role of intestinal microbiota in metabolic disease-a novel therapeutic target.

The role of intestinal microbiota in metabolic disease-a novel therapeutic target. Michael Connolly Department of Food Biosciences, The University of Reading The role of intestinal microbiota in metabolic disease-a novel therapeutic target. University of Reading 2008 www.reading.ac.uk

More information

Exosomes as a. Novel Therapeutic Approach to Gastrointestinal Diseases Rebecca Murray APRN, FNP, CDE

Exosomes as a. Novel Therapeutic Approach to Gastrointestinal Diseases Rebecca Murray APRN, FNP, CDE Exosomes as a Novel Therapeutic Approach to Gastrointestinal Diseases Rebecca Murray APRN, FNP, CDE Endocrine Nurse Practitioner Institute for Hormonal Balance Orlando, FL Medical Director Ward-Murray

More information

Vitamin D in Cattle: Calcium and Beyond. Corwin D. Nelson, Ph.D. Assistant Professor of Physiology Department of Animal Sciences

Vitamin D in Cattle: Calcium and Beyond. Corwin D. Nelson, Ph.D. Assistant Professor of Physiology Department of Animal Sciences OH HO OH Vitamin D in Cattle: Calcium and Beyond Corwin D. Nelson, Ph.D. Assistant Professor of Physiology Department of Animal Sciences Seminar Outline 1. Basics of vitamin D metabolism and genomic actions

More information

Featured Topic: Acne (4 slides)

Featured Topic: Acne (4 slides) Featured Topic: Acne (4 slides) What really causes acne Acne is the most common skin condition in the United States Acne doesn t happen because skin is dirty Acne occurs when sebum (the oil that keeps

More information

Cardiovascular Complications of Diabetes

Cardiovascular Complications of Diabetes VBWG Cardiovascular Complications of Diabetes Nicola Abate, M.D., F.N.L.A. Professor and Chief Division of Endocrinology and Metabolism The University of Texas Medical Branch Galveston, Texas Coronary

More information

Environmental Enteric Dysfunction. Jean Humphrey for the SHINE Trial Research Group

Environmental Enteric Dysfunction. Jean Humphrey for the SHINE Trial Research Group Environmental Enteric Dysfunction Jean Humphrey for the SHINE Trial Research Group Stunting is only partially responsive to current diet and health interventions Normal EED During EED there are abnormal

More information

FIBER HEALTH BENEFITS

FIBER HEALTH BENEFITS FIBER FIBER HEALTH BENEFITS Normal Laxation: Increase stool weight from fiber, water retained by fiber and bacterial mass Eases defecation and prevents or relieves constipation Cereal fibers are best;

More information

Plasma proteins Quantitatively, proteins are the most important part of the soluble components of the blood plasma.

Plasma proteins Quantitatively, proteins are the most important part of the soluble components of the blood plasma. Plasma proteins 42 Plasma proteins Quantitatively, proteins are the most important part of the soluble components of the blood plasma. concentrations of between 60 and 80 g L 1, they constitute approximately

More information

LIPIDS Dr. Latifah Al-Oboudi 2012

LIPIDS Dr. Latifah Al-Oboudi 2012 LIPIDS Dr. Latifah Al-Oboudi 2012 The Lipid Family Triglycerides Phospholipids Sterols All types of lipids are: soluble in organic solvents such as chloroform, benzene, and ether, but not in water. Differ

More information

Novel Reduction of PCSK9 Expression: Mechanistic Insights into the Anti-Atherosclerotic & Hypolipidemic Effects of Heat Shock Protein 27

Novel Reduction of PCSK9 Expression: Mechanistic Insights into the Anti-Atherosclerotic & Hypolipidemic Effects of Heat Shock Protein 27 Novel Reduction of PCSK9 Expression: Mechanistic Insights into the Anti-Atherosclerotic & Hypolipidemic Effects of Heat Shock Protein 27 Ed O Brien, Jean-Claude Bakala-N Goma, Chunhua Shi Cumming School

More information

Lipoprotein Particle Profile

Lipoprotein Particle Profile Lipoprotein Particle Profile 50% of people at risk for HEART DISEASE are not identified by routine testing. Why is LPP Testing The Most Comprehensive Risk Assessment? u Provides much more accurate cardiovascular

More information

WHO (World Health Organization) calls for Sugar Intake Reduction

WHO (World Health Organization) calls for Sugar Intake Reduction Sugar WHO (World Health Organization) calls for Sugar Intake Reduction WHO has a new recommendation: maximum free sugar intake be reduced to 5 teaspoons daily from the current limit of 10 teaspoons Free

More information

Increased Circulatory Lipopolysaccharide From a High Fat Diet Aggravates Inflammation and Exacerbates Renal Failure

Increased Circulatory Lipopolysaccharide From a High Fat Diet Aggravates Inflammation and Exacerbates Renal Failure Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2014 Increased Circulatory Lipopolysaccharide From a High Fat Diet Aggravates Inflammation and Exacerbates

More information

METABOLISM of ADIPOSE TISSUE

METABOLISM of ADIPOSE TISSUE METABOLISM of ADIPOSE TISSUE 2. LF UK Prof. Rudolf Poledne, PhD. TYPES OF ADIPOSE TISSUE brown adipose tissue subcutaneous adipose tissue visceral adipose tissue ADIPOSE TISSUE FUNCTIONS: thermal isolation

More information

Obesity. The World Health Organisation state that in 2014 more than 1.9 billion adults were overweight and of those 600 million were obese (1).

Obesity. The World Health Organisation state that in 2014 more than 1.9 billion adults were overweight and of those 600 million were obese (1). Obesity Indications Overweight and obesity is a global problem and is defined as abnormal or excessive fat accumulation that may impair health (1). Even though this is a preventable disease, prevalence

More information

METABOLIC SYNDROME AND HCV: FROM HCV

METABOLIC SYNDROME AND HCV: FROM HCV METABOLIC SYNDROME AND HCV: FROM THEORY TO PRACTICE HCV Steatosis Insulin resistance Arun J Sanyal M.D. Chairman, Div. of Gastroenterology, Hepatology and Nutrition Virginia Commonwealth University Richmond,

More information

Nutrition and gastrointestinal cancer: An update of the epidemiological evidence

Nutrition and gastrointestinal cancer: An update of the epidemiological evidence Nutrition and gastrointestinal cancer: An update of the epidemiological evidence Krasimira Aleksandrova, PhD MPH Nutrition, Immunity and Metabolsim Start-up Lab Department of Epidemiology German Institute

More information

Dysbiosis & Inflammation

Dysbiosis & Inflammation MASTERING THE MICROBIOME: Dysbiosis & Inflammation 2017 Tom Fabian, PhD It is reasonable to propose that the composition of the microbiome and its activities are involved in most, if not all, of the biological

More information

Client Report Screening Program Results For: Missouri Western State University October 28, 2013

Client Report Screening Program Results For: Missouri Western State University October 28, 2013 Client Report For: Missouri Western State University October 28, 2013 Executive Summary PROGRAM OVERVIEW From 1/1/2013-9/30/2013, Missouri Western State University participants participated in a screening

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Slide 1 MORE ABOUT ZONULIN. Slide 2 Zonulin For Testing Leaky Gut. Slide 3 Zonulin

Slide 1 MORE ABOUT ZONULIN. Slide 2 Zonulin For Testing Leaky Gut. Slide 3 Zonulin Slide 1 MORE ABOUT ZONULIN Slide 2 For Testing Leaky Gut There is now a test for zonulin that we can access So understanding more about it may be helpful for you and clients It is important to understand

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

The New Gold Standard for Lipoprotein Analysis. Advanced Testing for Cardiovascular Risk

The New Gold Standard for Lipoprotein Analysis. Advanced Testing for Cardiovascular Risk The New Gold Standard for Lipoprotein Analysis Advanced Testing for Cardiovascular Risk Evolution of Lipoprotein Testing The Lipid Panel Total Cholesterol = VLDL + LDL + HDL Evolution of Lipoprotein Testing

More information

FROM ABSTRACT Patients with rheumatoid arthritis (RA) improve on a vegetarian diet or supplementation with fish oil.

FROM ABSTRACT Patients with rheumatoid arthritis (RA) improve on a vegetarian diet or supplementation with fish oil. Anti-inflammatory effects of a low arachidonic acid diet and fish oil in patients with rheumatoid arthritis Rheumatol Int (2003) 23: 27 36 Olaf Adam, Corinna Beringer, Thomas Kless, Christa Lemmen, Alexander

More information

Subject Index. rationale for supplementation in cancer patients 260, 273 surgical cancer patient supplementation

Subject Index. rationale for supplementation in cancer patients 260, 273 surgical cancer patient supplementation Acute-phase response, cytokine mediation in cachexia 157, 158 ß 2 -Adrenergic agonist, effects on rat tumor models 264 Alcohol breast cancer studies 107, 108, 111, 112, 116 ß-carotene interactions 53 lung

More information

How much acid in the gut is too much?

How much acid in the gut is too much? 81 How much acid in the gut is too much? J.B. Rowe Animal Science, University of New England, Armidale NSW 2351 Summary Introduction Is the gut adapted for acidic conditions? Recent Advances in Animal

More information

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien

More information

Heart Disease Genesis

Heart Disease Genesis Heart Disease Genesis The Ultimate Lecture on CAD origins Petr Polasek MD FRCPC FACC Copyright 2017 by Sea Courses Inc. All rights reserved. No part of this document may be reproduced, copied, stored,

More information

13/09/2012. Dietary fatty acids. Triglyceride. Phospholipids:

13/09/2012. Dietary fatty acids. Triglyceride. Phospholipids: CARDIOVASCULAR DISEASES (CVD) and NUTRITION Major cause of morbidity & mortality in Canada & other developed countries e.g., majority of approved health claims on food labels relate to lowering CVD Relation

More information

Obesity, Metabolic Syndrome, and Diabetes: Making the Connections

Obesity, Metabolic Syndrome, and Diabetes: Making the Connections Obesity, Metabolic Syndrome, and Diabetes: Making the Connections Alka M. Kanaya, M.D. Associate Professor of Medicine & Epi/Biostats University of California, San Francisco February 26, 21 Roadmap 1.

More information

The LiVicordia study

The LiVicordia study CARDIOVASCULAR HEALTH AND LIFESTYLE: NORDIC-BALTIC COMPARISON The LiVicordia study Zita Kučinskienė On behalf of the LiVicordia group Mortality among men / 100000 from Ischemic heart diseases (410-414).

More information