Familial PAH. Genetics and pulmonary arterial hypertension. PAH and mutations in the bone morphogenetic protein type II receptor (BMPR-II)
|
|
- Cecil Simpson
- 5 years ago
- Views:
Transcription
1 athology of vascular lesions in idiopathic pulmonary arterial hypertension Genetics and pulmonary arterial hypertension Concentric intimal lesion Nick Morrell British Heart Foundation rofessor of Cardiopulmonary Medicine University of Cambridge School of Clinical Medicine Addenbrooke s and apworth Hospitals Cambridge, UK lexiform lesion CD31 CD31 α-sma α-sma Atkinson et al. Circulation. 22;15: Familial AH Autosomal dominant Reduced gene penetrance Sex bias F>M AH and mutations in the bone morphogenetic protein type II receptor (BMR-II) Heterozygous germline mutations in BMR2,, encoding a TGF-β receptor, cause familial AH mutations detected in ~7% of families (The International H Consortium, Nat. Genetics 2; Deng et al. Am J. Hum. Genetics 2) Unaffected Obligate carrier Affected UK family 4 Association of sporadic AH with BMR2 mutations 15-26% of sporadics have mutations in BMR-II parental transmission and de novo mutation documented (Thomson et al. J. Med. Genet. 2 Newman et al. N. Engl. J. Med. 21) Clinical outcomes of pulmonary arterial hypertension in carriers of BMR2 mutation. Sztrymf et al. Am J Respir Crit Care Med. 28;177: Austin et al. Respiratory Research 29, 1:87
2 BM signaling Bone and cartilage formation BM ligand Clathrin coated pits Cell membrane BMR-II LIMK1 Tctex-1 BMR1A/B/ALK-1 Smad1/5/8 MAK Angiogenesis and vascular differentiation Bone morphogenetic proteins Embryonic mesoderm formation HC HC Smad4 neurogenesis ~2 family members form kda dimers cysteine knot structure Dorso- Ventral patterning Gene expression regulation Transcription Organogenesis kidney lung Tissue specific nature of BM signalling BMR-II Cell-specific responses to BMs depend on the expression profile of BM receptors and ligands Familial pulmonary arterial hypertension BM6 BM2 BM4 BM6 BM4 BM2 BM9/1 GDF5 BMR-IA (ALK3) BMR-IB (ALK6) Juvenile gastrointestinal polyposis Hereditary brachydactyly BMR -II ALK3 BMR -II ALK6 BMR -II ALK1 Upton et al. Mol harmacol. 28;73: David et al Blood. 27;19: BMR-II wild type Ligand binding and cysteine kinase domain mutations Non-cysteine kinase domain mutations Cytoplasmic tail domain mutations Chemical chaperones improve cell surface localization of ER-retained mutant BMR-II wtbmr-ii- 5 myc C118W- 5 myc Smads p38 MAK Smads Smads Control 4-phenylbutyrate Normal vascular homeostasis Rudarakanchana et al. Hum Mol Genet. 22;11:1517- Abnormal vascular cell function Sobolewski et al. Hum Mol Genet ;17(2):318-9
3 otential for therapeutic rescue of missfolded BMR-II proteins in familial AH? Familial and idiopathic AH are associated with reduced pulmonary vascular expression of BMR-II Normal lung Exon 3 frameshift mutation BMR-II positive tissue area (%) 5 # # + CD31 positive tissue area (%) 5 Normal SH H H BMR2 mutation Normal SH H H BMR2 mutation BMR-II CD31 Atkinson et al. Circulation. 22;15: Ubiquitin ligases e.g. Smurf1/2 Viral ubiquitin ligases BMR-II BMR-I Reduced expression of BMR-II and phospho-smad1/5 in monocrotaline-induced induced AH BMR-II transcription Smads 1/5 Failure of antiproliferative effects in vascular smooth muscle Cytokines e.g. TNF-α HHV-8 8 infection HIV-1 1 infection Autoimmune inflammation Durrington et al. J Biol Chem. 21;285(48): Long L, Crosby A, et al Circulation 29;119: Adenoviral delivery of BMR-II in the hypoxic rat model of pulmonary hypertension Detection of BMR-II II-myc in rat lung following adenoviral gene delivery Reynolds, A. M. et al. Am J hysiol 27; 292: L1182-L Reynolds, A. M. et al. Am J hysiol 27; 292: L1182-L
4 Adenoviral BMRII-myc attenuates hypoxic pulmonary hypertension in the rat ulmonary artery smooth muscle cells from HAH patients exhibit reduced Smad1 mediated growth suppression ASMC(Donor1) ASMC(R491W) p-smad1 t-smad1 p-p38 t-p38 p-p44/42 t-p44/ BM Luciferase activity (% of control) BM4 + + Control ASMCs Mutant ASMCs 1 Donor IAH Mutant AH 3H-thymidine incorporation (% of.1%fbs) 1 5 Reynolds, A. M. et al. Am J hysiol 27; 292: L1182-L %FBS BM-4 (ng/ml) Yang et al Circ Res ;96: Smad1 mediates the growth inhibitory effects Of BM-4 4 in proximal ASMCs Inhibitors of DNA binding (Id) genes control cell fate and differentiation Flag-Smad1 Control BM4 Flag-Smad1+DN Smad1+DN-Smad1 control BM4 A B C D E F G H Transfected proximal ASMC 3 H-Thymidine incorporation (% of.1%fbs) DN-Smad1.1%FBS 1 5 BM4 (ng/ml) Control Vector.1%FBS 1 5 BM4 (ng/ml) Yang et al Circ Res ;96: BM signaling pathway BMR-II BMR-I Mutation in BMR-II reduces transcription of Id genes in response to BMs Smads 1/5 Cell specific changes in gene transcription Id gene expression Vascular cell phenotype migration and proliferation Yang et al. Circ Res ; 96: Yang et al. Circ Res 28;12: Yang et al. Circ Res 28;12:
5 Reduced Id1 gene expression in lesions of heritable AH Id gene knockdown leads to loss of the growth inhibitory effects of BMs in ASMCs Yang et al. Circ Res 28;12: Lentiviral-mediated overexpression of Id1 suppresses serum-induced proliferation of human ASMCs Con Lentivector Lenti- Lentiviral transfection efficiency Id1 rostanoid GCR DGF RTK BMR-II BMR-I Id1 -actin Vector Lenti-GF cam ERK1/2 counts (x1,) Cell specific changes in gene transcription Vascular cell phenotype migration and proliferation Smads 1/5 Id gene expression Yang et al. Circ Res 28;12: Treprostinil inhibits progression of pulmonary hypertension and vascular remodeling in monocrotaline model of H Treprostinil restores psmad1/5 signaling and Id1 gene expression in monocrotaline model of H A B E C D F Con MCT/Saline MCT/Trep H&E EVG
6 otential role of BMR2 mutations in pulmonary arterial hypertension Mutant BMR-II Abnormal vascular development? Unstable vasculature 2nd hit Inflammation Critical reduction in BM signaling Abnormal TGF-β signaling Thanks to: Kings College London Richard Trembath University of Glasgow Mandy MacLean Andrew Baker Imperial College Martin Wilkins Harvard University Ken Bloch University of Giessen Ralph Schermuly
ACTRIIA-Fc rebalances BMP and activin/tgf-β signaling to attenuate experimental pulmonary hypertension
ACTRIIAFc rebalances BM and activin/tgfβ signaling to attenuate experimental pulmonary hypertension LaiMing Yung, h.d 1 ; R. Scott earsall, h.d 2 ; Geoffrey Bocobo, B.S. 1 ; Dianne S. Sako 2 ; Teresa Dinter,
More informationElastase Mediated Pulmonary Vascular Disease. Elastase
PPH Newborn Autoimmune Heart defect Lung abnormality Pathology of Pulmonary Arterial Hypertension () Endothelial and Smooth Muscle Dysfunction Liver disease portal hyper. Pulmonary Hypertension Infectious:
More informationTumor suppressor genes D R. S H O S S E I N I - A S L
Tumor suppressor genes 1 D R. S H O S S E I N I - A S L What is a Tumor Suppressor Gene? 2 A tumor suppressor gene is a type of cancer gene that is created by loss-of function mutations. In contrast to
More informationSupplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
More informationMUTATION IN BONE MORPHOGENETIC PROTEIN RECEPTOR II GENE AS A CAUSE OF PULMONARY HYPERTENSION
MUTATION IN BONE MORPHOGENETIC PROTEIN RECEPTOR II GENE AS A CAUSE OF PULMONARY HYPERTENSION MUTATION IN THE GENE FOR BONE MORPHOGENETIC PROTEIN RECEPTOR II AS A CAUSE OF PRIMARY PULMONARY HYPERTENSION
More informationMultistep nature of cancer development. Cancer genes
Multistep nature of cancer development Phenotypic progression loss of control over cell growth/death (neoplasm) invasiveness (carcinoma) distal spread (metastatic tumor) Genetic progression multiple genetic
More informationBIOL2005 WORKSHEET 2008
BIOL2005 WORKSHEET 2008 Answer all 6 questions in the space provided using additional sheets where necessary. Hand your completed answers in to the Biology office by 3 p.m. Friday 8th February. 1. Your
More informationInsulin Resistance. Biol 405 Molecular Medicine
Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationControl of Cell Proliferation by Peptide Growth Factors. Autocrine Growth Factor Production Causes Malignant Transformation?
Control of Cell Proliferation by Peptide Growth Factors Autocrine Growth Factor Production Causes Malignant Transformation? Transforming Activities From Condition Media from a Tumor Cell Line Condition
More informationDevelopment of Carcinoma Pathways
The Construction of Genetic Pathway to Colorectal Cancer Moriah Wright, MD Clinical Fellow in Colorectal Surgery Creighton University School of Medicine Management of Colon and Diseases February 23, 2019
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
More informationPotential Role for the Bone Morphogenetic Antagonist Gremlin in Pulmonary Hypertension
Potential Role for the Bone Morphogenetic Antagonist Gremlin in Pulmonary Hypertension Dr Sean Gaine National Pulmonary Hypertension Unit Mater Misericordiae University Hospital University College Dublin
More informationTbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationPrinciples of cell signaling Lecture 4
Principles of cell signaling Lecture 4 Johan Lennartsson Molecular Cell Biology (1BG320), 2014 Johan.Lennartsson@licr.uu.se 1 Receptor tyrosine kinase-induced signal transduction Erk MAP kinase pathway
More informationsupplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
More informationS1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
More informationA class of genes that normally suppress cell proliferation. p53 and Rb..ect. suppressor gene products can release cells. hyperproliferation.
Tumor Suppressor Genes A class of genes that normally suppress cell proliferation. p53 and Rb..ect Mutations that inactivate the tumor suppressor gene products can release cells from growth suppression
More informationMuscular Dystrophy. Biol 405 Molecular Medicine
Muscular Dystrophy Biol 405 Molecular Medicine Duchenne muscular dystrophy Duchenne muscular dystrophy is a neuromuscular disease that occurs in ~ 1/3,500 male births. The disease causes developmental
More informationPulmonary hypertension; does gender matter?
Pulmonary hypertension; does gender matter? Nazzareno Galiè Istituto di Cardiologia Università di Bologna nazzareno.galie@unibo.it Galiè N et al. European Heart Journal (2009) 30, 2493 2537 Pulmonary Hypertension
More informationReviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): In this manuscript, Song et al. identified FBXW7 as a new positive regulator for RIG-Itriggered type I IFN signaling pathway. The authors observed
More informationChapter. Diffusion capacity and BMPR2 mutations in pulmonary arterial hypertension
Chapter 7 Diffusion capacity and BMPR2 mutations in pulmonary arterial hypertension P. Trip B. Girerd H.J. Bogaard F.S. de Man A. Boonstra G. Garcia M. Humbert D. Montani A. Vonk Noordegraaf Eur Respir
More informationSupplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
More informationCancer Genetics. What is Cancer? Cancer Classification. Medical Genetics. Uncontrolled growth of cells. Not all tumors are cancerous
Session8 Medical Genetics Cancer Genetics J avad Jamshidi F a s a U n i v e r s i t y o f M e d i c a l S c i e n c e s, N o v e m b e r 2 0 1 7 What is Cancer? Uncontrolled growth of cells Not all tumors
More informationResearch article. Department of Pharmacology and Toxicology, Medical College of Georgia, Georgia Health Sciences University, Augusta, Georgia, USA.
Research article Calpain mediates pulmonary vascular remodeling in rodent models of pulmonary hypertension, and its inhibition attenuates pathologic features of disease Wanli Ma, 1 Weihong Han, 1 Peter
More informationHST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007
MIT OpenCourseWare http://ocw.mit.edu HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationPrimary Pulmonary Hypertension Is Associated With Reduced Pulmonary Vascular Expression of Type II Bone Morphogenetic Protein Receptor
Primary Pulmonary Hypertension Is Associated With Reduced Pulmonary Vascular Expression of Type II Bone Morphogenetic Protein Receptor Carl Atkinson, BSc; Susan Stewart, FRCPath; Paul D. Upton, PhD; Rajiv
More informationUpdate On Current Concepts And Treatment Of Pulmonary Hypertension
Ottawa Hospital Research Institute Institute de recherche de l Hopital d Ottawa Update On Current Concepts And Treatment Of Pulmonary Hypertension ACC Rockies March 11-14, 2012 Dr. Duncan J. Stewart, CEO
More informationsupplementary information
DOI: 10.1038/ncb2153 Figure S1 Ectopic expression of HAUSP up-regulates REST protein. (a) Immunoblotting showed that ectopic expression of HAUSP increased REST protein levels in ENStemA NPCs. (b) Immunofluorescent
More informationRAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.
۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,
More informationAngiogenesis in Human Development. Vascular Development
Angiogenesis in Human Development Jan Kitajewski ICRC 217B, ph 851-4688, email: jkk9 BACKGROUND READING: Vascular Development Signaling Vascular Morphogenesis and Maintenance Douglas Hanahan. Science 277:
More informationRAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
More informationSrc-INACTIVE / Src-INACTIVE
Biology 169 -- Exam 1 February 2003 Answer each question, noting carefully the instructions for each. Repeat- Read the instructions for each question before answering!!! Be as specific as possible in each
More informationCANCER. Inherited Cancer Syndromes. Affects 25% of US population. Kills 19% of US population (2nd largest killer after heart disease)
CANCER Affects 25% of US population Kills 19% of US population (2nd largest killer after heart disease) NOT one disease but 200-300 different defects Etiologic Factors In Cancer: Relative contributions
More informationHormones and Cancer Research Unit Department of Medicine, McGill University Dr. Jean-Jacques Lebrun
Hormones and Cancer Research Unit Department of Medicine, McGill University www.hcru.mcgill.ca Dr. Jean-Jacques Lebrun TGF /Smad signaling pathways CELLULAR AND MOLECULAR BIOLOGY Institut de recherches
More informationImmune surveillance hypothesis (Macfarlane Burnet, 1950s)
TUMOR-IMMUNITÄT A.K. Abbas, A.H. Lichtman, S. Pillai (6th edition, 2007) Cellular and Molecular Immunology Saunders Elsevier Chapter 17, immunity to tumors Immune surveillance hypothesis (Macfarlane Burnet,
More information1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples. Major Principles:
Carcinogenesis 1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples Carcinogenesis Major Principles: 1. Nonlethal genetic damage is central to
More informationTable S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
More informationSupplementary Figure 1. TNFα reduces BMPR-II protein and mrna expression via NF-кB/RELA. (a and b) Representative immunoblots of BMPR-II in human
Supplementary Figure 1. TNFα reduces BMPR-II protein and mrna expression via NF-кB/RELA. (a and b) Representative immunoblots of BMPR-II in human dpasmcs (a) and PAECs (b) treated with IL-1β (1 ng ml -1
More informationThe functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein
THESIS BOOK The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein Orsolya Buzás-Bereczki Supervisors: Dr. Éva Bálint Dr. Imre Miklós Boros University of
More informationPhospholipase C γ Prof. Graham Carpenter
Graham Carpenter, h.d. rofessor of Biochemistry Cornelia Crooke Department of Biochemistry Vanderbilt University School of Medicine, Nashville, TN 1 Receptor Tyrosine Kinases GF Extracellular M Intracellular
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More informationProblem Set 5 KEY
2006 7.012 Problem Set 5 KEY ** Due before 5 PM on THURSDAY, November 9, 2006. ** Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. You are studying the development
More informationCancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
More informationAntibodies for Unfolded Protein Response
Novus-lu-2945 Antibodies for Unfolded rotein Response Unfolded roteins ER lumen GR78 IRE-1 GR78 ERK Cytosol GR78 TRAF2 ASK1 JNK Activator Intron RIDD elf2α Degraded mrna XB1 mrna Translation XB1-S (p50)
More informationPulmonary arterial hypertension (PAH) is a. Targeted gene delivery of BMPR2 attenuates pulmonary hypertension
Eur Respir J 212; 39: 329 343 DOI: 1.1183/931936.18731 CopyrightßERS 212 Targeted gene delivery of BMPR2 attenuates pulmonary hypertension A.M. Reynolds,#, M.D. Holmes,#,", S.M. Danilov +,1 and P.N. Reynolds,#,"
More informationCancer genetics
Cancer genetics General information about tumorogenesis. Cancer induced by viruses. The role of somatic mutations in cancer production. Oncogenes and Tumor Suppressor Genes (TSG). Hereditary cancer. 1
More informationBIO360 Fall 2013 Quiz 1
BIO360 Fall 2013 Quiz 1 Name: Key 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function
More informationCHEST Translating Basic Research Into Clinical Practice
--- -- -- - - CHEST Translating Basic Research Into Clinical Practice Molecular Mechanisms of Pulmonary Arterial Hypertension* Role of Mutations in the Bone Morphogenetic Protein Type II Receptor Rachel
More informationCell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
More informationCYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
More informationTARGETS OF CYCLIN D1-CDK
TARGETS OF CYCLIN D1-CDK FIRST TARGET OF THE COMPLEX CYCLIN D-KINASI: prb, IS THE PRODUCT OF THE GENE CONFERRING SUSCEPTIBILITY TO RETINOBLASTOMA - ABSENT OR MUTATED IN SEVERAL HUMAN CANCERS - TRANSCRIPTIONL
More informationMolecular biology :- Cancer genetics lecture 11
Molecular biology :- Cancer genetics lecture 11 -We have talked about 2 group of genes that is involved in cellular transformation : proto-oncogenes and tumour suppressor genes, and it isn t enough to
More informationFamilial and Hereditary Colon Cancer
Familial and Hereditary Colon Cancer Aasma Shaukat, MD, MPH, FACG, FASGE, FACP GI Section Chief, Minneapolis VAMC Associate Professor, Division of Gastroenterology, Department of Medicine, University of
More informationFollicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development.
Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai Follicular Lymphoma 1. Characterized by t(14:18) translocation 2. Ig heavy
More informationProblem Set 8 Key 1 of 8
7.06 2003 Problem Set 8 Key 1 of 8 7.06 2003 Problem Set 8 Key 1. As a bright MD/PhD, you are interested in questions about the control of cell number in the body. Recently, you've seen three patients
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationMicroglia, Inflammation, and FTD
FTD Minicourse April, 2009 Microglia, Inflammation, and FTD Li Gan, Ph.D Gladstone Institute of Neurological Disease University of California, San Francisco Outline Why study inflammation in neurodegeneration?
More informationSupplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress
Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,
More informationInner Nuclear Membrane Protein MAN1 and Regulation of R-Smad Signaling
4th International Melorheostosis Association Conference Inner Nuclear Membrane Protein MAN1 and Regulation of R-Smad Signaling Howard J. Worman Columbia University New York, NY The Nuclear Envelope By
More informationNALP12, a gene responsible for periodic fever syndromes. Isabelle Jéru INSERM U.654, Paris, FRANCE
NALP12, a gene responsible for periodic fever syndromes Isabelle Jéru INSERM U.654, Paris, FRANCE Hereditary periodic fever syndromes (HPFs) Phenotype 6 clinical entities Fever episodes Abdominal pain
More informationSUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
More informationTyrosine Kinase Inhibitors
European Society of Cardiology ESC CONGRESS 2011 aris, August 27-31, 2011 New Approaches to the Treatment of ulmonary Hypertension: Tyrosine Kinase Inhibitors Stephan Rosenkranz Klinik III für Innere Medizin
More informationPulmonary vascular remodelling: causes, mechanisms and consequences
Pulmonary vascular remodelling: causes, mechanisms and consequences Ralph Schermuly Department of Pulmonary Pharmacotherapy University of Giessen and Marburg Lung Center email: ralph.schermuly@ugmlc.de
More informationCover Page. The handle holds various files of this Leiden University dissertation.
Cover Page The handle http://hdl.handle.net/1887/22278 holds various files of this Leiden University dissertation. Author: Cunha Carvalho de Miranda, Noel Filipe da Title: Mismatch repair and MUTYH deficient
More informationFamilial and Hereditary Colon Cancer
Familial and Hereditary Colon Cancer Aasma Shaukat, MD, MPH, FACG, FASGE, FACP GI Section Chief, Minneapolis VAMC Associate Professor, Division of Gastroenterology, Department of Medicine, University of
More informationMelorheostosis Current Understanding and Recent Developments
Melorheostosis Current Understanding and Recent Developments Robert E. Fleming, M.D. Associate Professor of Pediatrics and Biochemistry & Molecular Biology Saint Louis University School of Medicine Clinical
More informationPrediction of invasiveness of hepatic tumor cells
Prediction of invasiveness of hepatic tumor cells (Overexpression of Romo1 Promotes Production of Reactive Oxygen Species and Invasiveness of Hepatic Tumor Cells) (Romo1 : Reactive Oxygen Species Modulator
More informationCancer. October is National Breast Cancer Awareness Month
Cancer October is National Breast Cancer Awareness Month Objectives 1: Gene regulation Explain how cells in all the different parts of your body develop such different characteristics and functions. Contrast
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
More informationSupplementary Figure 1: Uncropped western blots for Figure 1B. Uncropped blots shown in Figure 1B, showing that NOTCH intracellular domain (NICD) is
Supplementary Figure 1: Uncropped western blots for Figure 1B. Uncropped blots shown in Figure 1B, showing that NOTCH intracellular domain (NICD) is increased with exposure of HUVEC to 1h FSS, and that
More informationFunctional Genomics : PTPRF-Mediated Contact Inhibition in HCC development
Functional Genomics : PTPRF-Mediated Contact Inhibition in HCC development Sen-Yung Hsieh, MD, PhD Liver Research Unit Chang Gung Memorial Hospital Taoyuan, Taiwan Aims To identify genes controlling tumor
More informationG-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D
G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters
More informationIdentification of a novel duplication mutation in the VHL gene in a large Chinese family with Von Hippel-Lindau (VHL) syndrome
Identification of a novel duplication mutation in the VHL gene in a large Chinese family with Von Hippel-Lindau (VHL) syndrome L.H. Cao 1, B.H. Kuang 2, C. Chen 1, C. Hu 2, Z. Sun 1, H. Chen 2, S.S. Wang
More informationT cell maturation. T-cell Maturation. What allows T cell maturation?
T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry
More informationTITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer
AD Award Number: W81XWH-04-1-0325 TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer PRINCIPAL INVESTIGATOR: Valerie Boka CONTRACTING ORGANIZATION: University of Texas Health Science
More informationTyrosine kinases. Cell surface receptors ligand binding. Producer cell RNA. Target cell
Tyrosine kinases http://msbl.helsinki.fi/tkseminar roducer cell Signaling molecules Receptor binding Signal transduction Target cell Activation of Gene expression RNA Biological responses proliferation,
More informationThe Phagocytic Synapse in Distinguishing Particulate and Soluble Stimuli David M. Underhill
The hagocytic Synapse in Distinguishing articulate and Soluble Stimuli The hagocytic Synapse in Distinguishing articulate and Soluble Stimuli How does a cell know the difference between an inflammatory
More information(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
More informationGenetics of Cancer Lecture 32 Cancer II. Prof. Bevin Engelward, MIT Biological Engineering Department
Genetics of Cancer Lecture 32 Cancer II rof. Bevin Engelward, MIT Biological Engineering Department Why Cancer Matters New Cancer Cases in 1997 Cancer Deaths in 1997 Genetics of Cancer: Today: What types
More informationT cell-mediated immunity
T cell-mediated immunity Overview For microbes within phagosomes in phagocytes.cd4+ T lymphocytes (TH1) Activate phagocyte by cytokines studies on Listeria monocytogenes For microbes infecting and replicating
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationoncogenes-and- tumour-suppressor-genes)
Special topics in tumor biochemistry oncogenes-and- tumour-suppressor-genes) Speaker: Prof. Jiunn-Jye Chuu E-Mail: jjchuu@mail.stust.edu.tw Genetic Basis of Cancer Cancer-causing mutations Disease of aging
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More informationRole of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation
Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation In-kyu Lee, M.D., Ph. D. Dept. of Internal Med, Keimyung Univ., School of Med. Taegu, Korea Oxidative Stress and Atherosclerosis
More informationRole of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies. Traditional Hypothesis Stress
3/1/212 Role of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies K.R. Stenmark University of Colorado Denver, CO 845 Prominent Fibroproliferative
More informationSupplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.
Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William
More information609G: Concepts of Cancer Genetics and Treatments (3 credits)
Master of Chemical and Life Sciences Program College of Computer, Mathematical, and Natural Sciences 609G: Concepts of Cancer Genetics and Treatments (3 credits) Text books: Principles of Cancer Genetics,
More informationCancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
More informationNon-Mendelian inheritance
Non-Mendelian inheritance Focus on Human Disorders Peter K. Rogan, Ph.D. Laboratory of Human Molecular Genetics Children s Mercy Hospital Schools of Medicine & Computer Science and Engineering University
More informationHypercholesterolemia: So much cholesterol, so many causes
Hypercholesterolemia: So much cholesterol, so many causes Student group names kept anonymous Department of Biology, Lake Forest College, Lake Forest, IL 60045, USA Hypercholesterolemia is a disease characterized
More informationBIO360 Fall 2013 Quiz 1
BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.
More informationIdentification and characterization of genes responsive to apoptosis: Application of DNA chip technology and mrna differential display
Histol Histopathol (2000) 15: 1271-1 284 http://www.ehu.es/histol-histopathol Histology and H istopat hology Cellular and Molecular Biology Invited Revie W Identification and characterization of genes
More informationUvA-DARE (Digital Academic Repository) Marfan syndrome: Getting to the root of the problem Franken, Romy. Link to publication
UvA-DARE (Digital Academic Repository) Marfan syndrome: Getting to the root of the problem Franken, Romy Link to publication Citation for published version (APA): Franken, R. (2016). Marfan syndrome: Getting
More informationSignaling. Dr. Sujata Persad Katz Group Centre for Pharmacy & Health research
Signaling Dr. Sujata Persad 3-020 Katz Group Centre for Pharmacy & Health research E-mail:sujata.persad@ualberta.ca 1 Growth Factor Receptors and Other Signaling Pathways What we will cover today: How
More information