Functional Genomics : PTPRF-Mediated Contact Inhibition in HCC development
|
|
- Georgiana Dean
- 6 years ago
- Views:
Transcription
1 Functional Genomics : PTPRF-Mediated Contact Inhibition in HCC development Sen-Yung Hsieh, MD, PhD Liver Research Unit Chang Gung Memorial Hospital Taoyuan, Taiwan
2 Aims To identify genes controlling tumor initiation of human hepatoma from human kinome and phosphatome
3
4
5 PTPRF: a suppressor of tumor initiation in HCC?
6 Rabi et al., Hepatology sins siptprf sins siptprf Hep3B HepG sins siptprf sins siptprf Huh SK-Hep
7 Relative cell counts/stationary phase Rabi et al., Hepatology 2014 Silencing of PTPRF enhances cell proliferation and increases total cell numbers Control shptprf-1 shptprf-2 P<0.001 P<0.02 P<0.002 HepG2 Huh7 SKHep1
8 Colony number Rabi et al., Hepatology 2014 Silencing of PTPRF enhances anchorage-independent cell growth shluci clone-1 clone-2 10 shptprf 0 shluci shptprf Soft-agar assays for tumor sphere formation
9 shptprf control Volume of tumor (mm 3 ) Rabi et al., Hepatology 2014 Silencing of PTPRF enhances xenograft tumor formation shptprf shluci Control Time (wk)
10 Relative cell counts/stationary phase Colony number Rabi et al., Hepatology 2014 Ectopic expression of wild-type PTPRF, but not the phosphatase mutant, suppresses proliferation and tumorigenecity 3.00 Vector PTPRF-wd PTPRF-mt P< Vector PTPRF-wd PTPRF-mt P<0.01 P< SKHep HepG2 Huh7 SKHep Vector wd mt SK-control SK-LAR/WT SK-LAR-C/S The biological functions depend on its phosphatase activities!
11 Summary PTPRF suppresses cell proliferation and tumor initiation c/w a TSG Suppression of tumor formation depends on its phosphatase activities PTPRF suppresses total cell mass involved in contact inhibition??? Rabi et al., Hepatology 2014
12 Hanahan & Weinberg 2011
13 Hypothesis PTPRF PTPRF functions as a negative regulator to prevent overproliferation A negative feedback loop prevents hyperproliferation and tumor formation? Growth stimuli Cell proliferation? PTPRF
14 Does cell proliferation induce PTPRF expression? Rabi et al., Hepatology 2014
15 Is PTPRF induced due to increased cell density? Rabi et al., Hepatology 2014
16 Is PTPRF induced by cell-cell contact? PTPRF GAPDH Cell density (10 5 /well) EGTA mm mm 5 mm x 10 5 /well EGTA: 0 mm 4.5 x 10 5 /well EGTA: 5 mm Rabi et al., Hepatology 2014
17 Tentative conclusion PTPRF suppresses tumor formation PTPRF suppresses cell proliferation and total cell mass during proliferation PTPRF is induced by cell-cell contact during proliferation Loss of PTPRF function hyperproliferation and tumor initiation Growth stimuli Growth stimuli Cell proliferation Cell proliferation Overgrowth & tumor initiation PTPRF PTPRF Rabi et al., Hepatology 2014
18 How PTPRF suppresses cell proliferation? Cell proliferation Cell-cell contact? PTPRF?? growth signaling
19 PTPRF inhibits ERK phosphorylation/activation in response to growth stimuli Rabi et al., Hepatology 2014
20 Rabi et al., Hepatology 2014 PTPRF inhibits ERK-dependent signaling RTK RAS RAF MEK ERK elf4e RSK MYC MNK
21 PTPRF knockdown greatly enhances ERK-MYC growth signaling Rabi et al., Hepatology 2014
22 Rabi et al., Hepatology 2014 ERK1/2 activation required for MYC activation Cell proliferation Cell-cell contact MYC PTPRF? ERK RTK growth signaling
23 How PTPRF suppresses ERK-MYC signaling? Cell proliferation Cell-cell contact MYC PTPRF? ERK RTK growth signaling
24 Immunoprecipitation Rabi et al., Hepatology 2014
25 Reciprocal immunoprecipitation anti-ptprf IP: IgG Anti-SRC HepG2 Huh7 HepG2 Huh7 Proximity ligation assays IP: PTPRF IgG PP2A IB: PTPRF IB: PTPRF SRC PP2A PP2AC HepG2 Huh7 HepG2 Huh7 Abs: PTPFR+SRC PTPRF+ACTB PTPRF+PP2A Rabi et al., Hepatology 2014
26 Rabi et al., Hepatology 2014
27 A novel PTPRF-mediated contact inhibition pathway Cell-cell contact Restricted proliferation Cell proliferation Tumor initiation Hyperproliferation Cell-cell contact PTPRF MYC MYC PTPRF SRC PP2A ERK ERK RTK RTK Aberrant growth signaling
28 Relative IHC score Case 1 2 PTPRF downregulated in ~40% of HCC upregulated in ~22% of HCC N N T P = P = P = T 0.00 Tumor stage I II II III III Non-tumor N T N T N T N T N T N T N T N T N T N T N T N T N T N T nl PTPRF b- Actin PTPRF b-actin HCC
29 Rabi et al., Hepatology 2014 The PTPRF gene frequently deleted in HCC (20.5%) cases PTPRF: 1p34.2 ( ) Chromosome 1 Gene copy variation was determined by using array CGH
30 Rabi et al., Hepatology 2014 PTPRF downregulated lower survival upregulated lower recurrence & higher survival % 100 Disease-free survival % 100 Overall survival P = P = Upregulation: yes Upregulation: no M Downregulation: yes Downregulation: no M
31 Summary The PTPRF gene Frequently deleted in human HCC ~20.5% Frequently downregulated in human HCC ~40% Frequently downregulated in human CRC ~100% Frequently downregulated in human GC ~66% PTPRF downregulation Prediction of worse clinical outcomes PTPRF is a TSG!
32 Conclusions A novel PTPRF-SRC/PP2A-ERK-MYC negativefeedback loop prevents overproliferation of cells The PTPRF-ERK-MYC pathway may involve in tissue homeostasis Disruption of this contact inhibition mechanism leads overproliferation and tumor initiation
Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma CH Li, SC Chow, DL Yin,
More informationImpact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach
Impact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach NM23-M1 "knock- out" mice (without NDPK A) Experimental models of hepatocarcinogenesis Chemical
More informationComplexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies
Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies René Bernards The Netherlands Cancer Institute Amsterdam The Netherlands Molecular versus
More informationEpstein-Barr virus driven promoter hypermethylated genes in gastric cancer
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1
More informationSupplemental File. TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer
Supplemental File TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer Daniel T. Starczynowski, William W. Lockwood, Sophie Delehouzee, Raj Chari, Joanna Wegrzyn,
More informationmtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-
Supplementary Material for mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- XL Inhibition by Suppressing MCL-1 Anthony C. Faber 1,2 *, Erin M. Coffee
More informationBmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas
Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng
More informationTranslating Research into Clinical Practice: Strategies Against Hepatocellular Cancer
Translating Research into Clinical Practice: Strategies Against Hepatocellular Cancer Kevin Staveley-O Carroll, PhD, MD, FACS Professor and Chair, Department of Surgery Director of the Ellis Fischel Cancer
More informationProblem Set 8 Key 1 of 8
7.06 2003 Problem Set 8 Key 1 of 8 7.06 2003 Problem Set 8 Key 1. As a bright MD/PhD, you are interested in questions about the control of cell number in the body. Recently, you've seen three patients
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationCell cycle related kinase is a direct androgen receptor regulated gene that drives β-catenin/ T cell factor dependent hepatocarcinogenesis
Research article Cell cycle related kinase is a direct androgen receptor regulated gene that drives β-catenin/ T cell factor dependent hepatocarcinogenesis Hai Feng, 1 Alfred S.L. Cheng, 2 Daisy P. Tsang,
More informationSupplemental Data Macrophage Migration Inhibitory Factor MIF Interferes with the Rb-E2F Pathway
Supplemental Data Macrophage Migration Inhibitory Factor MIF Interferes with the Rb-E2F Pathway S1 Oleksi Petrenko and Ute M. Moll Figure S1. MIF-Deficient Cells Have Reduced Transforming Ability (A) Soft
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationCancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
More informationBIO360 Fall 2013 Quiz 1
BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.
More informationDevelopment of a Conditional Replication Competent Adenovirus, Controlled by the Human Telomerase Promoter (htert)
Development of a Conditional Replication Competent Adenovirus, Controlled by the Human Telomerase Promoter (htert) Eunhee Kim, Joo-Hang Kim, M.D., Ha-Youn Shin, Han Saem Lee, Joo-Hyuk Sohn, M.D., Jai Myung
More informationAACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855
Investigation of the Growth Inhibitory Activity of the MEK Inhibitor ARRY-162 in Combination with Everolimus in a Variety of KRas and PI3K Pathway Mutant Cancers Brian Tunquist, Tyler Risom, Debbie Anderson,
More informationNegative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α
Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,
More informationFrequent intrahepatic metastasis is a unique feature
Neuregulin/Erythroblastic Leukemia Viral Oncogene Homolog 3 Autocrine Loop Contributes to Invasion and Early Recurrence of Human Hepatoma Sen-Yung Hsieh, 1,2,4 Jung-Ru He, 1 Chih-Yun Hsu, 1 Wan-Ju Chen,
More informationProtein tyrosine phosphatase 1B targets PITX1/p120RasGAP. thus showing therapeutic potential in colorectal carcinoma
Protein tyrosine phosphatase 1B targets PITX1/p120RasGAP thus showing therapeutic potential in colorectal carcinoma Hao-Wei Teng, Man-Hsin Hung, Li-Ju Chen, Mao-Ju Chang, Feng-Shu Hsieh, Ming-Hsien Tsai,
More informationA particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se
A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy serves as a defence mechanism that prevents or retards
More information(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
More informationSupplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
More informationOpposing activities of the Ras and Hippo pathways converge on regulation of YAP protein turnover
The EMBO Journal Peer Review Process File - EMBO-2014-89385 Manuscript EMBO-2014-89385 Opposing activities of the Ras and Hippo pathways converge on regulation of YAP protein turnover Xin Hong, Hung Thanh
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More informationSupplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
More informationGenetics of Cancer Lecture 32 Cancer II. Prof. Bevin Engelward, MIT Biological Engineering Department
Genetics of Cancer Lecture 32 Cancer II rof. Bevin Engelward, MIT Biological Engineering Department Why Cancer Matters New Cancer Cases in 1997 Cancer Deaths in 1997 Genetics of Cancer: Today: What types
More informationGankyrin plays an essential role in Ras-induced tumorigenesis through regulation of the RhoA/ROCK pathway in mammalian cells
Research article Gankyrin plays an essential role in Ras-induced tumorigenesis through regulation of the RhoA/ROCK pathway in mammalian cells Jiang-Hong Man, Bing Liang, Yue-Xi Gu, Tao Zhou, Ai-Ling Li,
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human
More informationChristian Frezza MRC Cancer Unit
Christian Frezza MRC Cancer Unit What is cancer? What is cancer? Douglas Hanahan, Robert A. Weinberg; The Hallmarks of Cancer Cell, Volume 100, Issue 1, 7 January 2000, Pages 57 70 Cancer cells need energy
More informationsupplementary information
DOI: 10.1038/ncb2153 Figure S1 Ectopic expression of HAUSP up-regulates REST protein. (a) Immunoblotting showed that ectopic expression of HAUSP increased REST protein levels in ENStemA NPCs. (b) Immunofluorescent
More informationDetermination Differentiation. determinated precursor specialized cell
Biology of Cancer -Developmental Biology: Determination and Differentiation -Cell Cycle Regulation -Tumor genes: Proto-Oncogenes, Tumor supressor genes -Tumor-Progression -Example for Tumor-Progression:
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-10-1-1029 TITLE: PRINCIPAL INVESTIGATOR: Mu-Shui Dai, M.D., Ph.D. CONTRACTING ORGANIZATION: Oregon Health Science niversity, Portland, Oregon 97239 REPORT DATE: October 2013 TYPE
More informationMany Forms of Cell-Cell Communication Regulate Tissue Function and Phenotype Physiological Functions of Gap Junctions Homeostasis buffering/sharing of ions, nutrients, and water Metabolic support nutrient
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationKinome Profiling: The Potential in ER-Negative Patients. Charles M. Perou, Ph.D. Departments of Genetics and Pathology
Kinome Profiling: The Potential in ER-Negative Patients Charles M. Perou, Ph.D. Departments of Genetics and Pathology Lineberger Comprehensive Cancer Center University of North Carolina Chapel Hill, North
More informationHepatitis B virus X gene in the development of hepatocellular carcinoma. Citation Hong Kong Medical Journal, 2011, v. 17 n. 6, suppl. 6, p.
Title Hepatitis B virus X gene in the development of hepatocellular carcinoma Author(s) Ma, NF; Lau, SH; Hu, L; Dong, SS; Guan, XY Citation Hong Kong Medical Journal, 2011, v. 17 n. 6, suppl. 6, p. 44-47
More informationCancer Genomics (Current technologies & clinical implication)
Cancer Genomics (Current technologies & clinical implication) Jeonghee Cho, Ph.D. Samsung Medical Center Samsung Cancer Research Institute Robert Weinberg (M.I.T) Douglas Hanahan (ISREC) The Hallmarks
More informationProtein tyrosine kinase signaling
rotein tyrosine kinase signaling Serge ROCHE CRBM CNRS/Montpellier University serge.roche@crbm.cnrs.fr rotein phosphorylation on Tyr A central mechanism to control cell communication in a multicellular
More informationRAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.
۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,
More informationPredictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
More informationSupplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was
Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was performed on a total of 85 SS patients. Data filtration
More informationCyclin E1 and RTK/RAS signaling drive CDK inhibitor resistance via activation of E2F and ETS
/, Vol. 6, No.2 Cyclin E1 and RTK/RAS signaling drive CDK inhibitor resistance via activation of E2F and ETS Barbie Taylor-Harding 1, Paul-Joseph Aspuria 1, Hasmik Agadjanian 1, Dong-Joo Cheon 1, Takako
More informationCANCER. Inherited Cancer Syndromes. Affects 25% of US population. Kills 19% of US population (2nd largest killer after heart disease)
CANCER Affects 25% of US population Kills 19% of US population (2nd largest killer after heart disease) NOT one disease but 200-300 different defects Etiologic Factors In Cancer: Relative contributions
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationCancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationSignaling. Dr. Sujata Persad Katz Group Centre for Pharmacy & Health research
Signaling Dr. Sujata Persad 3-020 Katz Group Centre for Pharmacy & Health research E-mail:sujata.persad@ualberta.ca 1 Growth Factor Receptors and Other Signaling Pathways What we will cover today: How
More informationColorectal cancer: pathology
UK NEQAS for Molecular Pathology Colorectal cancer: pathology Nick West Pathology & Tumour Biology May 2013 Colorectal cancer (CRC) 40,695 new cases in 2010 15,708 deaths Management of CRC Surgery Main
More informationEPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
More informationUnderstanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma
Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma Muska Hassan NCI-ICBP Summer Fellow Broad Institute of MIT and Harvard: Cancer Program Mentor: Cory Johannessen,
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/322/ra38/dc1 Supplementary Materials for Dynamic Reprogramming of Signaling Upon Met Inhibition Reveals a Mechanism of Drug Resistance in Gastric Cancer Andrea
More informationActivation of cellular proto-oncogenes to oncogenes. How was active Ras identified?
Dominant Acting Oncogenes Eugene E. Marcantonio, M.D. Ph.D. Oncogenes are altered forms of normal cellular genes called proto-oncogenes that are involved in pathways regulating cell growth, differentiation,
More informationInfect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SAM library or vector. Introduce AKT reporter
Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SM library or vector Introduce reporter Grow cells in presence of puromycin for 5 days Vector control SM library fewer surviving cells More surviving
More informationFamilial PAH. Genetics and pulmonary arterial hypertension. PAH and mutations in the bone morphogenetic protein type II receptor (BMPR-II)
athology of vascular lesions in idiopathic pulmonary arterial hypertension Genetics and pulmonary arterial hypertension Concentric intimal lesion Nick Morrell British Heart Foundation rofessor of Cardiopulmonary
More informationHepatocellular carcinoma (HCC) is currently
Discovery of Novel Src Homology Region 2 Domain- Containing Phosphatase 1 Agonists From Sorafenib for the Treatment of Hepatocellular Carcinoma Wei-Tien Tai, 1,2* Chung-Wai Shiau, 3* Pei-Jer Chen, 1 Pei-Yi
More informationA class of genes that normally suppress cell proliferation. p53 and Rb..ect. suppressor gene products can release cells. hyperproliferation.
Tumor Suppressor Genes A class of genes that normally suppress cell proliferation. p53 and Rb..ect Mutations that inactivate the tumor suppressor gene products can release cells from growth suppression
More informationBasic tumor nomenclature
Jonas Nilsson jonas.a.nilsson@surgery.gu.se Sahlgrenska Cancer Center Bilder gjorda av Per Holmfeldt och Jonas Nilsson Benign tumor Basic tumor nomenclature Malignant tumor = cancer Metastasis Carcinoma:
More informationLecture 7: Signaling Through Lymphocyte Receptors
Lecture 7: Signaling Through Lymphocyte Receptors Questions to Consider After recognition of its cognate MHC:peptide, how does the T cell receptor activate immune response genes? What are the structural
More informationPrediction of invasiveness of hepatic tumor cells
Prediction of invasiveness of hepatic tumor cells (Overexpression of Romo1 Promotes Production of Reactive Oxygen Species and Invasiveness of Hepatic Tumor Cells) (Romo1 : Reactive Oxygen Species Modulator
More informationIntroduction. Cancer Biology. Tumor-suppressor genes. Proto-oncogenes. DNA stability genes. Mechanisms of carcinogenesis.
Cancer Biology Chapter 18 Eric J. Hall., Amato Giaccia, Radiobiology for the Radiologist Introduction Tissue homeostasis depends on the regulated cell division and self-elimination (programmed cell death)
More informationTumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary
More informationTargeting of the MUC1-C Oncoprotein in Colitis-Associated Colorectal Cancer
AD Award Number: W81XWH-12-1-0322 TITLE: Targeting of the MUC1-C Oncoprotein in Colitis-Associated Colorectal Cancer PRINCIPAL INVESTIGATOR: Kufe, Donald W., M.D. CONTRACTING ORGANIZATION: Boston, MA 02215-5450
More informationSupplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap
Supplementary Figure 1. a. b. p-value for depletion in vehicle (DMSO) 1e-05 1e-03 1e-01 1 0 1000 2000 3000 4000 5000 Genes log2 normalized shrna counts in T0 0 2 4 6 8 sh1 shluc 0 2 4 6 8 log2 normalized
More informationNegative feedback regulation of the ERK1/2 MAPK pathway
Cell. Mol. Life Sci. DOI 10.1007/s00018-016-2297-8 Cellular and Molecular Life Sciences REVIEW Negative feedback regulation of the ERK1/2 MAPK pathway David Lake 1 Sonia A. L. Corrêa 2,3 Jürgen Müller
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationSupplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the
Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant
More informationHepatocellular carcinoma (HCC) is one of the
Isolation and Characterization of a Novel Oncogene, Amplified in Liver Cancer 1, within a Commonly Amplified Region at 1q21 in Hepatocellular Carcinoma Ning-Fang Ma, 1,2 * Liang Hu, 2 * Jackie M. Fung,
More informationFile Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'
More informationcondition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%
FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence
More informationSupplementary Figure 1: Comparison of acgh-based and expression-based CNA analysis of tumors from breast cancer GEMMs.
Supplementary Figure 1: Comparison of acgh-based and expression-based CNA analysis of tumors from breast cancer GEMMs. (a) CNA analysis of expression microarray data obtained from 15 tumors in the SV40Tag
More informationSupplemental Figure S1A Notch1
Supplemental Figure S1A Notch1 erage) epth of Cove ormalized De Log1(No Notch exons Figure S1: A) Relative coverage of Notch1 and Notch 2 exons in HCC2218, HCC1187, MB157, MDA-MB157 cell lines. Blue color
More informationCooperative interaction of MUC1 with the HGF/c-Met pathway during hepatocarcinogenesis
Bozkaya et al. Molecular Cancer 212, 11:64 RESEARCH Open Access Cooperative interaction of with the HGF/c-Met pathway during hepatocarcinogenesis Giray Bozkaya 1, Peyda Korhan 1, Murat Çokaklı 1, Esra
More informationOncogenes and Tumor. supressors
Oncogenes and Tumor supressors From history to therapeutics Serge ROCHE Neoplastic transformation TUMOR SURESSOR ONCOGENE ONCOGENES History 1911 1960 1980 2001 Transforming retrovirus RSV v-src is an oncogene
More informationThe truncated mutant HBsAg expression increases the tumorigenesis of hepatitis B virus by regulating TGF-β/Smad signaling pathway
Wang et al. Virology Journal (2018) 15:61 https://doi.org/10.1186/s12985-018-0972-0 RESEARCH Open Access The truncated mutant HBsAg expression increases the tumorigenesis of hepatitis B virus by regulating
More informationDeregulation of signal transduction and cell cycle in Cancer
Deregulation of signal transduction and cell cycle in Cancer Tuangporn Suthiphongchai, Ph.D. Department of Biochemistry Faculty of Science, Mahidol University Email: tuangporn.sut@mahidol.ac.th Room Pr324
More informationTransgenic Mice and Genetargeting
Transgenic Mice and Genetargeting mice In Biomedical Science Techniques of transgenic and gene-targeting mice are indispensable for analyses of in vivo functions of particular genes and roles of their
More informationTumor stage : I II III IV. well differentiated. moderately differentiated. adenocarcinoma. normal colon (adjacent to cancer) Log (T/H) SLAP mrna level
moderately differentiated well differentiated Log (T/H) mrna level a Tumor stage : I II III IV.4.4.8 1.2 1.6 2. 2.4 2.8 3.2 N 1 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 # patient b normal colon (adjacent
More informationNever in mitosis gene A related kinase 6 promotes cell proliferation of hepatocellular carcinoma via cyclin B modulation
ONCOLOGY LETTERS 8: 1163-1168, 2014 Never in mitosis gene A related kinase 6 promotes cell proliferation of hepatocellular carcinoma via cyclin B modulation BIAO ZHANG 1*, HAI ZHANG 2*, DONG WANG 1, SHENG
More informationEarly Embryonic Development
Early Embryonic Development Maternal effect gene products set the stage by controlling the expression of the first embryonic genes. 1. Transcription factors 2. Receptors 3. Regulatory proteins Maternal
More informationHepaRG LX2. HepaRG HepaRG LX2 LX2
C Supporting Figure 1. Experimental design of s between and cells. (A) -hepatocytes were isolated from a 30 days of -progenitors. Differentiation into mature hepatocytes was achieved following a 2-weeks
More informationEgr-1 regulates RTA transcription through a cooperative involvement of transcriptional regulators
/, 2017, Vol. 8, (No. 53), pp: 91425-91444 Egr-1 regulates RTA transcription through a cooperative involvement of transcriptional regulators Roni Sarkar 1 and Subhash C. Verma 1 1 Department of Microbiology
More informationBIO360 Fall 2013 Quiz 1
BIO360 Fall 2013 Quiz 1 Name: Key 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function
More informationThe Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
More informationARTICLE IN PRESS. The International Journal of Biochemistry & Cell Biology xxx (2007) xxx xxx. Molecule in focus
The International Journal of Biochemistry & Cell Biology xxx (2007) xxx xxx Molecule in focus Deleted in liver cancer-1 (DLC-1): A tumor suppressor not just for liver Yi-Chun Liao, Su Hao Lo Lawrence Ellison
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationSUPPLEMENTAL EXPERIMENTAL PROCEDURES
SUPPLEMENTAL EXPERIMENTAL PROCEDURES Crystal violet assay Cells were seeded in 24-well plates and cultured in media supplemented with % FBS for 7 days. Media were then removed, plates were briefly washed
More informationPCDH9 acts as a tumor suppressor inducing tumor cell arrest at G 0 /G 1 phase and is frequently methylated in hepatocellular carcinoma
MOLECULAR MEDICINE REPORTS 16: 4475-4482, 2017 PCDH9 acts as a tumor suppressor inducing tumor cell arrest at G 0 /G 1 phase and is frequently methylated in hepatocellular carcinoma JUN LV 1,2*, PENGFEI
More informationSummary and Concluding Remarks
Summary and Concluding Remarks Chapter 6 The intestinal epithelium provides an excellent model system for investigating molecular mechanisms regulating cell lineage establishment, stem cell proliferation,
More informationResearch Communication HPIP is Upregulated in Liver Cancer and Promotes Hepatoma Cell Proliferation via Activation of G2=M Transition
Research Communication HPIP is Upregulated in Liver Cancer and Promotes Hepatoma Cell Proliferation via Activation of G2=M Transition Xiaojie Xu 1 Chengying Jiang 2,3 Shibin Wang 4 Yanhong Tai 2 Tao Wang
More informationLysine methyltransferase SMYD2 promotes cyst growth in autosomal dominant polycystic kidney disease
Lysine methyltransferase SMYD2 promotes cyst growth in autosomal dominant polycystic kidney disease Linda Xiaoyan Li,, Julien Sage, Xiaogang Li J Clin Invest. 2017;127(7):2751-2764. https://doi.org/10.1172/jci90921.
More informationReviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): The authors have presented data demonstrating activation of AKT as a common resistance mechanism in EGFR mutation positive, EGFR TKI resistant
More informationC) The graph should look exactly like the graph on the left (Mut1 cells + Mating Pheromone for 3 hours at 25 degrees). The cells arrest in G1.
706-2000-Exam 4 Answer Key 1) The question asks you to explain peaks A and B in the top graph. The other two graphs were there to give you hints. The question did not ask for these other two graphs to
More informationDaxx inhibits hypoxia-induced lung cancer cell metastasis by suppressing the HIF-1a/HDAC1/Slug axis
ARTICLE Received 22 Feb 216 Accepted 7 Nov 216 Published 22 Dec 216 Updated 7 Feb 217 DOI: 1.138/ncomms13867 inhibits hypoxia-induced lung cancer cell metastasis by suppressing the HIF-1a/HDAC1/ axis OPEN
More information