Functional Genomics : PTPRF-Mediated Contact Inhibition in HCC development

Size: px
Start display at page:

Download "Functional Genomics : PTPRF-Mediated Contact Inhibition in HCC development"

Transcription

1 Functional Genomics : PTPRF-Mediated Contact Inhibition in HCC development Sen-Yung Hsieh, MD, PhD Liver Research Unit Chang Gung Memorial Hospital Taoyuan, Taiwan

2 Aims To identify genes controlling tumor initiation of human hepatoma from human kinome and phosphatome

3

4

5 PTPRF: a suppressor of tumor initiation in HCC?

6 Rabi et al., Hepatology sins siptprf sins siptprf Hep3B HepG sins siptprf sins siptprf Huh SK-Hep

7 Relative cell counts/stationary phase Rabi et al., Hepatology 2014 Silencing of PTPRF enhances cell proliferation and increases total cell numbers Control shptprf-1 shptprf-2 P<0.001 P<0.02 P<0.002 HepG2 Huh7 SKHep1

8 Colony number Rabi et al., Hepatology 2014 Silencing of PTPRF enhances anchorage-independent cell growth shluci clone-1 clone-2 10 shptprf 0 shluci shptprf Soft-agar assays for tumor sphere formation

9 shptprf control Volume of tumor (mm 3 ) Rabi et al., Hepatology 2014 Silencing of PTPRF enhances xenograft tumor formation shptprf shluci Control Time (wk)

10 Relative cell counts/stationary phase Colony number Rabi et al., Hepatology 2014 Ectopic expression of wild-type PTPRF, but not the phosphatase mutant, suppresses proliferation and tumorigenecity 3.00 Vector PTPRF-wd PTPRF-mt P< Vector PTPRF-wd PTPRF-mt P<0.01 P< SKHep HepG2 Huh7 SKHep Vector wd mt SK-control SK-LAR/WT SK-LAR-C/S The biological functions depend on its phosphatase activities!

11 Summary PTPRF suppresses cell proliferation and tumor initiation c/w a TSG Suppression of tumor formation depends on its phosphatase activities PTPRF suppresses total cell mass involved in contact inhibition??? Rabi et al., Hepatology 2014

12 Hanahan & Weinberg 2011

13 Hypothesis PTPRF PTPRF functions as a negative regulator to prevent overproliferation A negative feedback loop prevents hyperproliferation and tumor formation? Growth stimuli Cell proliferation? PTPRF

14 Does cell proliferation induce PTPRF expression? Rabi et al., Hepatology 2014

15 Is PTPRF induced due to increased cell density? Rabi et al., Hepatology 2014

16 Is PTPRF induced by cell-cell contact? PTPRF GAPDH Cell density (10 5 /well) EGTA mm mm 5 mm x 10 5 /well EGTA: 0 mm 4.5 x 10 5 /well EGTA: 5 mm Rabi et al., Hepatology 2014

17 Tentative conclusion PTPRF suppresses tumor formation PTPRF suppresses cell proliferation and total cell mass during proliferation PTPRF is induced by cell-cell contact during proliferation Loss of PTPRF function hyperproliferation and tumor initiation Growth stimuli Growth stimuli Cell proliferation Cell proliferation Overgrowth & tumor initiation PTPRF PTPRF Rabi et al., Hepatology 2014

18 How PTPRF suppresses cell proliferation? Cell proliferation Cell-cell contact? PTPRF?? growth signaling

19 PTPRF inhibits ERK phosphorylation/activation in response to growth stimuli Rabi et al., Hepatology 2014

20 Rabi et al., Hepatology 2014 PTPRF inhibits ERK-dependent signaling RTK RAS RAF MEK ERK elf4e RSK MYC MNK

21 PTPRF knockdown greatly enhances ERK-MYC growth signaling Rabi et al., Hepatology 2014

22 Rabi et al., Hepatology 2014 ERK1/2 activation required for MYC activation Cell proliferation Cell-cell contact MYC PTPRF? ERK RTK growth signaling

23 How PTPRF suppresses ERK-MYC signaling? Cell proliferation Cell-cell contact MYC PTPRF? ERK RTK growth signaling

24 Immunoprecipitation Rabi et al., Hepatology 2014

25 Reciprocal immunoprecipitation anti-ptprf IP: IgG Anti-SRC HepG2 Huh7 HepG2 Huh7 Proximity ligation assays IP: PTPRF IgG PP2A IB: PTPRF IB: PTPRF SRC PP2A PP2AC HepG2 Huh7 HepG2 Huh7 Abs: PTPFR+SRC PTPRF+ACTB PTPRF+PP2A Rabi et al., Hepatology 2014

26 Rabi et al., Hepatology 2014

27 A novel PTPRF-mediated contact inhibition pathway Cell-cell contact Restricted proliferation Cell proliferation Tumor initiation Hyperproliferation Cell-cell contact PTPRF MYC MYC PTPRF SRC PP2A ERK ERK RTK RTK Aberrant growth signaling

28 Relative IHC score Case 1 2 PTPRF downregulated in ~40% of HCC upregulated in ~22% of HCC N N T P = P = P = T 0.00 Tumor stage I II II III III Non-tumor N T N T N T N T N T N T N T N T N T N T N T N T N T N T nl PTPRF b- Actin PTPRF b-actin HCC

29 Rabi et al., Hepatology 2014 The PTPRF gene frequently deleted in HCC (20.5%) cases PTPRF: 1p34.2 ( ) Chromosome 1 Gene copy variation was determined by using array CGH

30 Rabi et al., Hepatology 2014 PTPRF downregulated lower survival upregulated lower recurrence & higher survival % 100 Disease-free survival % 100 Overall survival P = P = Upregulation: yes Upregulation: no M Downregulation: yes Downregulation: no M

31 Summary The PTPRF gene Frequently deleted in human HCC ~20.5% Frequently downregulated in human HCC ~40% Frequently downregulated in human CRC ~100% Frequently downregulated in human GC ~66% PTPRF downregulation Prediction of worse clinical outcomes PTPRF is a TSG!

32 Conclusions A novel PTPRF-SRC/PP2A-ERK-MYC negativefeedback loop prevents overproliferation of cells The PTPRF-ERK-MYC pathway may involve in tissue homeostasis Disruption of this contact inhibition mechanism leads overproliferation and tumor initiation

Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma

Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma CH Li, SC Chow, DL Yin,

More information

Impact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach

Impact of NM23-M1 knock-out on metastatic potential of hepatocellular carcinoma: a transgenic approach Impact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach NM23-M1 "knock- out" mice (without NDPK A) Experimental models of hepatocarcinogenesis Chemical

More information

Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies

Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies René Bernards The Netherlands Cancer Institute Amsterdam The Netherlands Molecular versus

More information

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1

More information

Supplemental File. TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer

Supplemental File. TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer Supplemental File TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer Daniel T. Starczynowski, William W. Lockwood, Sophie Delehouzee, Raj Chari, Joanna Wegrzyn,

More information

mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-

mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- Supplementary Material for mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- XL Inhibition by Suppressing MCL-1 Anthony C. Faber 1,2 *, Erin M. Coffee

More information

Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas

Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng

More information

Translating Research into Clinical Practice: Strategies Against Hepatocellular Cancer

Translating Research into Clinical Practice: Strategies Against Hepatocellular Cancer Translating Research into Clinical Practice: Strategies Against Hepatocellular Cancer Kevin Staveley-O Carroll, PhD, MD, FACS Professor and Chair, Department of Surgery Director of the Ellis Fischel Cancer

More information

Problem Set 8 Key 1 of 8

Problem Set 8 Key 1 of 8 7.06 2003 Problem Set 8 Key 1 of 8 7.06 2003 Problem Set 8 Key 1. As a bright MD/PhD, you are interested in questions about the control of cell number in the body. Recently, you've seen three patients

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon

More information

Cell cycle related kinase is a direct androgen receptor regulated gene that drives β-catenin/ T cell factor dependent hepatocarcinogenesis

Cell cycle related kinase is a direct androgen receptor regulated gene that drives β-catenin/ T cell factor dependent hepatocarcinogenesis Research article Cell cycle related kinase is a direct androgen receptor regulated gene that drives β-catenin/ T cell factor dependent hepatocarcinogenesis Hai Feng, 1 Alfred S.L. Cheng, 2 Daisy P. Tsang,

More information

Supplemental Data Macrophage Migration Inhibitory Factor MIF Interferes with the Rb-E2F Pathway

Supplemental Data Macrophage Migration Inhibitory Factor MIF Interferes with the Rb-E2F Pathway Supplemental Data Macrophage Migration Inhibitory Factor MIF Interferes with the Rb-E2F Pathway S1 Oleksi Petrenko and Ute M. Moll Figure S1. MIF-Deficient Cells Have Reduced Transforming Ability (A) Soft

More information

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by

More information

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated

More information

BIO360 Fall 2013 Quiz 1

BIO360 Fall 2013 Quiz 1 BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.

More information

Development of a Conditional Replication Competent Adenovirus, Controlled by the Human Telomerase Promoter (htert)

Development of a Conditional Replication Competent Adenovirus, Controlled by the Human Telomerase Promoter (htert) Development of a Conditional Replication Competent Adenovirus, Controlled by the Human Telomerase Promoter (htert) Eunhee Kim, Joo-Hang Kim, M.D., Ha-Youn Shin, Han Saem Lee, Joo-Hyuk Sohn, M.D., Jai Myung

More information

AACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855

AACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855 Investigation of the Growth Inhibitory Activity of the MEK Inhibitor ARRY-162 in Combination with Everolimus in a Variety of KRas and PI3K Pathway Mutant Cancers Brian Tunquist, Tyler Risom, Debbie Anderson,

More information

Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α

Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,

More information

Frequent intrahepatic metastasis is a unique feature

Frequent intrahepatic metastasis is a unique feature Neuregulin/Erythroblastic Leukemia Viral Oncogene Homolog 3 Autocrine Loop Contributes to Invasion and Early Recurrence of Human Hepatoma Sen-Yung Hsieh, 1,2,4 Jung-Ru He, 1 Chih-Yun Hsu, 1 Wan-Ju Chen,

More information

Protein tyrosine phosphatase 1B targets PITX1/p120RasGAP. thus showing therapeutic potential in colorectal carcinoma

Protein tyrosine phosphatase 1B targets PITX1/p120RasGAP. thus showing therapeutic potential in colorectal carcinoma Protein tyrosine phosphatase 1B targets PITX1/p120RasGAP thus showing therapeutic potential in colorectal carcinoma Hao-Wei Teng, Man-Hsin Hung, Li-Ju Chen, Mao-Ju Chang, Feng-Shu Hsieh, Ming-Hsien Tsai,

More information

A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se

A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy serves as a defence mechanism that prevents or retards

More information

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm) Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939

More information

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji

More information

Opposing activities of the Ras and Hippo pathways converge on regulation of YAP protein turnover

Opposing activities of the Ras and Hippo pathways converge on regulation of YAP protein turnover The EMBO Journal Peer Review Process File - EMBO-2014-89385 Manuscript EMBO-2014-89385 Opposing activities of the Ras and Hippo pathways converge on regulation of YAP protein turnover Xin Hong, Hung Thanh

More information

Supplementary Information

Supplementary Information Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna

More information

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81. IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag

More information

Genetics of Cancer Lecture 32 Cancer II. Prof. Bevin Engelward, MIT Biological Engineering Department

Genetics of Cancer Lecture 32 Cancer II. Prof. Bevin Engelward, MIT Biological Engineering Department Genetics of Cancer Lecture 32 Cancer II rof. Bevin Engelward, MIT Biological Engineering Department Why Cancer Matters New Cancer Cases in 1997 Cancer Deaths in 1997 Genetics of Cancer: Today: What types

More information

Gankyrin plays an essential role in Ras-induced tumorigenesis through regulation of the RhoA/ROCK pathway in mammalian cells

Gankyrin plays an essential role in Ras-induced tumorigenesis through regulation of the RhoA/ROCK pathway in mammalian cells Research article Gankyrin plays an essential role in Ras-induced tumorigenesis through regulation of the RhoA/ROCK pathway in mammalian cells Jiang-Hong Man, Bing Liang, Yue-Xi Gu, Tao Zhou, Ai-Ling Li,

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human

More information

Christian Frezza MRC Cancer Unit

Christian Frezza MRC Cancer Unit Christian Frezza MRC Cancer Unit What is cancer? What is cancer? Douglas Hanahan, Robert A. Weinberg; The Hallmarks of Cancer Cell, Volume 100, Issue 1, 7 January 2000, Pages 57 70 Cancer cells need energy

More information

supplementary information

supplementary information DOI: 10.1038/ncb2153 Figure S1 Ectopic expression of HAUSP up-regulates REST protein. (a) Immunoblotting showed that ectopic expression of HAUSP increased REST protein levels in ENStemA NPCs. (b) Immunofluorescent

More information

Determination Differentiation. determinated precursor specialized cell

Determination Differentiation. determinated precursor specialized cell Biology of Cancer -Developmental Biology: Determination and Differentiation -Cell Cycle Regulation -Tumor genes: Proto-Oncogenes, Tumor supressor genes -Tumor-Progression -Example for Tumor-Progression:

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-10-1-1029 TITLE: PRINCIPAL INVESTIGATOR: Mu-Shui Dai, M.D., Ph.D. CONTRACTING ORGANIZATION: Oregon Health Science niversity, Portland, Oregon 97239 REPORT DATE: October 2013 TYPE

More information

Many Forms of Cell-Cell Communication Regulate Tissue Function and Phenotype Physiological Functions of Gap Junctions Homeostasis buffering/sharing of ions, nutrients, and water Metabolic support nutrient

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Kinome Profiling: The Potential in ER-Negative Patients. Charles M. Perou, Ph.D. Departments of Genetics and Pathology

Kinome Profiling: The Potential in ER-Negative Patients. Charles M. Perou, Ph.D. Departments of Genetics and Pathology Kinome Profiling: The Potential in ER-Negative Patients Charles M. Perou, Ph.D. Departments of Genetics and Pathology Lineberger Comprehensive Cancer Center University of North Carolina Chapel Hill, North

More information

Hepatitis B virus X gene in the development of hepatocellular carcinoma. Citation Hong Kong Medical Journal, 2011, v. 17 n. 6, suppl. 6, p.

Hepatitis B virus X gene in the development of hepatocellular carcinoma. Citation Hong Kong Medical Journal, 2011, v. 17 n. 6, suppl. 6, p. Title Hepatitis B virus X gene in the development of hepatocellular carcinoma Author(s) Ma, NF; Lau, SH; Hu, L; Dong, SS; Guan, XY Citation Hong Kong Medical Journal, 2011, v. 17 n. 6, suppl. 6, p. 44-47

More information

Cancer Genomics (Current technologies & clinical implication)

Cancer Genomics (Current technologies & clinical implication) Cancer Genomics (Current technologies & clinical implication) Jeonghee Cho, Ph.D. Samsung Medical Center Samsung Cancer Research Institute Robert Weinberg (M.I.T) Douglas Hanahan (ISREC) The Hallmarks

More information

Protein tyrosine kinase signaling

Protein tyrosine kinase signaling rotein tyrosine kinase signaling Serge ROCHE CRBM CNRS/Montpellier University serge.roche@crbm.cnrs.fr rotein phosphorylation on Tyr A central mechanism to control cell communication in a multicellular

More information

RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.

RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. ۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,

More information

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h) Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d

More information

Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was

Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was performed on a total of 85 SS patients. Data filtration

More information

Cyclin E1 and RTK/RAS signaling drive CDK inhibitor resistance via activation of E2F and ETS

Cyclin E1 and RTK/RAS signaling drive CDK inhibitor resistance via activation of E2F and ETS /, Vol. 6, No.2 Cyclin E1 and RTK/RAS signaling drive CDK inhibitor resistance via activation of E2F and ETS Barbie Taylor-Harding 1, Paul-Joseph Aspuria 1, Hasmik Agadjanian 1, Dong-Joo Cheon 1, Takako

More information

CANCER. Inherited Cancer Syndromes. Affects 25% of US population. Kills 19% of US population (2nd largest killer after heart disease)

CANCER. Inherited Cancer Syndromes. Affects 25% of US population. Kills 19% of US population (2nd largest killer after heart disease) CANCER Affects 25% of US population Kills 19% of US population (2nd largest killer after heart disease) NOT one disease but 200-300 different defects Etiologic Factors In Cancer: Relative contributions

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Signaling. Dr. Sujata Persad Katz Group Centre for Pharmacy & Health research

Signaling. Dr. Sujata Persad Katz Group Centre for Pharmacy & Health research Signaling Dr. Sujata Persad 3-020 Katz Group Centre for Pharmacy & Health research E-mail:sujata.persad@ualberta.ca 1 Growth Factor Receptors and Other Signaling Pathways What we will cover today: How

More information

Colorectal cancer: pathology

Colorectal cancer: pathology UK NEQAS for Molecular Pathology Colorectal cancer: pathology Nick West Pathology & Tumour Biology May 2013 Colorectal cancer (CRC) 40,695 new cases in 2010 15,708 deaths Management of CRC Surgery Main

More information

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2

More information

Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma

Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma Muska Hassan NCI-ICBP Summer Fellow Broad Institute of MIT and Harvard: Cancer Program Mentor: Cory Johannessen,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/322/ra38/dc1 Supplementary Materials for Dynamic Reprogramming of Signaling Upon Met Inhibition Reveals a Mechanism of Drug Resistance in Gastric Cancer Andrea

More information

Activation of cellular proto-oncogenes to oncogenes. How was active Ras identified?

Activation of cellular proto-oncogenes to oncogenes. How was active Ras identified? Dominant Acting Oncogenes Eugene E. Marcantonio, M.D. Ph.D. Oncogenes are altered forms of normal cellular genes called proto-oncogenes that are involved in pathways regulating cell growth, differentiation,

More information

Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SAM library or vector. Introduce AKT reporter

Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SAM library or vector. Introduce AKT reporter Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SM library or vector Introduce reporter Grow cells in presence of puromycin for 5 days Vector control SM library fewer surviving cells More surviving

More information

Familial PAH. Genetics and pulmonary arterial hypertension. PAH and mutations in the bone morphogenetic protein type II receptor (BMPR-II)

Familial PAH. Genetics and pulmonary arterial hypertension. PAH and mutations in the bone morphogenetic protein type II receptor (BMPR-II) athology of vascular lesions in idiopathic pulmonary arterial hypertension Genetics and pulmonary arterial hypertension Concentric intimal lesion Nick Morrell British Heart Foundation rofessor of Cardiopulmonary

More information

Hepatocellular carcinoma (HCC) is currently

Hepatocellular carcinoma (HCC) is currently Discovery of Novel Src Homology Region 2 Domain- Containing Phosphatase 1 Agonists From Sorafenib for the Treatment of Hepatocellular Carcinoma Wei-Tien Tai, 1,2* Chung-Wai Shiau, 3* Pei-Jer Chen, 1 Pei-Yi

More information

A class of genes that normally suppress cell proliferation. p53 and Rb..ect. suppressor gene products can release cells. hyperproliferation.

A class of genes that normally suppress cell proliferation. p53 and Rb..ect. suppressor gene products can release cells. hyperproliferation. Tumor Suppressor Genes A class of genes that normally suppress cell proliferation. p53 and Rb..ect Mutations that inactivate the tumor suppressor gene products can release cells from growth suppression

More information

Basic tumor nomenclature

Basic tumor nomenclature Jonas Nilsson jonas.a.nilsson@surgery.gu.se Sahlgrenska Cancer Center Bilder gjorda av Per Holmfeldt och Jonas Nilsson Benign tumor Basic tumor nomenclature Malignant tumor = cancer Metastasis Carcinoma:

More information

Lecture 7: Signaling Through Lymphocyte Receptors

Lecture 7: Signaling Through Lymphocyte Receptors Lecture 7: Signaling Through Lymphocyte Receptors Questions to Consider After recognition of its cognate MHC:peptide, how does the T cell receptor activate immune response genes? What are the structural

More information

Prediction of invasiveness of hepatic tumor cells

Prediction of invasiveness of hepatic tumor cells Prediction of invasiveness of hepatic tumor cells (Overexpression of Romo1 Promotes Production of Reactive Oxygen Species and Invasiveness of Hepatic Tumor Cells) (Romo1 : Reactive Oxygen Species Modulator

More information

Introduction. Cancer Biology. Tumor-suppressor genes. Proto-oncogenes. DNA stability genes. Mechanisms of carcinogenesis.

Introduction. Cancer Biology. Tumor-suppressor genes. Proto-oncogenes. DNA stability genes. Mechanisms of carcinogenesis. Cancer Biology Chapter 18 Eric J. Hall., Amato Giaccia, Radiobiology for the Radiologist Introduction Tissue homeostasis depends on the regulated cell division and self-elimination (programmed cell death)

More information

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary

More information

Targeting of the MUC1-C Oncoprotein in Colitis-Associated Colorectal Cancer

Targeting of the MUC1-C Oncoprotein in Colitis-Associated Colorectal Cancer AD Award Number: W81XWH-12-1-0322 TITLE: Targeting of the MUC1-C Oncoprotein in Colitis-Associated Colorectal Cancer PRINCIPAL INVESTIGATOR: Kufe, Donald W., M.D. CONTRACTING ORGANIZATION: Boston, MA 02215-5450

More information

Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap

Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap Supplementary Figure 1. a. b. p-value for depletion in vehicle (DMSO) 1e-05 1e-03 1e-01 1 0 1000 2000 3000 4000 5000 Genes log2 normalized shrna counts in T0 0 2 4 6 8 sh1 shluc 0 2 4 6 8 log2 normalized

More information

Negative feedback regulation of the ERK1/2 MAPK pathway

Negative feedback regulation of the ERK1/2 MAPK pathway Cell. Mol. Life Sci. DOI 10.1007/s00018-016-2297-8 Cellular and Molecular Life Sciences REVIEW Negative feedback regulation of the ERK1/2 MAPK pathway David Lake 1 Sonia A. L. Corrêa 2,3 Jürgen Müller

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the

Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant

More information

Hepatocellular carcinoma (HCC) is one of the

Hepatocellular carcinoma (HCC) is one of the Isolation and Characterization of a Novel Oncogene, Amplified in Liver Cancer 1, within a Commonly Amplified Region at 1q21 in Hepatocellular Carcinoma Ning-Fang Ma, 1,2 * Liang Hu, 2 * Jackie M. Fung,

More information

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description: File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'

More information

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence

More information

Supplementary Figure 1: Comparison of acgh-based and expression-based CNA analysis of tumors from breast cancer GEMMs.

Supplementary Figure 1: Comparison of acgh-based and expression-based CNA analysis of tumors from breast cancer GEMMs. Supplementary Figure 1: Comparison of acgh-based and expression-based CNA analysis of tumors from breast cancer GEMMs. (a) CNA analysis of expression microarray data obtained from 15 tumors in the SV40Tag

More information

Supplemental Figure S1A Notch1

Supplemental Figure S1A Notch1 Supplemental Figure S1A Notch1 erage) epth of Cove ormalized De Log1(No Notch exons Figure S1: A) Relative coverage of Notch1 and Notch 2 exons in HCC2218, HCC1187, MB157, MDA-MB157 cell lines. Blue color

More information

Cooperative interaction of MUC1 with the HGF/c-Met pathway during hepatocarcinogenesis

Cooperative interaction of MUC1 with the HGF/c-Met pathway during hepatocarcinogenesis Bozkaya et al. Molecular Cancer 212, 11:64 RESEARCH Open Access Cooperative interaction of with the HGF/c-Met pathway during hepatocarcinogenesis Giray Bozkaya 1, Peyda Korhan 1, Murat Çokaklı 1, Esra

More information

Oncogenes and Tumor. supressors

Oncogenes and Tumor. supressors Oncogenes and Tumor supressors From history to therapeutics Serge ROCHE Neoplastic transformation TUMOR SURESSOR ONCOGENE ONCOGENES History 1911 1960 1980 2001 Transforming retrovirus RSV v-src is an oncogene

More information

The truncated mutant HBsAg expression increases the tumorigenesis of hepatitis B virus by regulating TGF-β/Smad signaling pathway

The truncated mutant HBsAg expression increases the tumorigenesis of hepatitis B virus by regulating TGF-β/Smad signaling pathway Wang et al. Virology Journal (2018) 15:61 https://doi.org/10.1186/s12985-018-0972-0 RESEARCH Open Access The truncated mutant HBsAg expression increases the tumorigenesis of hepatitis B virus by regulating

More information

Deregulation of signal transduction and cell cycle in Cancer

Deregulation of signal transduction and cell cycle in Cancer Deregulation of signal transduction and cell cycle in Cancer Tuangporn Suthiphongchai, Ph.D. Department of Biochemistry Faculty of Science, Mahidol University Email: tuangporn.sut@mahidol.ac.th Room Pr324

More information

Transgenic Mice and Genetargeting

Transgenic Mice and Genetargeting Transgenic Mice and Genetargeting mice In Biomedical Science Techniques of transgenic and gene-targeting mice are indispensable for analyses of in vivo functions of particular genes and roles of their

More information

Tumor stage : I II III IV. well differentiated. moderately differentiated. adenocarcinoma. normal colon (adjacent to cancer) Log (T/H) SLAP mrna level

Tumor stage : I II III IV. well differentiated. moderately differentiated. adenocarcinoma. normal colon (adjacent to cancer) Log (T/H) SLAP mrna level moderately differentiated well differentiated Log (T/H) mrna level a Tumor stage : I II III IV.4.4.8 1.2 1.6 2. 2.4 2.8 3.2 N 1 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 # patient b normal colon (adjacent

More information

Never in mitosis gene A related kinase 6 promotes cell proliferation of hepatocellular carcinoma via cyclin B modulation

Never in mitosis gene A related kinase 6 promotes cell proliferation of hepatocellular carcinoma via cyclin B modulation ONCOLOGY LETTERS 8: 1163-1168, 2014 Never in mitosis gene A related kinase 6 promotes cell proliferation of hepatocellular carcinoma via cyclin B modulation BIAO ZHANG 1*, HAI ZHANG 2*, DONG WANG 1, SHENG

More information

Early Embryonic Development

Early Embryonic Development Early Embryonic Development Maternal effect gene products set the stage by controlling the expression of the first embryonic genes. 1. Transcription factors 2. Receptors 3. Regulatory proteins Maternal

More information

HepaRG LX2. HepaRG HepaRG LX2 LX2

HepaRG LX2. HepaRG HepaRG LX2 LX2 C Supporting Figure 1. Experimental design of s between and cells. (A) -hepatocytes were isolated from a 30 days of -progenitors. Differentiation into mature hepatocytes was achieved following a 2-weeks

More information

Egr-1 regulates RTA transcription through a cooperative involvement of transcriptional regulators

Egr-1 regulates RTA transcription through a cooperative involvement of transcriptional regulators /, 2017, Vol. 8, (No. 53), pp: 91425-91444 Egr-1 regulates RTA transcription through a cooperative involvement of transcriptional regulators Roni Sarkar 1 and Subhash C. Verma 1 1 Department of Microbiology

More information

BIO360 Fall 2013 Quiz 1

BIO360 Fall 2013 Quiz 1 BIO360 Fall 2013 Quiz 1 Name: Key 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function

More information

The Biology and Genetics of Cells and Organisms The Biology of Cancer

The Biology and Genetics of Cells and Organisms The Biology of Cancer The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried

More information

ARTICLE IN PRESS. The International Journal of Biochemistry & Cell Biology xxx (2007) xxx xxx. Molecule in focus

ARTICLE IN PRESS. The International Journal of Biochemistry & Cell Biology xxx (2007) xxx xxx. Molecule in focus The International Journal of Biochemistry & Cell Biology xxx (2007) xxx xxx Molecule in focus Deleted in liver cancer-1 (DLC-1): A tumor suppressor not just for liver Yi-Chun Liao, Su Hao Lo Lawrence Ellison

More information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

SUPPLEMENTAL EXPERIMENTAL PROCEDURES SUPPLEMENTAL EXPERIMENTAL PROCEDURES Crystal violet assay Cells were seeded in 24-well plates and cultured in media supplemented with % FBS for 7 days. Media were then removed, plates were briefly washed

More information

PCDH9 acts as a tumor suppressor inducing tumor cell arrest at G 0 /G 1 phase and is frequently methylated in hepatocellular carcinoma

PCDH9 acts as a tumor suppressor inducing tumor cell arrest at G 0 /G 1 phase and is frequently methylated in hepatocellular carcinoma MOLECULAR MEDICINE REPORTS 16: 4475-4482, 2017 PCDH9 acts as a tumor suppressor inducing tumor cell arrest at G 0 /G 1 phase and is frequently methylated in hepatocellular carcinoma JUN LV 1,2*, PENGFEI

More information

Summary and Concluding Remarks

Summary and Concluding Remarks Summary and Concluding Remarks Chapter 6 The intestinal epithelium provides an excellent model system for investigating molecular mechanisms regulating cell lineage establishment, stem cell proliferation,

More information

Research Communication HPIP is Upregulated in Liver Cancer and Promotes Hepatoma Cell Proliferation via Activation of G2=M Transition

Research Communication HPIP is Upregulated in Liver Cancer and Promotes Hepatoma Cell Proliferation via Activation of G2=M Transition Research Communication HPIP is Upregulated in Liver Cancer and Promotes Hepatoma Cell Proliferation via Activation of G2=M Transition Xiaojie Xu 1 Chengying Jiang 2,3 Shibin Wang 4 Yanhong Tai 2 Tao Wang

More information

Lysine methyltransferase SMYD2 promotes cyst growth in autosomal dominant polycystic kidney disease

Lysine methyltransferase SMYD2 promotes cyst growth in autosomal dominant polycystic kidney disease Lysine methyltransferase SMYD2 promotes cyst growth in autosomal dominant polycystic kidney disease Linda Xiaoyan Li,, Julien Sage, Xiaogang Li J Clin Invest. 2017;127(7):2751-2764. https://doi.org/10.1172/jci90921.

More information

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Reviewers' comments: Reviewer #1 (Remarks to the Author): The authors have presented data demonstrating activation of AKT as a common resistance mechanism in EGFR mutation positive, EGFR TKI resistant

More information

C) The graph should look exactly like the graph on the left (Mut1 cells + Mating Pheromone for 3 hours at 25 degrees). The cells arrest in G1.

C) The graph should look exactly like the graph on the left (Mut1 cells + Mating Pheromone for 3 hours at 25 degrees). The cells arrest in G1. 706-2000-Exam 4 Answer Key 1) The question asks you to explain peaks A and B in the top graph. The other two graphs were there to give you hints. The question did not ask for these other two graphs to

More information

Daxx inhibits hypoxia-induced lung cancer cell metastasis by suppressing the HIF-1a/HDAC1/Slug axis

Daxx inhibits hypoxia-induced lung cancer cell metastasis by suppressing the HIF-1a/HDAC1/Slug axis ARTICLE Received 22 Feb 216 Accepted 7 Nov 216 Published 22 Dec 216 Updated 7 Feb 217 DOI: 1.138/ncomms13867 inhibits hypoxia-induced lung cancer cell metastasis by suppressing the HIF-1a/HDAC1/ axis OPEN

More information