Enhancement of C2C12 myoblast proliferation and differentiation by diarylheptanoid form Curcuma comosa Roxb.
|
|
- George Cobb
- 5 years ago
- Views:
Transcription
1 Enhancement of C2C12 myoblast proliferation and differentiation by diarylheptanoid form Curcuma comosa Roxb. Curcuma comosa Roxb. Mr. Chittipong Tipbunjong Mahidol University Bangkok, Thailand
2 Muscle regeneration Skeletal muscle plays an important role in normal daily activities. Loss of function of skeletal muscle would, therefore, affect quality of life. --- self-repair after injury--- Muscle regeneration --- role of satellite cells--- Pavlath et al, 1999 Tiidus PM et al, 2003 Enns DL et al, 2008 Systemic administration of curcumin stimulates muscle regeneration after injury Estrogen can protect muscle damage and inflammation after strenuous exercise Estrogen activates satellite cells via estrogen receptors to proliferate in rat skeletal muscle following downhill running The interest of using phytoestrogens as alternatives to the steroid hormone is dramatically increased. ----less adverse effects----
3 Diarylheptanoid () Suksamran et al. (2008): exhibited estrogenic activity comparable to phytoestrogen genistein exhibit numerous biological activities and have been used as traditional medicine in Asian countries. Anti-apoptosis Zhi et al Hepatoprotection Kim et al Curcuma comosa Roxb &group=16&gblog=50 Anti-bacteria Ding et al Anti-osteoporosis Arthit et al Melanogenesis inh. Watana et al Anti-cancer Pawinee et al Anti-inflammation Mayer et al aromatic rings tethered by 7 carbon chain and having various substituents. we hypothesize that diarylheptanoids enhance myoblast proliferation and/or differentiation.
4 Objective To test the effects of diarylheptanoid on myoblast proliferation and differentiation, and investigate its mechanism. OH 1-(4-hydroxyphenyl)-7-phenyl-(6E)-6-hepten-3-one Natural and pure compounds
5 Proliferation MTT assay : enhances myoblast proliferation Cell counting [nm] BrdU incorporation assay control BrdU + nucleus BrdU - nucleus DHT Protein expression con. DHT [ M] con. DHT con. DHT (cyclin D1 and c-myc; markers for cell division)
6 Differentiation : Progression of myoblast differentiation (MHC (myosin heavy chain) and myogenin; muscle differentiation markers)
7 Differentiation : enhances C2C12 myoblast differentiation control Myotube (MHC+) nucleus myogenin tubulin DHT con. DHT con. DHT
8 Proliferation : enhances myoblast proliferation occurred - --in ER-independent manner BrdU incorporation assay Con. DHT + ICI Con. DHT (ER; Estrogen Receptor)
9 Differentiation : enhances myoblast differentiation in ER-dependent manner + ICI (ICI 182,780; ER inhibitor)
10 enhances myoblast differentiation through ERα, but not ERβ ERα sirna ERβ sirna
11 Differentiation Time (min) h High expression pakt perk p-p70s6k p-gsk-3β p-p38 NF-ĸB - ICI 182,780 : ER inhibitor - 2-Br : membrane ER inhibitor enhances myoblast differentiation via pakt, p-p38, and NF-kB, but not perk, through membrane ER.
12 Differentiation Time (min) h High expression pakt perk p-p70s6k p-gsk-3β p-p38 NF-ĸB + Akt inhibitor + Rapamycin + SB Akt inhibitor + Rapamycin + SB Akt inhibitor + SB p-p70s6k is a downstream of pakt/mtor p-gsk-3β is a downstream of pakt NF-ĸB is a downstream of p38
13 Summary cell membrane diarylheptanoid Cav-1 2-BR ICI 182,780 ERα PAT PA ERα Protein pakt perk p38 Neosynthesized - myogenin - MHC mtor p-gsk-3β NF-ĸB p-p70s6k - myogenin - MHC mrna ERα-siRNA [Cav-1, Caveolin-1; PA, palmitic acid; PAT, palmitoyl-acyl-transferase]
14 Applications This compound may has potential for further development as therapeutic agents for treatment of muscle injury. Curcuma comosa Roxb &group=16&gblog=50 The basic knowledge of action between diarylheptanoid and ER, and its downstream signaling pathways in myoblasts may provide a background to develop, modify, and synthesize a better new natural product in the future.
15 Thank you for your attention
16 Acknowledgement Prof. Yindee Kitiyanant Prof. Chumpol Pholpramool Prof. Karyn A. Esser This work was supported by the Office of the Higher Education Commission and Mahidol university
17
18 enhance proliferation ER independent manner cyclin D1 c-myc My works anti-oxidant/ anti-apoptosis enhance differentiation ER dependent manner specific to ERα subtype membrane ER IC ± 0.19 mitigated cell death induced by H 2 O 2
E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination
E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments
More informationIL-6 - a hypertrophic factor
IL-6 - a hypertrophic factor 3 rd CIM PhD Course Copenhagen, April 30 th, 2009 Pompeu Fabra University Department of Experimental and Health Sciences Barcelona, Spain Myogenesis MRF: muscle regulatory
More informationANSC/FSTC 607 Biochemistry and Physiology of Muscle as a Food PRIMARY, SECONDARY, AND TERTIARY MYOTUBES
ANSC/FSTC 607 Biochemistry and Physiology of Muscle as a Food PRIMARY, SECONDARY, AND TERTIARY MYOTUBES I. Satellite Cells A. Proliferative, myoblastic cells that lie in invaginations in the sarcolemma
More informationCrosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea
Crosstalk between Adiponectin and IGF-IR in breast cancer Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Obesity Chronic, multifactorial disorder Hypertrophy and hyperplasia
More informationResearch progress on the use of estrogen receptor agonist for treatment of spinal cord injury
Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury Swapan K. Ray, PhD Professor, Department of Pathology, Microbiology, and Immunology USC School of Medicine,
More informationYong Wu, Ph.D. Division of Cancer Research and Training (DCRT) Charles R. Drew University of Medicine & Science
Yong Wu, Ph.D. Division of Cancer Research and Training (DCRT) Charles R. Drew University of Medicine & Science Jay Vadgama, Ph.D Chief, Division of Cancer Research and Training Background One in 8 women
More informationSupplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationLecture #27 Lecturer A. N. Koval
Lecture #27 Lecturer A. N. Koval Hormones Transduce Signals to Affect Homeostatic Mechanisms Koval A. (C), 2011 2 Lipophilic hormones Classifying hormones into hydrophilic and lipophilic molecules indicates
More informationEFFECT OF SELECTED FOOD AND MEDICAL PLANTS AND PLANT MOLECULES ON OVARIAN FUNCTIONS
EFFECT OF SELECTED FOOD AND MEDICAL PLANTS AND PLANT MOLECULES ON OVARIAN FUNCTIONS Alexander V. Sirotkin Constantine the Philosopher University and Research Institute of Animal Production, Nitra, Slovakia
More informationMuscles, muscle fibres and myofibrils
Muscles, muscle fibres and myofibrils Properties of Muscle Fiber Types Fast fibers Slow fibers Characteristic IIb IIx IIa Type I V max (speed of shortening) Highest Intermediate Low Resistance to fatigue
More informationRatchakrit Srikuea 1 and Muthita Hirunsai 2 1
J Appl Physiol 120: 1381 1393, 2016. First published March 31, 2016; doi:10.1152/japplphysiol.01018.2015. Effects of intramuscular administration of 1,25(OH) 2 D 3 during skeletal muscle regeneration on
More informationSTARS. Mini-Symposium. Skeletal Muscle: Development, Adaptation & Disease. Gain Without Pain
STARS Mini-Symposium Skeletal Muscle: Development, Adaptation & Disease Gain Without Pain Rhonda Bassel-Duby, Ph.D. Associate Professor of Molecular Biology Diagram of Skeletal Muscle Myoglobin Immunohistochemistry
More informationENVIRONMENTAL HEALTH PERSPECTIVES
ehp ehponline.org ENVIRONMENTAL HEALTH PERSPECTIVES Bisphenol A at Low Nanomolar Doses Confers Chemoresistance in Estrogen Receptor Alpha Positive and Negative Breast Cancer Cells Elizabeth W. LaPensee,
More informationSupplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
More informationEstrogenic Activity of Diarylheptanoids from Curcuma comosa Roxb. Requires Metabolic Activation
840 J. Agric. Food Chem. 2009, 57, 840 845 Estrogenic Activity of Diarylheptanoids from Curcuma comosa Roxb. Requires Metabolic Activation WIPAWEE WINUTHAYANON, KANOKNETR SUKSEN, CHUENCHIT BOONCHIRD, APORN
More informationmtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions
Supplementary Information mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions Shyuichiro Matsubara 1, Qiang Ding 1, Yumi Miyazaki 1, Taisaku Kuwahata
More informationReproductive Endocrinology
Reproductive Endocrinology Reproductive Endocrinology Hypothalamic hormones Gonadotropin releasing hormone (GnRH) - stimulate release of FSH = follicle stimulating hormone LH = luteinizing hormone from
More informationSteroid Hormones Synthesis
*I ll try my best to incorporate the Slides in this Sheet; you don t need to study the slides if you study this sheet. Steroid Hormones Synthesis - The figure to the right is the Steroid nucleus, it has
More informationChapter 1: Curcumin is excellent compound for various medicinal usages
Super-Curcumin Story Chapter 1: Curcumin is excellent compound for various medicinal usages Chapter 2: Discovery of Super-Curcumin analog Chapter 3: Anti-tumor activities of Super-Curcumin analog Chapter
More informationSupplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors
Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA
More informationBiochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 28 Fatty Acid Synthesis 2013 W. H. Freeman and Company Chapter 28 Outline 1. The first stage of fatty acid synthesis is transfer
More informationDesign, Synthesis and Biological Screening of Focused Libraries of New Antiestrogens
Design, Synthesis and Biological Screening of Focused Libraries of New Antiestrogens Presenter: Jelena Janjic, Dipl.Pharm. Graduate student Pharmaceutical Sciences Prof. Dr. Peter Wipf s group Dr. Billy
More informationScholars Laurier. Wilfrid Laurier University. Amy Elisabeth Thomas Wilfrid Laurier University. Theses and Dissertations (Comprehensive)
Wilfrid Laurier University Scholars Commons @ Laurier Theses and Dissertations (Comprehensive) 2009 The Influence of Propyl Pyrazole Triol on the Post- Exercise Alpha Estrogen Receptor-Mediated Activation
More informationCancer It is not a hormone condition as people might think All conditions have a hormone component but no one gets cancer because of hormones Hormones
Hormones and Cancer Cancer It is not a hormone condition as people might think All conditions have a hormone component but no one gets cancer because of hormones Hormones can play a role as to which cancer
More informationDiosgenin, antagonism of LXRs 36 DNA microarray, sesame seed lignan regulation of liver fatty acid metabolism gene expression 12 18, 22, 23
Subject Index ACC, see Acyl-CoA carboxylase 1 -Acetoxychavicol acetate, inducible nitric oxide synthase suppression in cancer chemoprevention 199, 200 Acetylene carotenoids, anti-inflammatory activity
More informationObjectives By the end of lecture the student should:
Objectives By the end of lecture the student should: Discuss β oxidation of fatty acids. Illustrate α oxidation of fatty acids. Understand ω oxidation of fatty acids. List sources and fates of active acetate.
More informationWhat is survivorship? Late effects of treatment. Concerns of survivorship
Choices to enhance vitality!!!and survival!!!!!!!!! (and how to make it work in the real world)! What is survivorship? Multiple definitions! Anyone living with cancer at any stage since diagnosis! Anyone
More informationThis brings me to my point. Disease starts when there is a surplus or deficiency of certain nutritive or non-nutritive substances in the human body.
WHAT IS DISEASE? A pathological condition of a part of an organ, or system of an organism resulting from various causes, such as infection, genetic defect, or environmental stress, and characterized by
More informationNovel Physiological Role of Caveolin-1 in Aging and Aging-related Diseases. Sang Chul Park Gachon University Lee Gil Ya Cancer and Diabetes Institute
Novel Physiological Role of Caveolin-1 in Aging and Aging-related Diseases Sang Chul Park Gachon University Lee Gil Ya Cancer and Diabetes Institute Primarily I asked questions on biological issues on
More informationActivation of calcium signaling through Trpv1 by nnos and peroxynitrite as a key trigger of skeletal muscle hypertrophy
Activation of calcium signaling through Trpv y nnos and peroxynitrite as a key trigger of skeletal muscle hypertrophy Naoki Ito, Urs T. Ruegg, Akira Kudo, Yuko Miyagoe-Suzuki, and Shin ichi Takeda Supplementary
More informationCorrelation between estrogen receptor β expression and the curative effect of endocrine therapy in breast cancer patients
1568 Correlation between estrogen receptor β expression and the curative effect of endocrine therapy in breast cancer patients LIYING GUO 1, YU ZHANG 2, WEI ZHANG 3 and DILIMINA YILAMU 1 1 Department of
More informationdna oestrogen GENOTYPE REPORT Patient Name: Date of Birth: Sample Number: Referring Practitioner: Date Reported:
dna oestrogen GENOTYPE REPORT Patient Name: Date of Birth: Sample Number: Referring Practitioner: Date Reported: BACKGROUND TO THE ANALYSIS The importance of both oestrogen and progesterone in breast cancer
More informationUnderstanding PI3K/mTOR/MEK signalling in breast cancer. Euphemia Leung Auckland Cancer Society Research Centre University of Auckland
Understanding PI3K/mTOR/MEK signalling in breast cancer Euphemia Leung Auckland Cancer Society Research Centre University of Auckland Receptor status of human breast cancer On a popula>on basis ER+/PR+
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3311 A B TSC2 -/- MEFs C Rapa Hours WCL 0 6 12 24 36 pakt.s473 AKT ps6k S6K CM IGF-1 Recipient WCL - + - + - + pigf-1r IGF-1R pakt ps6 AKT D 1 st SILAC 2 nd SILAC E GAPDH FGF21 ALKPGVIQILGVK
More informationABSTRACT INTRODUCTION. Ulises D. Orlando 1,*, Ana F. Castillo 1,*, Melina A. Dattilo 1, Angela R. Solano 1, Paula M. Maloberti 1, Ernesto J.
/, Vol. 6, No. 40 Acyl-CoA synthetase-4, a new regulator of mtor and a potential therapeutic target for enhanced estrogen receptor function in receptor-positive and -negative breast cancer Ulises D. Orlando
More informationState of the Art 3: Immunotherapy and Modulators of Apoptosis
State of the Art 3: Immunotherapy and Modulators of Apoptosis James Finke, PhD - Cleveland Clinic, Immunology Crystal Mackall, MD - NCI, Pediatric Oncology James Mier, MD - BIDMC, Medical Oncology Craig
More informationKevin R. Fox, MD Rena Rowan Breast Center Abramson Cancer Center University of Pennsylvania Perelman School of MedicineR
Kevin R. Fox, MD Rena Rowan Breast Center Abramson Cancer Center University of Pennsylvania Perelman School of MedicineR Treatment of early stage, HER2 positive breast cancer Treatment of early stage,
More informationGH-Releasing Hormone Promotes Survival and Prevents TNF- -Induced Apoptosis and Atrophy in C2C12 Myotubes
ORIGINAL RESEARCH GH-Releasing Hormone Promotes Survival and Prevents TNF- -Induced Apoptosis and Atrophy in C2C12 Myotubes Davide Gallo,* Iacopo Gesmundo,* Letizia Trovato, Giulia Pera, Eleonora Gargantini,
More informationMultimedia Appendix 6 Educational Materials Table of Contents. Intervention Educational Materials Audio Script (version 1)
Multimedia Appendix 6 Educational Materials Table of Contents Intervention Educational Materials... 1 Audio Script (version 1)... 1 Text (version 1)... 5 Slides (version 1)... 17 Audio Script (version
More informationCell Signaling (part 1)
15 Cell Signaling (part 1) Introduction Bacteria and unicellular eukaryotes respond to environmental signals and to signaling molecules secreted by other cells for mating and other communication. In multicellular
More informationMechanisms Associated with Dietary Energy Balance Effects on Tumor Development: Alterations in Growth Factor and Energy Sensing Pathways
Mechanisms Associated with Dietary Energy Balance Effects on Tumor Development: Alterations in Growth Factor and Energy Sensing Pathways John DiGiovanni, Ph.D. Professor and Coulter R. Sublett Endowed
More informationSongbirds, Steroids, and Adult Neurogenesis. Brad Walters Biological Sciences Lehigh University September, 2008
Songbirds, Steroids, and Adult Neurogenesis Brad Walters Biological Sciences Lehigh University September, 2008 Songbirds, steroids, and neurogenesis Some tissues regenerate well 1 2 3 4 http://flickr.com/photos/museumoflondon/2392340925/
More informationChapter 20 Carboxylic Acids. Introduction
hapter 20 arboxylic Acids Introduction arbonyl (-=) and hydroxyl (-H) on the same carbon is carboxyl group. arboxyl group is usually written -H or 2 H. Aliphatic acids have an alkyl group bonded to -H.
More informationEthnopharmacology. Herb for women s health. Active compounds from Curcuma comosa
Ethnopharmacology Curcuma comosa belongs to ginger family (Zingiberaceae), also known as Wan chukmotluk in Thai, meaning a rhizome that raises the uterus back to its position. Herb for women s health In
More informationCell proliferation and migration mechanism of caffeoylserotonin and serotonin via serotonin 2B receptor in human keratinocyte HaCaT cells
BMB Reports BMB Rep. 2018; 51(4): 188-193 www.bmbreports.org Cell proliferation and migration mechanism of caffeoylserotonin and serotonin via serotonin 2B receptor in human keratinocyte HaCaT cells Hye-Eun
More informationAn HMGA2-IGF2BP2 Axis Regulates Myoblast Proliferation and Myogenesis
Please cite this article in press as: Li et al., An HMGA2-IGF2BP2 Axis Regulates Myoblast Proliferation and Myogenesis, Developmental Cell (2012), http://dx.doi.org/10.1016/j.devcel.2012.10.019 Developmental
More informationVictor Chaban, Ph.D., MSCR
Hormonal Modulation of Pain : Estrogen Modulation of Visceral Nociception Victor Chaban, Ph.D., MSCR Department of Internal Medicine Charles R. Drew University of Medicine and Science Department of Medicine
More informationCHY2026: General Biochemistry. Lipid Metabolism
CHY2026: General Biochemistry Lipid Metabolism Lipid Digestion Lipid Metabolism Fats (triglycerides) are high metabolic energy molecules Fats yield 9.3 kcal of energy (carbohydrates and proteins 4.1 kcal)
More informationBiomolecules: lipids
Biomolecules: lipids Organic biomolecules: lipids Organic amphiphilic compounds insoluble in water Easily extracted from animal and vegetal cells using apolar solvents Fundamental to build cell's shape
More informationTala Saleh. Razi Kittaneh ... Nayef Karadsheh
Tala Saleh Razi Kittaneh... Nayef Karadsheh β-oxidation of Fatty Acids The oxidation of fatty acids occurs in 3 steps: Step 1: Activation of the Fatty acid FA + HS-CoA + ATP FA-CoA + AMP + PPi - The fatty
More informationglucose glucose 6-phospho fructose 6-phosphate fructose 1,6-bisphosphate glyceraldehyde 3-phosphate 1,3-bisphosphoglycerate 3-phosphoglycerate
Cells glucose glucose glucose 6-phospho glycogen pentose phosphate T 1-phosphate 6-phosphate gluconate CC T CC+PD-1 pathway Isobar: fructose 1,6-diphosphate; glucose 1,6-diphosphate DHAP lactate fructose
More informationCELLS. Cells. Basic unit of life (except virus)
Basic unit of life (except virus) CELLS Prokaryotic, w/o nucleus, bacteria Eukaryotic, w/ nucleus Various cell types specialized for particular function. Differentiation. Over 200 human cell types 56%
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationPrediction of invasiveness of hepatic tumor cells
Prediction of invasiveness of hepatic tumor cells (Overexpression of Romo1 Promotes Production of Reactive Oxygen Species and Invasiveness of Hepatic Tumor Cells) (Romo1 : Reactive Oxygen Species Modulator
More informationLipids and Classification:
Lipids and Classification: Lipids: Biological lipids are a chemically diverse group of organic compounds which are insoluble or only poorly soluble in water. They are readily soluble in non-polar solvents
More informationDISRUPTION OF BRANCHED-CHAIN AMINO ACID CATABOLISM IMPAIRS RAT MYOBLAST SURVIVAL AND DIFFERENTIATION ZAMEER N. DHANANI
DISRUPTION OF BRANCHED-CHAIN AMINO ACID CATABOLISM IMPAIRS RAT MYOBLAST SURVIVAL AND DIFFERENTIATION ZAMEER N. DHANANI A thesis submitted to the Faculty of Graduate Studies in partial fulfillment of the
More informationimplicated in pathologies such as type-2 diabetes, bipolar disorder, Alzheimer s, and
Abstract THE ROLE OF GSK-3β IN MCF-7 BREAST CANCER CELL SIGNALING AND DRUG RESISTANCE by MELISSA LYNN SOKOLOSKY APRIL, 2011 Director: DR. JAMES MCCUBREY DEPARTMENT OF BIOLOGY Glycogen synthase kinase-
More informationExcessive fatty acid oxidation induces muscle atrophy in cancer cachexia
SUPPLEMENTARY INFORMATION Excessive fatty acid oxidation induces muscle atrophy in cancer cachexia Tomoya Fukawa, Benjamin Chua Yan-Jiang, Jason Chua Min-Wen, Elwin Tan Jun-Hao, Dan Huang, Chao-Nan Qian,
More informationWe are IntechOpen, the first native scientific publisher of Open Access books. International authors and editors. Our authors are among the TOP 1%
We are IntechOpen, the first native scientific publisher of Open Access books 3,350 108,000 1.7 M Open access books available International authors and editors Downloads Our authors are among the 151 Countries
More informationSupplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
More informationChapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar
http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids
More informationBCM 221 LECTURES OJEMEKELE O.
BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX
More informationReview Session 1. Control Systems and Homeostasis. Figure 1.8 A simple control system. Biol 219 Review Sessiono 1 Fall 2016
Control Systems and Homeostasis Review Session 1 Regulated variables are kept within normal range by control mechanisms Keeps near set point, or optimum value Control systems local and reflex Input signal
More informationAP Biology
Tour of the Cell (1) 2007-2008 Types of cells Prokaryote bacteria cells - no organelles - organelles Eukaryote animal cells Eukaryote plant cells Cell Size Why organelles? Specialized structures - specialized
More informationORGANIC CHEMISTRY. Chapter Steroids. Department of Chemistry, Xiamen University
23.4 Steroids 23.4A Structures and Systematic Nomenclature of Steroids Steroids are derivatives of the following perhydrocyclopentanophenanthrene ring system. The four rings are designated A, B, C, and
More informationRAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
More informationmtor e le altre vie di trasduzione del segnale: Implicazioni cliniche Giampaolo Tortora
mtor e le altre vie di trasduzione del segnale: Implicazioni cliniche Giampaolo Tortora Cattedra di Oncologia Medica UOC Oncologia Medica du Facoltà di Medicina e Chirurgia e Azienda Ospedaliera Universitaria
More informationEstrogenic effects of flavonoid components in Xiaoyao powder
Estrogenic effects of flavonoid components in Xiaoyao powder J.H. Chen 1, N. Zhang 1, Y.Q. Wang 1, J.Z. Wang 1, S.X. Ji 1, W.J. Dang 1, S.M. Li 2 and L. Feng 2 1 College of Jiamusi, Heilongjiang University
More informationSummary of fatty acid synthesis
Lipid Metabolism, part 2 1 Summary of fatty acid synthesis 8 acetyl CoA + 14 NADPH + 14 H+ + 7 ATP palmitic acid (16:0) + 8 CoA + 14 NADP + + 7 ADP + 7 Pi + 7 H20 1. The major suppliers of NADPH for fatty
More informationExperience The Magic of Science. DermaPep UL. Multi-functional whitening active. Experience the magic of science
Experience The Magic of Science Multi-functional whitening active DermaP ep Experience the magic of science Anti-aging DermaPep A35 DermaPep A42 DermaPep A44 DermaPep A53 Whitening DermaPep A35 DermaPep
More informationRobert Newman, Ph.D. and Peiying Yang, Ph.D.
Robert Newman, Ph.D. and Peiying Yang, Ph.D. Department of Experimental Therapeutics and General Oncology The University of Texas, M.D. Anderson Cancer Center 1 Cardiac glycoside extracts from plants and
More informationMolecular understanding of tamoxifen resistance in breast cancer. Renée de Leeuw
Molecular understanding of tamoxifen resistance in breast cancer Renée de Leeuw Omslag ontworpen door: Theophile Suijkerbuijk (www.theophile.nl) Molecular understanding of tamoxifen resistance in breast
More informationCAN THE CD43 MOLECULE BE CONSIDERED AS A THERAPEUTIC TAGET? Yvonne Rosenstein Instituto de Biotecnologia, UNAM
CAN THE CD43 MOLECULE BE CONSIDERED AS A THERAPEUTIC TAGET? Yvonne Rosenstein Instituto de Biotecnologia, UNAM CD43: the molecule and its signaling capacities favors a Th1 differentiation pattern and contributes
More informationRobert Newman, Ph.D. and Peiying Yang, Ph.D.
Robert Newman, Ph.D. and Peiying Yang, Ph.D. Department of Experimental Therapeutics and General Oncology The University of Texas, M.D. Anderson Cancer Center Digitalis purpuria: Source of cardiac glycosides
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationSupplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
More informationA Dissertation. entitled. The Impact of FoxO1 on Skeletal Muscle Protein Synthesis. Rachael A. Potter
A Dissertation entitled The Impact of FoxO1 on Skeletal Muscle Protein Synthesis by Rachael A. Potter Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Doctor of Philosophy
More information9/16/2009. Fast and slow twitch fibres. Properties of Muscle Fiber Types Fast fibers Slow fibers
Muscles, muscle fibres and myofibrils Fast and slow twitch fibres Rat hindlimb muscle ATPase staining at different ph and NADH Muscle fibre shortening velocity lengths/second Properties of Muscle Fiber
More informationAntitumor Activity of CUDC-305, a Novel Oral HSP90 Inhibitor, in Solid and Hematological Tumor Xenograft Models
Antitumor Activity of CUDC-5, a Novel Oral HSP Inhibitor, in Solid and Hematological Tumor Xenograft Models Rudi Bao, MD/PhD April 1, 2 AACR 1th Annual Meeting 2 Experimental and Molecular Therapeutics
More informationSupplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
More informationKaryotype analysis reveals transloction of chromosome 22 to 9 in CML chronic myelogenous leukemia has fusion protein Bcr-Abl
Chapt. 18 Cancer Molecular Biology of Cancer Student Learning Outcomes: Describe cancer diseases in which cells no longer respond Describe how cancers come from genomic mutations (inherited or somatic)
More informationPrinciples of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
More informationSupplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationInterrogating mtor Inhibition in Patients with HRPC
Interrogating mtor Inhibition in Patients with HRPC Daniel George, John Madden, Andrew Armstrong, Mark Dewhirst, Nancy Major, and Phillip Febbo Divisions of Medical Oncology, Urology, Pathology, Radiology,
More informationCHOLINE ACETYLTRANSFERASE AND ACETYLCHOLINESTERASE IN MALE RAT S BRAIN
Original Research Article 115 EFFECTS OF Curcuma comosa EXTRACTS ON CHOLINE ACETYLTRANSFERASE AND ACETYLCHOLINESTERASE IN MALE RAT S BRAIN Sasithorn Lupreechaset 1, Laddawal Phivthong-ngam 2, Nuansri Niwattisaiwong
More informationEnzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors
Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma
More informationBiochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 27 Fatty Acid Degradation Dietary Lipid (Triacylglycerol) Metabolism - In the small intestine, fat particles are coated with bile
More informationGENERAL SUMMARY Corpus luteum is a transient endocrine structure formed from the ruptured ovarian follicle. Its main function is to secrete P 4, a pro
Corpus luteum is a transient endocrine structure formed from the ruptured ovarian follicle. Its main function is to secrete P 4, a pro-gestational hormone, essential for establishment and maintenance of
More informationLipid Chemistry. Presented By. Ayman Elsamanoudy Salwa Abo El-khair
Lipid Chemistry Presented By Ayman Elsamanoudy Salwa Abo El-khair 6 1. By the end of this chapter the student should be able to: define lipids. describe the biological importance of lipids. point out basic
More informationthe nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids
the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids and their sub-units; the role of lipids in the plasma
More informationBmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas
Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng
More informationDIET, AGING, and MIND Part II. Neal G. Simon, Ph. D. Dept. of Biological Sciences Lehigh University
DIET, AGING, and MIND Part II Neal G. Simon, Ph. D. Dept. of Biological Sciences Lehigh University Outline: Diet, Aging, and Mind 1. Review 2. Brain Changes in Aging 3. Dementias 4. Dietary Interventions:
More informationPhotobiomodulation s genetic pathways for cellular proliferation
Photobiomodulation s genetic pathways for cellular proliferation By Lew Lim, MedicLights Research Inc., Toronto, Canada, April 1, 2013 Based on investigations by Timon CY Liu et al of South China Normal
More informationSupporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationObestatin controls the ubiquitin proteasome and autophagy lysosome systems in glucocorticoidinduced muscle cell atrophy
Published online 3 July 2017 in Wiley Online Library (wileyonlinelibrary.com) ORIGINAL ARTICLE Obestatin controls the ubiquitin proteasome and autophagy lysosome systems in glucocorticoidinduced muscle
More informationAlkaline Oxidative Pretreatment followed by Reductive Lignin Depolymerization
Alkaline Oxidative Pretreatment followed by Reductive Lignin Depolymerization Eric L. Hegg Michigan State University Great Lakes Bioenergy Research Center (GLBRC) Michigan Forest Bioeconomy Conference
More informationUNIVERSITY TEKNOLOGI MARA THE ANTI PROLIFERATIVE PROPERTIES OF TINOSPORA CRISPA ON TRIPLE NEGATIVE BREAST CANCER CELL LINES
UNIVERSITY TEKNOLOGI MARA THE ANTI PROLIFERATIVE PROPERTIES OF TINOSPORA CRISPA ON TRIPLE NEGATIVE BREAST CANCER CELL LINES REYADH RADHI AL-RASHIDI Thesis submitted in fulfillment of the requirements for
More information