cyndazla: a cynomolgus monkey homologue of the human autosomal DAZ gene*

Transcription

1 Molecular Human Reproduction vol.3 no.6 pp , 1997 cyndazla: a cynomolgus monkey homologue of the human autosomal DAZ gene* Cesare Carani 1,Jörg Gromoll 2, Martin H.Brinkworth 2, Manuela Simoni 2, Gerhard F.Weinbauer 2 and Eberhard Nieschlag 2,3 1 Chair of Endocrinology of the University of Modena, Via del Pozzo 71, I Modena, Italy, and 2 Institute of Reproductive Medicine of the University of Münster, Domagkstraβe 11, D Münster, Germany 3 To whom correspondence should be addressed A gene on the human Y chromosome, specifically deleted in azoospermic patients (DAZ: deleted in azoospermia), and a DAZ homologue (DAZH) on human chromosome 3, have been recently described. In the present work we report the isolation and characterization of the corresponding DAZH gene of the cynomolgus monkey (Macaca fascicularis), which we have named cyndazla (cynomolgus DAZ-like autosomal). Reverse transcription polymerase chain reaction was used to amplify the monkey DAZ homologue, and sequence analysis revealed an open reading frame of 888 bp encoding 295 amino acids. Northern blot hybridization of different tissues to a probe derived from the cyndazla cdna detected a transcript of 3.5 kb that, in the male, was expressed only in the testis. Comparison of the cyndazla sequence to autosomal DAZ homologues from human, mouse and Drosophila showed two RNA-recognition motifs (RRM) and the presence of only one DAZ consensus repeat compared with the seven repeats found in the human DAZ gene on the Y chromosome. The homology of the cyndazla cdna compared with the human DAZH and mouse dazla cdnas is and 87.46% respectively. The identification of the monkey cyndazla enables further studies regarding the putative functions of DAZH, such as onset of expression and hormonal dependence of this gene. Key words: azoospermia/dazla/evolution/monkey/male infertility Introduction The DAZ (deleted in azoospermia) gene family comprises the Y-linked DAZ gene and its autosomal homologues. The DAZ gene encodes a protein of 366 amino acids, and Southern blotting of DNA from males and females from different primate species indicates that it is only present on the Y chromosome (Reijo et al., 1995). It is expressed in human testis and exclusively in germ cells, most abundantly in spermatogonia (Menke et al., 1997). Autosomal homologues are known from mouse dazla (DAZ-like, autosomal), or dazh (DAZ homologue) located on chromosome 17 (Cooke et al., 1996; Reijo et al., 1996b) and human DAZ homologue (DAZH) and/or SPGYLA (spermatogenesis gene on the Y-like, autosomal) are mapped to chromosome 3 (Saxena et al., 1996, Shan et al., 1996). Furthermore, boule, the DAZ homologue gene in Drosophila, is also autosomal (Eberhart et al., 1996) as is the only putative DAZ homologue detected in marsupials (Delbridge et al., 1997). The disruption of boule results in degeneration of spermatogenetic cells and azoospermia (Castrillon et al., 1993; Karsch-Mizrachi and Haynes, 1993). In the mouse, dazh is transcribed in male and female gonads. In the testis it is expressed in prospermatogonia and spermatogonia (Reijo et al., 1996b) and its expression reaches a peak at puberty (Cooke *Sequence data from this paper have been deposited with the EMBL/Gene Bank Libraries under Accession No. X et al., 1996; Reijo et al., 1996b). Similarly the human autosomal DAZ (DAZH) is abundantly expressed in the adult testis and at a lower level in the adult ovary (Saxena et al., 1996). Although the precise function of DAZ in man is unknown, its expression in spermatogonia (Menke et al., 1997), the phenotype associated with boule mutations (Eberhart et al., 1996), and the discovery of DAZ deletions in ejaculated spermatozoa from men with severe oligozoospermia (Reijo et al., 1996a) suggest a role early in spermatogenesis (Cooke et al., 1996; Kent-First et al., 1996; Reijo et al., 1996a,b; Pryor et al., 1997; Simoni et al., 1997). The cynomolgus monkey, Macaca fascicularis, is a very well characterized primate model for studying human spermatogenesis, which has a germ cell maturation process consistently different from those in rodents and lower species (Weinbauer and Nieschlag, 1991). Information about the DAZ gene in the non-human primate would therefore enable investigation of the mechanism of DAZ function. Given the presence of a putative DAZ gene in non-human primates (Reijo et al., 1995) data concerning DAZ-related sequences in the monkey would also provide insights into the evolution of DAZ genes and into the function of their autosomal homologues. Here we report cloning of the cynomolgus monkey autosomal homologue of the human DAZH, which we have termed cyndazla. Materials and methods When this investigation was started, only the human Y-chromosomal DAZ sequence had been published (Reijo et al., 1995). We therefore European Society for Human Reproduction and Embryology 479

2 C.Carani et al. Figure 1. The cdna and predicted amino acid sequence of cyndazla. The open reading frame starts at position 1 and consists of 288 amino acids. The primers used for reverse transcription polymerase chain reaction are underlined, and the 72 bp DAZ repeat identified is in bold letters. designed oligonucleotide primers based on the human DAZ cdna.the with ATGTCTACTGCAAATCCTGAAAC as a forward and TCAAAreverse primer TCAGTCTCTTCTCTGGATTAA (corresponding to CAGATTTAAGCATTGCCCG as a reverse primer. RT PCR was bases of the human DAZH) was used for first strand performed, using the same condition as described above, and yielded cdna synthesis. Total RNA (10 µg) from one normal adult cynomolgus a single DNA fragment which was again cloned into the TA-cloning monkey testis served as a template for avian myeloblastoma vector. Both strands of the cloned DNA-insert were sequenced by virus (AMV) reverse transcriptase (RT). Polymerase chain reaction the dideoxy chain termination method (Sanger et al., 1977) applying (PCR) was performed with the forward primer ATGTCTGCTGC- the primer walk technique (Gudermann et al., 1992). Two independent AAATCCTGAG corresponding to bases 1 20 of the human DAZ. clones were completely sequenced to exclude PCR-based errors. The reaction mixtures were incubated using a OmniGene (MWB- Biotech, Ebersberg, Germany) temperature cycler according to the following programme: 35 cycles (94 C 50 s; 57 C 1 min; 72 C 3 Northern blot analysis min) The programme was preceded by a 4 min denaturation step at RNA was extracted from testis tissue obtained from an 94 C and followed by a final extension step at 72 C for 5 min. PCR untreated man orchidectomized because of prostate carcinoma products were run on 1% agarose gels and the fragment cloned into and from cynomolgus monkey testis, kidney, brain and prostate. the TA-cloning vector (Invitrogen, Leek, The Netherlands) and Total RNA (20 µg) was subjected to electrophoresis through a 1% sequenced. The cdna encoded 768 bp encoding 265 amino acids denaturing agarose-formaldehyde gel and transferred to a nylon and did not contain a translational stop codon. After the recent membrane by Northern blotting in 10 sodium citrate/sodium publication of human DAZH cdna sequence (Saxena et al., 1996) chloride (SSC) (Sambrook et al., 1989). The cyndazla cdna the primer selection was adjusted according to the published sequence was linearized by Not1 digestion and antisense crna was 480

3 Non-human primate DAZLA homologue Figure 2. Amino acid sequence comparison of cyndazla, DAZH, Dazla, and boule. Asterisks indicate identical amino acids in the monkey, human and mouse DAZ-homologue genes. Closed circles represent identical amino acids in monkey, human, mouse, and fly. RNA-recognition motifs (RRM) are indicated by shaded boxes. The open box shows the 24 amino acids of the first DAZ repeat motif. Figure 3. Autoradiograph of a Northern blot showing hybridization to a 3.5 kb cyndazla transcript in human testis (lane 1, 2), and in monkey testis (lane 3, 4), but not in monkey kidney (lanes 5, 6), brain (lanes 7, 8) or prostate (lanes 9, 10). Loading is 10 µg of total RNA in lanes 1, 3, 5, 7, 9 and 20 µg in lanes 2, 4, 6, 8, 10. The band visible above the 3.5 kb signal was due to cross hybridization of the crna probe with the ribosomal 28S rrna. transcribed in vitro by Sp6 RNA polymerase. The specific activity 1989), 0.1% sodium dodecyl sulphate (SDS), for h at of the [ 32 P]-CTP labelled probe was ~ c.p.m./µg crna and 55 C. The final washing conditions were: 0.1% SSC, 0.1% SDS c.p.m./ml hybridization buffer were used for hybridization at 65 C. Blots were exposed to Kodak X-Omat film for 1 2 in 50% formamide, 1 Denhardt s solution (Sambrook et al., days. 481

4 C.Carani et al. RNAs from different monkey tissues to a cyndazla crna probe revealed the presence of a prominent transcript in human and monkey testis with ~3.5 kb and a lower expression in the smaller transcript with ~2.3 kb. No such signal could be observed in the other tissues investigated (Figure 3). Therefore, in the male, cyndazla is specifically expressed in the testis. PCR amplification of cynomolgus monkey genomic DNA using the primer pair sy254 to amplify Y-specific human DAZ sequences (Simoni et al., 1997) yielded a band in the male monkey only, apparently identical to that obtained in human, suggesting that a Y-specific cyndaz must exist in this species as well (Figure 4). Discussion We have isolated and characterized a homologue of the autosomal human DAZH gene in a non-human primate, the cynomolgus monkey. The homology of the cdna termed Figure 4. Genomic DNA was isolated from blood samples of a cyndazla to the human DAZH cdna and mouse dazla female and male monkey and human. Using the primer pair cdna is and 87.46% respectively. Northern blot sy254 amplifying Y-specific human DAZ sequences, a DNA hybridization yielded a transcript of similar size for human fragment was obtained in the male monkey (lane 1) and human and monkey testicular RNA, but not with RNA from other (lane 2), whereas no signal was obtained in the female monkey (lane 3) and human (lane 4). To assure proper polymerase chain organs, indicating that the expression of cyndazla may be amplification (PCR) conditions a partial DNA fragment of the confined to the testis in the male. Unfortunately, we did autosomal follicle stimulating hormone receptor (FSHR) was not have access to ovarian tissue but, by analogy with the amplified as a control, simultanously to the DAZ amplification. findings in human (Saxena et al., 1996), and in mouse Lane 5 represents the corresponding negative controls. M (Cooke et al., 1996), ovarian expression of cyndazla can DNA ladder of standards. be expected. Moreover, our results suggest that a Y-related Results cyndaz gene exists in the cynomolgus monkey. We speculate that both cyndaz and cyndazla could have an important The RT PCR of testicular cynomolgus monkey RNA with role in primate spermatogenesis. To this end, however, we primers corresponding to the 5 and 3 ends of the human have been so far unable to detect specific transcripts in the DAZH gene resulted in the specific amplification of a single testis by in-situ hybridization (ISH). Analysing human distinct DNA fragment of 888 bp. Varying the amount of testicular tissue, Menke et al. (1997) found transcripts of RNA used for first strand transcription or changing the the DAZ gene family by ISH using two different probes. parameters of the PCR reaction, did not result in the The signal could be localized in spermatogonia and perhaps amplification of additional cdna fragments. Thus, the also in early spermatocytes, however, only after very long cdna fragment obtained seems to be the most prominent exposure (87 and 176 days respectively). It is, therefore, transcription product of the monkey cyndazla gene. reasonable to speculate that testicular expression of Sequence analysis of the cloned DNA fragment revealed an cyndazla is similiarly low. open reading frame of 888 bp (Figure 1). The nucleotide Both the Y-chromosomal DAZ and the autosomal DAZH sequence encodes 295 amino acids with a calculated might contribute to spermatogenic development (Reijo et al., molecular mass of 31.1 kda. 1996b). Nevertheless the precise roles of these genes in Figure 2 shows a comparison of monkey, human, mouse spermatogenesis remain unknown. Tiepolo and Zuffardi and fly autosomal DAZ homologues at the amino acid level. (1976) described microscopically detectable deletions in the With 295 amino acids the monkey cyndazla has the same long arm of the Y chromosome (Yq11) and more recently length as the human DAZH with 290 identical amino acids, with the power of molecular methods, several investigators whereas mouse and fly have 298 and 228 amino acids have described various types of microdeletion of Yq11 in respectively. In the N-terminal part of the monkey protein, azoospermic and oligozoospermic patients. The majority of two RNA-recognition motif (RRM) domains are found which deletions were found in interval 6 of the Y chromosome, a match perfectly the RRM consensus sequences observed in region that contains ~ bp, from which two gene other RNA-binding proteins (Burd and Dreyfuss, 1994). families, RBM (Najmabadi et al., 1996a) and DAZ (Saxena Very high homology between cyndazla, DAZH and dazla et al., 1996), have been described and may be involved in is evident in the N-terminal and C-terminal parts of the the aetiology of azoospermia and oligozoospermia (Vogt putative protein including the sequence corresponding to the et al., 1992, 1996; Ma et al., 1993; Kobayashi et al., 1994; first repeat of the human DAZ. Reijo et al., 1996a; Prior et al., 1997; Simoni et al., 1997). Northern blot hybridization of human testis RNA and Moreover, some men with normal sperm counts have 482

5 Non-human primate DAZLA homologue microdeletions of the Y chromosome while some with Karsch-Mizrachi, I. and Haynes, S.R. (1993) The RB97D gene encodes a potential RNA-binding protein required for spermatogenesis in Drosophila. spermatogenic disruption and normal RBM and DAZ genes, Nucleic Acids Res., 21, have deletions in other tracts of the q arm of the Y Kent-First, M.G., Kol, S., Muallem, A. et al. (1996) The incidence and chromosome (Najmabadi et al., 1996b). Therefore it is possible relevance of Y-linked microdeletions in babies born after intracytoplasmic sperm injection and their infertile fathers. Mol. Hum difficult to define the relationship between deletion of the Reprod., 2, DAZ gene and the pathogenesis of disrupted spermatogenesis. Kobayashi, K., Mizuno, K., Hida, A. et al. (1994) PCR analysis of the Y Currently, it is only clear that in Drosophila the lack of chromosome long arm in azoospermic patients: evidence for a second boule function results in azoospermia indicating that boule locus required for spermatogenesis. Hum. Mol. Genet., 3, Ma, K., Inglis, J.D., Sharkey, A. et al. (1993) A Y chromosome has an essential role in spermatogenesis in the fly. In gene family with RNA-binding protein homology: candidates for the azoospermic men no mutations of DAZ have yet been found azoospermia factor AZF controlling human spermatogensis. Cell, 75, (Vereb et al., 1997), but the possibility that mutations in Menke, D.B., Mutter, G.L. and Page, D.C. (1997) Expression of DAZ, an either Y DAZ or autosomal DAZ could cause oligo- or Azoospermia Factor candidate, in human spermatogonia. Am. J. Hum. azoospermia cannot be excluded. Genet., 60, Amplification of a DAZ gene fragment by PCR using Najmabadi, H., Chai, N., Kapali, A. et al. (1996a) Genomic structure of primer sequences of the human DAZ gene indicates the a Y specific ribonucleic acid binding motif-containing gene: a putative candidate for a subset of male infertility. J. Clin. Endocrinol. Metab., presence of at least two DAZ forms, one autosomal and 81, one Y-chromosomal in the cynomolgus monkey. This supports Najmabadi, H., Huang, V., Yen, P. et al. (1996b) Substantial prevalence the view of Reijo et al. (1995), who suggest that the of microdeletion of Y chromosome in infertile men with idiopathic azoospermia detected using a sequence-target site-based mapping strategy. evolution of a second form of DAZ is a very recent step J. Clin. Endocrinol. Metab., 81, in evolution, whereby the DAZ gene was copied from an Pryor, J., Kent-First, M., Muallem, A. et al. (1997) Microdeletion in the autosome to the Y chromosome in primates (Saxena et al., Y chromosome of infertile men. N. Engl. J. Med., 336, ). The consequences of this are, however, unknown Reijo, R., Lee, T.-Y., Salo, P. et al. (1995) Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel and our monkey model could be an important tool for RNA-binding protein gene. Nature Genet., 10, studying this problem. Reijo, R., Alagappan, R.K., Patrizio, P. and Page, D.C. (1996a) Severe The identification of the cynomolgus monkey cyndazla oligozoospermia resulting from deletions of azoospermia factor gene on Y chromosome. Lancet, 347, should make it possible to investigate experimentally the Reijo, R., Seligman, J., Dinulos, M.B. et al. (1996b) Mouse autosomal precise role of the autosomal DAZ homologue during male homolog of DAZ, a candidate male sterility gene in humans, is expresssed and female gametogenesis in a primate animal model. in male germ cells before and after puberty. Genomics, 35, Studies to follow the onset of cyndazla expression Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: a Laboratory Manual. 2nd edn. Cold Spring Harbor Laboratory Press, during puberty when germ cell proliferation commences or Cold Spring Harbor, New York. experimental modification of regulation of spermatogonia, Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with (e.g. by administration of follicle stimulating hormone) will chain-terminating inhibitors. Proc. Natl Acad. Sci. USA, 74, Saxena, R., Brown, L.G., Hawkins, T. et al. (1996) The DAZ gene cluster give further insights into the spermatogenic function of on the human Y chromosome arose from an autosomal gene that was this gene. transposed, repeatedly amplified and pruned. Nature Genet., 14, Shan, Z., Hirschmann, P., Seebacher, T. et al. (1996) A SPGY copy homologous to the mouse gene Dazla and the Drosophila gene boule Acknowledgements is autosomal and expressed only in human male gonad. Hum. Mol. Genet., 5, The authors wish to thank Lisa Pekel for skilful technical assistance. Simoni, M., Gromoll, J., Dworniczak, B. et al. (1997) Screening for The work was supported by the Deutsche Forschungsgemeinschaft deletion of Y chromosome involving the DAZ (Deleted in Azoospermia) (project NI ). C.Carani was partially supported by a grant gene in azoospermia and severe oligozoospermia. Fertil. Steril., 67, from Ares Serono, Geneva, Switzerland, through the European Tiepolo, L. and Zuffardi, O. (1976) Localization of factors controlling Academy of Andrology. spermatogenesis in the non-fluorescent portion of the human Y chromosome long arm. Hum. Genet., 34, Vereb, M., Agulnik, A.I., Houston, J.T. et al. (1997) Absence of DAZ gene mutation in cases of non-obstructed azoospermia. Mol. Hum. References Reprod., 3, Castrillon, D.H., Gonczy, P., Alexander, S. et al. (1993) Toward a Vogt, P.H., Edelmann, A., Kirsch, S. et al. (1996) Human Y chromosome molecular genetic analysis of spermatogenesis in Drosophila melanogaster: azoospermia factors (AZF) mapped to different subregions in Yq11. characterization of male-sterile mutants generated by single P element Hum. Mol. Genet., 5, mutagenesis. Genetics, 135, Vogt, P., Chandley, A.C., Hargreave, T.B. et al. (1992) Microdeletions in Cooke, H.J., Lee, M., Kerr, S. and Ruggiu, M. (1996) A murine homologue interval 6 of the Y chromosome of males with idiopathic sterility point of the human DAZ gene is autosomal and expressed only in male and to disruption of AZF, a human spermatogenesis gene. Hum. Genet., 89, female gonads. Hum. Mol. Genet., 5, Delbridge, M.L., Harry, J.L., Toder, R. et al. (1997) A human candidate Weinbauer, G.F. and Nieschlag, E. (1991) Peptide and steroid regulation spermatogenesis gene, RBM1, is conserved and amplified on marsupial of spermatogenesis in primates. In Robaire, B. (ed.), The Germ Cell: Y chromosome. Nature Genet., 15, Spermatogonium to Fertilization. Proceedings of the 11th North American Eberhart, C.G., Maines, J.Z. and Wasserman, S.A. (1996) Meiotic cell Testis Workshop. Ann. N.Y. Acad. Sci., 637, cycle requirement for a fly homologue of human Deleted in Azoospermia. Nature, 381, Received on October 14, 1996; accepted on April 21, 1997 Gudermann, T., Birnbaumer, M. and Birnbaumer, L. (1992) Evidence for dual coupling of the murine luteinizing hormone receptor to adenylyl cyclase and phosphoinositide breakdown and Ca 2 mobilization. J. Biol. Chem., 267,