Tadalafil ameliorates metabolic syndrome induced alterations in visceral adipose tissue: an experimental study in the rabbit Mario Maggi Sexual
|
|
- Noah Singleton
- 5 years ago
- Views:
Transcription
1 Tadalafil ameliorates metabolic syndrome induced alterations in visceral adipose tissue: an experimental study in the rabbit Mario Maggi Sexual Medicine and Andrology Unit Dept. Experimental and Clinical Biomedical Sciences University of Florence Italy
2 Sexual Medicine & Andrology Unit Dept. «Mario Serio» University of Florence Linda Vignozzi Anatomy and Histology Units Department of Experimental and Clinical Medicine Prof.Daniele Bani Prof. Barbara Vannelli Dr. Annamaria Morelli, Dr. Erica Sarchielli Ilaria Cellai Paolo Comeglio Francesca Corcetto Chiara Cornio Sandra Filippi Elena Maneschi Gastroenterology Unit Department «Mario Serio» Dr. Tommaso Mello Prof. Andrea Galli
3 High triglycerides Low HDL cholesterol Hypertension Hyperglycemia Visceral obesity Metabolic syndrome (MetS)
4 BAT dissipates energy in the form of heat, by metabolizing fatty acids
5 Inhibition of PDE5 RhoA/ROCK
6 Aim of the Study: to investigate the effect of a PDE5 inhibitor, Tadalafil, on metabolic features in a rabbit model of MetS MetS Hyperglycaemia Reduced glucose tolerance (OGTT) Hypercholesterolemia Hypertriglyceridemia Hypertension Increased visceral fat mass Dysfunctional VAT NASH 0 Standard diet: control High fat diet: HFD 0.5% cholesterol and 4% peanuts oil weeks Hypogonadotropic hypogonadism o testosterone level ( FSH and LH level) o prostate, seminal vesicles weight Filippi S et al., J Sex Med 2009, 6(12): Vignozzi et al., Mol cell Endocrinol ;384: Vignozzi L et al., J Sex Med Jan;8(1):57-77 Vignozzi et al.,.j of Endocrinol 2012 Jan;212(1):71-84 Morelli et al., Prostate Sep 19. Morelli et al., J Steroid Biochem Mol Biol ;132:80. Maneschi et al., J Endocrinol Dec;215(3):
7 Rabbit model of Metabolic Syndrome MetS Hyperglycaemia Reduced glucose tolerance (OGTT) Hypercholesterolemia Hypertriglyceridemia Hypertension Increased visceral fat mass Dysfunctional VAT NASH 0 Standard diet: control High fat diet: HFD weeks 0.5% cholesterol and 4% peanuts oil Tadalafil (2mg/kg/day) Hypogonadotropic hypogonadism o testosterone level ( FSH and LH level) o prostate, seminal vesicles weight High fat diet + acute Tadalafil: HFD + 1 week Tad Vignozzi et al., Mol cell Endocrinol ;384: Vignozzi et al.,.j of Endocrinol 2012 Jan;212(1):71-84 Morelli et al., Prostate Sep 19. Morelli et al., J Steroid Biochem Mol Biol ;132:80. Maneschi et al., J Endocrinol Dec;215(3): Vignozzi L et al., J Sex Med Jan;8(1):57-77 Filippi S et al., J Sex Med 2009, 6(12):
8 Tadalafil significantly reduced HFD induced increase in triglycerides P< P=0.02 MetS Triglycerides (mg/dl) Hyperglycaemia Reduced glucose tolerance (OGTT) Hypercholesterolemia Hypertriglyceridemia Hypertension Increased visceral fat mass Dysfunctional VAT NASH RD HFD HFD+Tad1week Morelli et al., 2013, Prostate. 73(4): Vignozzi et al., unpublished 2014
9 Tadalafil significantly reduced HFD induced increase in VAT weigth P=0.004 P=0.011 MetS VAT (% of body weight) Hyperglycaemia Reduced glucose tolerance (OGTT) Hypercholesterolemia Hypertriglyceridemia Hypertension Increased visceral fat mass Dysfunctional VAT NASH RD HFD HFD+Tad1week Morelli et al., 2013, Prostate. 73(4): Vignozzi et al., unpublished 2014
10 VAT expresses high level of both PDE5 and PDE11 Vignozzi et al., unpublished 2014
11 HFD induced adipocyte hypertrophy and hypoxia were reduced by Tadalafil d. Adipocytediameter (μm) Control RD HFD HFD+Tadalafil h. Hypoxyprobepositivity (% of control) Control RD HFD HFD+Tadalafil HFD+tadalafil Maneschi et al. J of Endocrinol , 1-17 Maneschi et al., J of Endocrinol 218(2): Vignozzi et al., unpublished 2014
12 HFD induced reduction of GLUT4 translocation to plasma membrane was normalized by Tadalafil 120,00 mglut4/cglut4 % 100,00 80,00 60,00 40,00 20,00 0,00 Control RD HFD Diet HFD+Tadalafil Diet+Tad A mglut4 cglut4 STAT1 P<0.01 vs. all the other groups Maneschi et al. J of Endocrinol , 1-17 Maneschi et al., J of Endocrinol 218(2): Vignozzi et al., unpublished 2014
13 UCP1 immunolocalization in rabbit VAT 10x
14 Isolation of rpads from visceral fat RD rpad RD HFD rpad HFD HFD+TAD rpad HFD+TAD Maneschi et al., J Endocrinol Jul 6;218(2): Maneschi et al., J Endocrinol Dec;215(3):
15 Isolation of rpads from visceral fat RD NT DMEM with 4,5 g/l Glucose, P/S, L Glutamine FETAL BOVINE SERUM 5% rpad RD 10 days RD NT10 HFD rpad HFD 10 days HFD NT10 HFD+TAD rpad HFD+TAD 10 days HFD+Tad NT10 Vignozzi et al., unpublished 2014
16 Pre-adipocytes expresses very high level of PDE5 (similar to smooth muscle of corpora cavernosa) Vignozzi et al., unpublished 2014
17 A. RD B. HFD C. HFD+tadalafil D. E.
18 TFAM NRF1 CS SLC25A12 NDUFB5 NDUFB3 NDUFS1 SDHB GCb1 GCa1 PKG1 ROCK2 ROCK1 RhoA HOXC9 RB1 PPARγ PPARϒC 1β PPARϒC 1α BMP4 CD137 TMEM26 UCP1 CIDEA Mitochondrial biogenesis GC/PKG pathway White adipocyte markers p<0,0001, p<0,001, p<0,01, p<0,05 vs HFD mrna expression in HFD+Tadalafil (% of HFD) Brown/Brite adipocyte markers
19 Mitochondrial network morphology and dynamics by using a mitochondria specific probe (MitoTracker) RD HFD HFD+TADALAFIL
20 Mitochondrial ultrastructure by using TEM a. RD b. HFD c. HFD+ tadalafil d. Total Mitochondrial cristae surface/ outer membrane surface p< p< RD HFD HFD+Tadalafil
21 Superoxide production by using dihydroethidium (DHE) a. RD b. HFD c. HFD+tadalafil d.
22 In vitro treatment with tadalafil 100 nm in rpads from HFD rabbits Untreated 10 days HFD +Tadalafil rpad HFD +Tadalafil +KT5823 +KT5823 BAY : a selective sgc activator Tadalafil (inhibits cgmp degradation) +8Br cgmp +BAY KT5823: a selective inhibitor of PKG - 8Br cgmp: a PDE-resistant cgmp analog
23 In vitro treatment with tadalafil 100 nm in rpads from HFD rabbits a. RD b. HFD c. HFD+ tadalafil d. e. f rpad RD rpad HFD rpad HFD + tadalafil 3 H-glucose uptake (%) Insulin (M) Mean number of lipid droplets in rpad Mean volume (μm 3 ) of lipid droplets in rpad
24 Figure 10 a. RD rpad c. b. Untreated HFD rpad d. P< Mitochondrial lenght (µm) P< RD rpad HFD rpad +100nM tadalafil Untreated 100nMtadalafil HFD rpad
25 a. b. c. d. e. f. 140 Total mithoncondrialcristae surface / outer membrane surface P< P< P<0.05 P< Untreated RD RD rpad Untreated HFD +100nM Tadalafil tadalafil + KT KT nM KT+Tadalafil tadalafil+kt5823 HFD rpad
26 In vitro treatment with tadalafil 100 nm in rpads from HFD rabbits Tadalafil stimulates Brown-like phenotype mrna/18s UCP1 # TMEM26 # 0 0 control Tadalafil KT5823 Tadlf+KT 8BrcGMP BR5381 Untreated tadalafil KT 5823 tadalafil+kt Br-cGMP BAY HFD rpad control Untreated Tadalafil tadalafil KT KT5823 tadalafil+kt5823 Tadlf+KT 8-Br-cGMP 8BrcGMP BAY BR HFD rpad CD CIDEA mrna/18s # # Untreated tadalafil tadalafil+kt Br-cGMP BAY NT10 Tadalafil KT5823 Tadlf+KT 8BrcGMP BR5381 HFD rpad 0 control Tadalafil KT5823 Tadlf+KT 8BrcGMP BAY Untreated tadalafil KT 5823 tadalafil+kt Br-cGMP BAY
27 Antonio Aversa Davide Francomano Andrea Lenzi Department of Experimental Medicine, Medical Pathophysiology, Food Science and Endocrinology Section, Sapienza University of Rome, Viale Regina Elena 324, Rome, Italy Open label, single-arm, uncontrolled, single center, clinical trial, on 10 male patients aged 18 years, referring to an outpatient facility for the treatment of sexual dysfunction. Primary objective: to determine the potential effects of chronic tadalafil administration (2.5 mg/daily) on body composition in male subjects with erectile dysfunction. The primary outcomes was the variation of abdominal fat mass, measured with a whole body dual-energy X-ray absorptiometry (DXA- HOLOGIC QDR-1000), Further outcomes included body mass index (BMI) and other measures of fat distribution (waist circumference) and body composition (total fat mass with DXA)
28 Antonio Aversa Davide Francomano Andrea Lenzi Department of Experimental Medicine, Medical Pathophysiology, Food Science and Endocrinology Section, Sapienza University of Rome, Viale Regina Elena 324, Rome, Italy All patients were treated with tadalafil 2.5mg daily, in the early morning, for 8 weeks; the treatment was then stopped, and further follow-up evaluation was performed at week weeks 16 weeks Tadalafil 2.5mg daily Stop treatment Washout
29 Antonio Aversa Davide Francomano Andrea Lenzi Department of Experimental Medicine, Medical Pathophysiology, Food Science and Endocrinology Section, Sapienza University of Rome, Viale Regina Elena 324, Rome, Italy Open label, single-arm, uncontrolled, single center, clinical trial, on 10 male patients aged 18 years, referring to our outpatient facility for the treatment of sexual dysfunction.
30 a. b Fat (kg) Lean (kg) Total mass (kg) c. p<0.01 Baseline vs 8 weeks 8 weeks vs 16 weeks
31 conclusions: in an animal model of MetS (diet-induced) and in human subjects, in vivo tadalafil administration is able to decrease visceral adipose tissue (VAT), after short-term exposure (1 and 8 weeks, respectively). in vivo and in vitro studies demonstrated that tadalafil, via PKG activation in VAT, up-regulates browning-specific genes, including UCP1, and counteracts HFD-associated mitochondrial alterations, suggesting VAT browning
In The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
More informationThe Metabolic Syndrome Update The Metabolic Syndrome Update. Global Cardiometabolic Risk
The Metabolic Syndrome Update 2018 Marc Cornier, M.D. Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine
More informationMetabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine
Metabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine Setting the scene GB, 43 yo AA man followed for hypothyroidism returns on LT4 125 mcg/d and has a TSH=1.1
More informationLate onset hypogonadism
Late onset hypogonadism Farrukh Javid Male Menopause Clinical AND biochemical syndrome Testosterone levels decline by 0.4-3% per year after the age of 30, as opposed to the more rapid decline that occurs
More informationThe Role of Testosterone in the Sexual Function. Luiz Otavio Torres President Elect of ISSM Belo Horizonte - Brazil
The Role of Testosterone in the Sexual Function Luiz Otavio Torres President Elect of ISSM Belo Horizonte - Brazil Hormones and Sexual Function Paraventricular Nucleus Stimuli visual Sexual Desire Melatonine
More informationEffects of Exercise and Physical Activity on Diabetes Mellitus and Obesity
1 EXERCISE IS MEDICINE: The Science Behind the Movement Effects of Exercise and Physical Activity on Diabetes Mellitus and Obesity Rosa Allyn G. Sy, MD, FPCP, FPSEDM Endocrinology, Diabetes, Metabolism
More informationab Adipogenesis Assay Kit (Cell-Based)
ab133102 Adipogenesis Assay Kit (Cell-Based) Instructions for Use For the study of induction and inhibition of adipogenesis in adherent cells. This product is for research use only and is not intended
More informationThe Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk
Update 2013 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine Denver Health
More informationHSN301 Diet and Disease Entire Note Summary
Topic 1: Metabolic Syndrome Learning Objectives: 1. Define obesity 2. Factors causing obesity 3. Obesity as a risk factor for metabolic syndrome 4. The pathogenesis of metabolic syndrome 5. Treatment of
More informationTestosterone and PDE5 inhibitors in the aging male
Testosterone and PDE5 inhibitors in the aging male Francesco Romanelli Department of Experimental Medicine Medical Pathophysiology, Food Science and Endocrinology Section Sapienza University of Rome 3005
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationMetabolic Solutions Development Company, Kalamazoo, USA.
New Insulin Sensitizers Produce Differentiation of Brown-like Adipose Cells from a Subcutaneous Fat Depot and Increase Secretion of Adiponectin in vitro William G. McDonald, Serena L. Cole, Danielle D.
More informationChanges and clinical significance of serum vaspin levels in patients with type 2 diabetes
Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes L. Yang*, S.J. Chen*, G.Y. Yuan, D. Wang and J.J. Chen Department of Endocrinology, Affiliated Hospital of Jiangsu
More informationMetabolic Syndrome. Shon Meek MD, PhD Mayo Clinic Florida Endocrinology
Metabolic Syndrome Shon Meek MD, PhD Mayo Clinic Florida Endocrinology Disclosure No conflict of interest No financial disclosure Does This Patient Have Metabolic Syndrome? 1. Yes 2. No Does This Patient
More information9/26/2018. Andy Weiler, M.Ed. September 26 th, 2018
Andy Weiler, M.Ed. September 26 th, 2018 1 2 Stay tuned for the answer to our riddle Riddle #2 3 Riddle #2 Riddle #2 4 Riddle #2 The answer: 50%/50% chance to be right Fluids: blood volume, body water,
More informationWEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH
MENOPAUSE WHEN DOES IT OCCUR? The cessation of the menstrual cycle for one year. WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH Jan Schroeder, Ph.D. Chair of The Department of Kinesiology California State
More informationA Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationBenign prostatic enlargement can be influenced by metabolic profile: results of a multicenter prospective study
Gacci et al. BMC Urology (2017) 17:22 DOI 10.1186/s12894-017-0211-9 RESEARCH ARTICLE Benign prostatic enlargement can be influenced by metabolic profile: results of a multicenter prospective study Open
More informationMETABOLISMO E VITAMINA D
CONVEGNO NAZIONALE GIBIS ROMA 14-15 MAGGIO 2015 METABOLISMO E VITAMINA D Alfredo Scillitani UO Endocrinologia Ospedale Casa Sollievo della Sofferenza Holick MF, NEJM 2007 Sindrome Metabolica E un cluster
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationFGF21 Resistance in Adipose Tissues as a Cause of Insulin Resistance
Resistance in Adipose Tissues as a Cause of Insulin Resistance The ICDM 213 & 5 th AASD Scientific Meeting Seoul, Korea, Nov 8, 213 Aimin Xu Dept of Medicine & Dept of Pharmacology and Pharmacy The University
More information3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
More informationTest5, Here is Your My5 to Health Profile with Metabolic Syndrome Insight
Test5, Here is Your My5 to Health Profile with Metabolic Syndrome Insight Quest, Quest Diagnostics, the associated logo, and all associated Quest Diagnostics marks are the registered trademarks of Quest
More informationNicolucci C. (1), Rossi S. (2), Catapane M. (1), Introduction:
Bisphenol A and Nicolucci C. (1), Rossi S. (2), Catapane M. (1), (1) Dept. Experimental Medicine, Second University of (2) Institute of Genetic and Biophysics, CNR, Naples (3) Dept. of Pediatrics 'F. Fede',
More informationSexual dysfunction in male LUTS. M. Gacci Department of Urology, University of Florence
Sexual dysfunction in male LUTS M. Gacci Department of Urology, University of Florence Roma, 25-26 June, 2015 Cross-sectional population-based study of 4800 men (40 79 yr of age) UK, Netherlands, France,
More informationDiabetes: Across the Lifespan Friday, October 17, Obesity, Insulin Resistance and Type 2 Diabetes Cardiovascular Risks in Children.
Diabetes: Across the Lifespan Friday, October 17, 2014 Obesity, Insulin Resistance and Type 2 Diabetes Cardiovascular Risks in Children. Don P. Wilson, M.D., FNLA Diplomate, Am Brd of Clinical Lipidology
More informationForebyggelse af metabolisk syndrom vha. mejeriprodukter
Forebyggelse af metabolisk syndrom vha. mejeriprodukter Kjeld Hermansen Medicinsk Endokrinologisk afd. MEA, Aarhus Universitetshospital Mejeriforskningens Dag 2. marts 2017, Hotel Legoland Metabolic Syndrome
More informationcontrol kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More informationAlternative management of hypogonadism Tamoxifen. Emmanuele A. Jannini, MD Tor Vergata University of Rome ITALY
Alternative management of hypogonadism Tamoxifen Emmanuele A. Jannini, MD Tor Vergata University of Rome ITALY eajannini@gmail.com What hypogonadism is? What hypogonadism is? It is an empty glass The two
More informationMetabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk
Metabolic Syndrome Update 21 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes University of Colorado Denver Denver Health Medical Center The Metabolic
More informationThe role of apolipoprotein D in lipid metabolism and metabolic syndrome
UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates
More informationModule 2: Metabolic Syndrome & Sarcopenia. Lori Kennedy Inc & Beyond
Module 2: Metabolic Syndrome & Sarcopenia 1 What You Will Learn Sarcopenia Metabolic Syndrome 2 Sarcopenia Term utilized to define the loss of muscle mass and strength that occurs with aging Progressive
More informationMetabolic Issues in Transgender Women Living With HIV. Jordan E. Lake, MD, MSc 2 November 2018
Metabolic Issues in Transgender Women Living With HIV Jordan E. Lake, MD, MSc 2 November 2018 Disclosures -No relevant financial disclosures Learning Objectives Understand metabolic issues relevant to
More information3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.
U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,
More informationA microrna-34a/fgf21 Regulatory Axis and Browning of White Fat
A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International
More informationSALIVARY CORTISOL FLUCTUATIONS AND HYPERGLICEMIC STRESS IN PATIENTS WITH ABDOMINAL OBESITY
SALIVARY CORTISOL FLUCTUATIONS AND HYPERGLICEMIC STRESS IN PATIENTS WITH ABDOMINAL OBESITY Corina Dima-Cozma 1, Andreea Szalontay 2, Cristina Ghiciuc 3, Sebastian Cozma 4, Francesca Romana Patacchioli
More informationMetabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
More informationRegulation of adipose tissue remodeling by peripheral serotonin
Regulation of adipose tissue remodeling by peripheral serotonin Sangkyu Park Catholic Kwandong University College of Medicine Department of Biochemistry Serotonin (5-HT) is a signaling molecule Hemostasis
More informationTestosterone therapy (TTh) prevents progression from prediabetes to type 2 diabetes (T2DM) in hypogonadal: 9-year data from a registry study
Testosterone therapy (TTh) prevents progression from prediabetes to type 2 diabetes (T2DM) in hypogonadal: 9-year data from a registry study F Saad 1,2, KS Haider 3, A Haider 3 1 Global Medical Affairs
More informationObesity, Metabolic Syndrome, and Diabetes: Making the Connections
Obesity, Metabolic Syndrome, and Diabetes: Making the Connections Alka M. Kanaya, M.D. Associate Professor of Medicine & Epi/Biostats University of California, San Francisco February 26, 21 Roadmap 1.
More informationR. Leibel Naomi Berrie Diabetes Center 19 March 2010
Pathophysiology of type 2 diabetes mellitus R. Leibel Naomi Berrie Diabetes Center 19 March 2010 Body Mass Index Chart 25-29.9 29.9 = overweight; 30-39.9= 39.9 obese; >40= extreme obesity 5'0" 5'2" 52
More informationShapePerfection Burns fat fights cellulite
Burns fat fights cellulite Burns fat fights cellulite Spicy Substances to Fight Cellulite and Excess Centimeters ShapePerfection is a liposoluble anti-cellulite slimming active ingredient that is based
More informationSupplementary Online Content
Supplementary Online Content Larsen JR, Vedtofte L, Jakobsen MSL, et al. Effect of liraglutide treatment on prediabetes and overweight or obesity in clozapine- or olanzapine-treated patients with schizophrenia
More informationVisceral adipose tissue and carotid intimamedia thickness in HIV-infected patients undergoing cart: a prospective cohort study
Beires et al. BMC Infectious Diseases (2018) 18:32 DOI 10.1186/s12879-017-2884-9 RESEARCH ARTICLE Visceral adipose tissue and carotid intimamedia thickness in HIV-infected patients undergoing cart: a prospective
More informationHSN301 REVISION NOTES TOPIC 1 METABOLIC SYNDROME
HSN301 REVISION NOTES TOPIC 1 METABOLIC SYNDROME What does the term Metabolic Syndrome describe? Metabolic syndrome describes a cluster of cardio-metabolic conditions that increase one's risk of developing
More informationCardiometabolic Side Effects of Risperidone in Children with Autism
Cardiometabolic Side Effects of Risperidone in Children with Autism Susan J. Boorin, MSN, PMHNP-BC PhD Candidate Yale School of Nursing 1 This speaker has no conflicts of interest to disclose. 2 Boorin
More informationLipoatrophic Diabetes: What can zebras teach us about horses? Ranganath Muniyappa, MD, PhD Diabetes, Endocrinology, and Obesity Branch NIDDK, NIH
Lipoatrophic Diabetes: What can zebras teach us about horses? Ranganath Muniyappa, MD, PhD Diabetes, Endocrinology, and Obesity Branch NIDDK, NIH Objectives 1. Describe the clinical manifestations of abnormal
More informationConclusions. Keywords
Central obesity is predictive of persistent storage lower urinary tract symptoms (LUTS) after surgery for benign prostatic enlargement: results of a multicentre prospective study Mauro Gacci, Arcangelo
More informationDEVELOPMENTAL ORIGINS OF DIABETES AND CARDIOVASCULAR DISEASE. Goals
DEVELOPMENTAL ORIGINS OF DIABETES AND CARDIOVASCULAR DISEASE Goals Evolutionary paradox of obesity/diabetes Thrifty gene hypothesis Thrifty phenotype hypothesis Effects of small for gestational age (SGA)
More informationPCOS & Diet Therapy. Dr. Ladan Giahi Immunonutritionist Avicenna Research Institute October 2015
PCOS & Diet Therapy Dr. Ladan Giahi Immunonutritionist Avicenna Research Institute October 2015 Questions to be discussed: 1) Why dietary modification is considered as first line of treatment? 2) What
More informationTHE ENDOCANNABINOID SYSTEM IN ADIPOSE TISSUE. Key Points
December 2008 (Vol. 1, Issue 3, pages 31-35) THE ENDOCANNABINOID SYSTEM IN ADIPOSE TISSUE By Uberto Pagotto, MD, PhD Endocrinology Unit and Center of Applied Biomedical Research (C.R.B.A.), Department
More informationImpact of Testosterone Deficiency and Testosterone Therapy on Lower Urinary Tract Symptoms in Men with Metabolic Syndrome
Review Article pissn: 2287-4208 / eissn: 2287-4690 World J Mens Health 2018 September 36(3): 199-222 Impact of Testosterone Deficiency and Testosterone Therapy on Lower Urinary Tract Symptoms in Men with
More informationAmerican Journal of Oral Medicine and Radiology
American Journal of Oral Medicine and Radiology e - ISSN - XXXX-XXXX ISSN - 2394-7721 Journal homepage: www.mcmed.us/journal/ajomr PREVALENCE OF NONALCOHOLIC FATTY LIVER DISEASE AMONG TYPE 2 DIABETIC POPULATION
More informationMETABOLIC SYNDROME AND HCV: FROM HCV
METABOLIC SYNDROME AND HCV: FROM THEORY TO PRACTICE HCV Steatosis Insulin resistance Arun J Sanyal M.D. Chairman, Div. of Gastroenterology, Hepatology and Nutrition Virginia Commonwealth University Richmond,
More informationmajority of the patients. And taking an aggregate of all trials, very possibly has a modest effect on improved survival.
Hello. I am Farshid Dayyani. I am Assistant Professor in Genitourinary Medical Oncology at The University of Texas MD Anderson Cancer Center. We will be talking today about prostate cancer for survivorship
More informationUMHS-PUHSC JOINT INSTITUTE
Role of Visceral Adiposity in the Pathogenesis of Non-Alcoholic Fatty Liver Disease in Lean versus Obese Patients: A Comparative Study between Patients at UMHS versus PUHSC Lai WEI and Anna LOK W Zhang,
More informationImplications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss
GG2 Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss Dr Giacomo Gastaldi CHRU Montpellier Folie 1 GG2 19.10.2009 GG_PC; 12.10.2009 Plan Introduction
More informationClient Report Screening Program Results For: Missouri Western State University October 28, 2013
Client Report For: Missouri Western State University October 28, 2013 Executive Summary PROGRAM OVERVIEW From 1/1/2013-9/30/2013, Missouri Western State University participants participated in a screening
More informationThe Pennsylvania State University. The Graduate School. College of Health and Human Development
The Pennsylvania State University The Graduate School College of Health and Human Development EFFECTS OF DIETS LOW IN SFA AND WITH VARYING MUFA AND PUFA PROFILES ON BODY COMPOSITION AND HDL FUNCTION IN
More informationA synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
More informationLipout. Burns stored fat and achieves centimetric reduction BODY SCULPTURE
April 14 Burns stored fat and achieves centimetric reduction » The modern lifestyle Stress Sedentism Unbalanced diet EXCESS FAT + CELLULITE » How to remove excess fat and cellulite? The fatty tissue is
More informationSupplementary Table 1.
Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA
More informationTesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies
Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies Copyright 2016. All Rights Reserved. Property of Theratechnologies Inc. Mechanism of Action of Tesamorelin
More informationCardiovascular Complications of Diabetes
VBWG Cardiovascular Complications of Diabetes Nicola Abate, M.D., F.N.L.A. Professor and Chief Division of Endocrinology and Metabolism The University of Texas Medical Branch Galveston, Texas Coronary
More informationMetabolic defects underlying dyslipidemia in abdominal obesity
Metabolic defects underlying dyslipidemia in abdominal obesity Professor Marja-Riitta Taskinen Department of Medicine, Division of Cardiology Helsinki University Hospital, Finland Disclosures: Honorariums/
More informationZia H Shah MD FCCP. Director of Sleep Lab Our Lady Of Lourdes Hospital, Binghamton
Zia H Shah MD FCCP Director of Sleep Lab Our Lady Of Lourdes Hospital, Binghamton Obesity 70-80% of cases Alcohol use Hypognathism Marfan s syndrome Smoking ENT problems OSA and DM epidemics have
More informationRelationship between Low Muscle Mass and Metabolic Syndrome in Elderly People with Normal Body Mass Index
J Bone Metab 2015;22:99-106 http://dx.doi.org/10.11005/jbm.2015.22.3.99 pissn 2287-6375 eissn 2287-7029 Original Article Relationship between Low Muscle Mass and Metabolic Syndrome in Elderly People with
More informationTiming and tempo of first year growth in relation to cardiovascular and metabolic risk profile in early adulthood
Note: for non-commercial purposes only Timing and tempo of first year growth in relation to cardiovascular and metabolic risk profile in early adulthood Anita Hokken-Koelega Professor of Pediatric Endocrinology
More informationDevelopment of the Automated Diagnosis CT Screening System for Visceral Obesity
Review Asian Pacific Journal of Disease Management 2008; 2(2), 31-38 Development of the Automated Diagnosis CT Screening System for Visceral Obesity Toru Nakagawa 1), Syuichiro Yamamoto 1), Masataka Irokawa
More informationANTHROPOMETRIC CHARACTERISTICS OF SOME LIMB AND BODY CIRCUMFERENCES IN MALES AND FEMALES WITH TYPE 2 DIABETES MELLITUS
PROCEEDINGS OF THE BALKAN SCIENTIFIC CONFERENCE OF BIOLOGY IN PLOVDIV (BULGARIA) FROM 19 TH TILL 21 ST OF MAY 2005 (EDS B. GRUEV, M. NIKOLOVA AND A. DONEV), 2005 (P. 159 164) ANTHROPOMETRIC CHARACTERISTICS
More informationPlacental Transport in Pathologic Pregnancies
Note: for non-commercial purposes only Placental Transport in Pathologic Pregnancies Gernot Desoye Clinic of Obstetrics and Gynaecology Medical University, Graz Most Common Pregnancy Pathologies Diabetes
More informationTestosterone therapy in hypogonadal men results in sustained and clinically meaningful weight loss
clinical obesity doi: 10.1111/cob.12022 Testosterone therapy in hypogonadal men results in sustained and clinically meaningful weight loss A. A. Yassin 1 and G. Doros 2 What is already known about this
More informationObesity and the Metabolic Syndrome in Developing Countries: Focus on South Asians
Obesity and the Metabolic Syndrome in Developing Countries: Focus on South Asians Anoop Misra Developing countries, particularly South Asian countries, are witnessing a rapid increase in type 2 diabetes
More informationHormone Replacement Therapy
Hormone Replacement Therapy What Role Should It Play With Our Patients? Noel R. Williams MD, FACOG TESTOSTERONE FOR MEN: SALVATION OR SNAKE OIL? Definition Male hypogonadism means the testicles don't produce
More informationUnderstanding Body Composition
PowerPoint Lecture Outlines 7 Understanding Body Composition Objectives Define body composition. Explain why the assessment of body size, shape, and composition is useful. Explain how to perform assessments
More informationNHS England. Evidence review: Metreleptin for Congenital Leptin Deficiency
NHS England Evidence review: Metreleptin for Congenital Leptin Deficiency 1 NHS England Evidence review: Metreleptin for Congenital Leptin Deficiency First published: July 2017 Updated: Not applicable
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationTestosterone Regulates PDE5 Expression and in vivo Responsiveness totadalafil in Rat Corpus Cavernosum
European Urology European Urology 47 (2005) 409 416 Testosterone Regulates PDE5 Expression and in vivo Responsiveness totadalafil in Rat Corpus Cavernosum Xin-hua Zhang a,1, Annamaria Morelli a,1, Michaela
More informationNAFLD AND TYPE 2 DIABETES
NAFLD AND TYPE 2 DIABETES Sonia Caprio, MD STOPNASH Symposium on the Origin and Pathways of Nonalcoholic Steatohepatitis Washington 7, 215 Global Projection of Diabetes Hossain P et al. N Engl J Med 27;356:213
More informationSupplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
More informationMetabolic Syndrome.
www.bmiweightloss.com.au What is the metabolic syndrome? The was first described in 1988 by Gerald Reavson It was originally described as the clustering of four conditions These conditions when present
More informationBody Mass Index Chart = overweight; = obese; >40= extreme obesity
Pathophysiology of type 2 diabetes mellitus R. Leibel Naomi Berrie Diabetes Center 25 February 2008 Body Mass Index Chart 25-29.9 = overweight; 30-39.9= obese; >40= extreme obesity 5'0" 5'2" Weight (lbs)
More informationFAPESP Week /21/2017
Texas Tech University Dr Naima Moustaid-Moussa Texas Tech University FAPESP Week 2017 09/21/2017 University of Sao Paulo Dr Sonia Jancar ICB-USP Theresa Ramalho MS PhD candidate, Immunology ICB-USP Dr
More informationAssociation of hypothyroidism with metabolic syndrome - A case- control study
Article ID: ISSN 2046-1690 Association of hypothyroidism with metabolic syndrome - A case- control study Peer review status: No Corresponding Author: Dr. Veena K Karanth, Associate Professor, Surgery,
More informationAntipsychotic-Related Risk for Weight Gain and Metabolic Abnormalities During Development Christoph U. Correll, MD
Antipsychotic-Related Risk for Weight Gain and Metabolic Abnormalities During Development Christoph U. Correll, MD Professor of Psychiatry and Molecular Medicine Hofstra North Shore - LIJ School of Medicine
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationThe Impact of High Intensity Interval Training On Lipid Profile, Inflammatory Markers and Anthropometric Parameters in Inactive Women
Brief Report The Impact of High Intensity Interval Training On Lipid Profile, Inflammatory Markers and Anthropometric Parameters in Inactive Women Nasrin Zaer Ghodsi (MSc) Department of Physical Education,
More informationReproductive outcome in women with body weight disturbances
Reproductive outcome in women with body weight disturbances Zeev Shoham M.D. Dep. Of OB/GYN Kaplan Hospital, Rehovot, Israel Weight Status BMI (kg/m 2 ) Underweight
More informationFat Accumulation and Obesity-related Cardiovascular Risk Factors in Middle-aged Japanese Men and Women
ORIGINAL ARTICLE Fat Accumulation and Obesity-related Cardiovascular Risk Factors in Middle-aged Japanese Men and Women Miwa Ryo 1, Tohru Funahashi 1, Tadashi Nakamura 1, Shinji Kihara 1, Kazuaki Kotani
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationThe interplay between premature ejaculation and erectile dysfunction a systematic review and meta-analysis
The interplay between premature ejaculation and erectile dysfunction a systematic review and meta-analysis Giulia Rastrelli MD, PhD Sexual Medicine and Andrology Unit Department of Experimental and Clinical
More informationPresent and future association between obesity and hypogonadism in Italian male
ORIGINAL PAPER DOI: 10.4081/aiua.2014.1.26 Present and future association between obesity and hypogonadism in Italian male Valentina Boddi 1, Valeria Barbaro 2, Paul Mc Nieven 3, Mario Maggi 1, Carlo Maria
More informationAECOM, Bronx, NY; 2 Incyte Corporation, Wilmington, DE; 3 dgd Research, San Antonio, TX; 4 Profil Institute, San Diego, CA
INCB013739, a Selective Inhibitor of 11β-Hydroxysteroid Dehydrogenase Type 1 (11βHSD1), Improves Insulin Sensitivity and Lowers Plasma Cholesterol Over 28 Days in Patients with Type 2 Diabetes Mellitus
More informationRehabilitation and Research Training Center on Secondary Conditions in Individuals with SCI. James S. Krause, PhD
Disclosure The contents of this presentation were developed with support from educational grants from the Department of Education, NIDRR grant numbers H133B090005, H133B970011 and H133G010160. However,
More informationDiabetes in Older Adults
Diabetes in Older Adults NICOLAS MUSI, MD Barshop Institute for Longevity and Aging Studies San Antonio GRECC University of Texas Health Science Center San Antonio, TX Metabolic Alterations in Aging Sarcopenia
More informationThe Metabolic Syndrome Prof. Jean-Pierre Després
The Metabolic Syndrome 1 Jean-Pierre Després, Ph.D., FAHA, FIAS Quebec Heart and Lung Institute Department of Medicine Université Laval Québec, Canada Reaven s syndrome X Triglycerides HDL cholesterol
More informationMETABOLIC SYNDROME IN OBESE CHILDREN AND ADOLESCENTS
Rev. Med. Chir. Soc. Med. Nat., Iaşi 2012 vol. 116, no. 4 INTERNAL MEDICINE - PEDIATRICS ORIGINAL PAPERS METABOLIC SYNDROME IN OBESE CHILDREN AND ADOLESCENTS Ana-Maria Pelin 1, Silvia Mǎtǎsaru 2 University
More informationImpact of Physical Activity on Metabolic Change in Type 2 Diabetes Mellitus Patients
2012 International Conference on Life Science and Engineering IPCBEE vol.45 (2012) (2012) IACSIT Press, Singapore DOI: 10.7763/IPCBEE. 2012. V45. 14 Impact of Physical Activity on Metabolic Change in Type
More information