FGF21 Resistance in Adipose Tissues as a Cause of Insulin Resistance
|
|
- Godfrey Clarke
- 5 years ago
- Views:
Transcription
1 Resistance in Adipose Tissues as a Cause of Insulin Resistance The ICDM 213 & 5 th AASD Scientific Meeting Seoul, Korea, Nov 8, 213 Aimin Xu Dept of Medicine & Dept of Pharmacology and Pharmacy The University of Hong Kong
2 Our research focus: Adipokines and hepatokines in obesity-related cardiometabolic syndrome White Adipose Tissue Adipokines (adiponectin, A-FABP, LCN2 ) Liver Hepatokines (, MUP1) Pancreas Brain Skeletal muscle Blood vessel
3 Adipokines characterized in our laboratory A-FABP (Xu A, et al, Clin Chem, 26) (Xu &Tso et al, Circulation, 27) (Tso & Xu et al, Diabetes Care, 27) (Yeung D et al, ATVB, 27) Yeung D et al, Euro Heart J, 28) Hui X, JBC, 21, Neurology, 211) Hoo R, J Hepatology, 212, Lipocalin-2 (Wang Y et al, Clin Chem, 27) (Law I, Diabetes, 21) JBC, 212; Liu Y, BJP, 212 Adipose tissue Adiponectin (Xu A et al, J. Clin. Invest, 23, Wang et al, JBC 22, 24, 25, 26 Cancer Res, 26, Chow WS et al, Hypertension, 26; Cheng K et al, Diabetes, 27, Hoo R, et al. ATVB, 27, Liu M, PNAS, 28, Hepatology, 28, Cell Metabolism, 29, 211 Diabetes, 29, 21, 211, 212, Cell Metabolism, 211, PNAS, 212 Zhang X, Diabetes, 28; Diabetes, 21; Chen C; Diabetes Care, 211; Yu H, Clin. Chem. 211; Chen W, JBC, 211; Ge X, JBC, 211; Xiang Y, JECM, 211 ; Li H, Diabetes, 212; J Hepatology, 212; Ong L, JCEM, 212; Lin ZF, Cell Metabolism, 213
4 as a metabolic regulator 29aa N 28aa 181aa C It is secreted mainly from the liver. Its major target is adipose tissue. Liver Administration of recombinant acutely decreases blood glucose to a normal level in both rodents and monkeys with diabetes. It does not have mitogenic activities. Adipose tissue
5 Multiple beneficial effects of recombinant in animals
6 Adipose tissue as a major action site of FGF2 Liver Adipose tissue
7 Multiple effects of in adipocytes Adipocyte P ERK1/2??? FGFR β-klotho?? AMPK SIRT1 SRF SRF Elk-1 Glut1 transcription GLUT1 Lipolysis Glucose uptake PPARγ PGC1α UCP1 Heat dissipation Chow WS, 212
8 induces glucose uptake by inducing the expression of GLUT1 in adipocytes (Ge X, J Biol. Chem. 211, 286: ) FGFR β-klotho P ERK1/2 P RSK P ERK1/2 P RSK Glut1 promoter P Elk1 P CAGGAAGCACTTCCTTTAAAGG Ets consensus binding motif SRF SRE consensus binding motif Glucose uptake P SRF Glut1 transcription
9 fine-tunes growth hormone-induced lipolysis in adipocytes Pituitary Fasting GH Negative feedback Adipose tissue Lipolysis FFA PPAR-α Liver Chen W, et al, J Biol Chem ;286(4):
10 Regulates PGC-1α and Browning of White Adipose Tissues Cold or β3-adrenergic Stimuli Promoter PGC-1α (PTM Level) UCP1 Production Thermogenesis Transdifferentiation
11 Adipocytes play an obligatory role in mediating the metabolic actions of 1. Cell Metab. 212 Sep 5;16(3): PLoS One. 212;7(7):e Molecular Metabolism, Available online 27 August 212.
12 How does exert its profound effects on systemic insulin sensitivity and glucose homeostasis via its actions in adipocytes?? Adiponectin as a mediator?
13 Adiponectin, an insulin sensitizing adipokine predominantly produced from adipocytes (LMW) (MMW) HMW: High molecular weight Wang Y et al, JBC, 22, JBC, 24, JBC, 26, JBC, 28, Proteomics, 25, 26; Richards AA, Mol. Endocrinol, 21, Wang Y, Biochem J, 28 (Review), JMB, 29
14 Multiple protective effects of adiponectin against a cluster of obesity-related disorders Insulin sensitivity Hypertension Myocardial infarction Cardiomyopathy Atherosclerosis Fatty liver, NASH fibrosis (Xu A, JCI, 23) (Ding X, Am J Path, 25) Zhou M, Hepatology, 28 and 211) Obesity-related asthma (Shore S, J Allergy Clin Immunol. 26) Vascular protection (Cheng K, Diabetes,27) (Chang J, Diabetes, 21) (Wang Y, Diabetes, 211) (Wong J, Cell Metabolism, 211) Inflammation (Fayad R, Gastroenterology. 27) Hoo R, ATVB, 28) Dyslipidemia (Xu A, Endocrinology,25) Obesity-related cancers (Wang Y, Cancer Res, 27 and Cell Res, 29, Liu J, Carcinogenesis, 211)
15 Fold change of Adiponectin levels Adiponectin mrna(au) induces both expression and secretion of adiponectin in mouse adipocytes A B 3 2 Vehicle 2.5 Vehicle Times(hours) Times(hours) Lin ZF, Cell Metabolism, 213: 7;17:
16 Percentage of adiponectin secreted into Medium enhances adiponectin secretion in A Pulse-chase experiment with 35 S methionine Vehicle CL CM CL CM mouse adipocytes Chase times(hours) B Percentage of adiponectin released 1 Vehicle Times (hours) CL: Cell lysates; CM: Conditioned medium
17 PPARr agonists increase adiponectin expression and secretion Liu M, PNAS, 28 Reviewed by Wang Y, Biochem J, 28
18 Adiponectin(ng/ml) Adiponectin mrna(au) Adiponectin(ng/ml) Adiponectin mrna(au) Suppression of PPARγ attenuates -induced expression and secretion of adiponectin A 6 B GW9662 C Vehicle GW D Vehicle GW9662: PPARr antagonist PPAR (+/+) PPAR (+/-). PPAR (+/+) PPAR (+/-)
19 Fold changes(au) Fold changes(au) induces the expression of molecular chaperones involved in adiponectin secretion Ero1-Lα DsbA-L β-actin GW Ero1-Lα DsbA-L β-actin PPARγ Ero1-L Vehicle GW9662 DsbA-L +GW9662 Ero1-L PPAR (+/+)+Vehicle PPAR (+/-)+Vehicle DsbA-L PPAR (+/+)+ PPAR (+/-)+ p<.5; p<.1. n=5-6
20 Adiponectin(ng/ml) Adiponectin mrna(au) Adiponectin (ng/ml) acts in an autocrine manner to induce adiponectin production in adipocytes A Vehicle Rosiglitazone C 5 4 B WT KO Vehicle Rosiglitazone Rosi anti-fgf21 IgG nonimmnue IgG WT KO p<.5; p<.1. n=5 in each group
21 Adiponectin( g/ml) Absorbance at 28nm Adiponectin( g/ml) (pg/ml) induces adiponectin production in mice A 4 WT KO B 1 Vehicle (.5mg/kg.day) C Chow HFD Chow HFD 4 weeks 35 weeks 4 Vehicle 3 2 D Times(weeks) HMW Hexamer Trimer Vehicle Times(weeks) Elution times(min)
22 Triglycerides(mmol/l) perk1/2 /Erk1/2 Glucose(mmol/l) Insulin(ng/ml) The acute metabolic benefits of are abrogated in adiponectin-deficient mice with dietary obesity A B C Times (min) 6 Times (min) 12 WT+Vehicle ADN(-/-)+Vehicle WT+ ADN(-/-)+ D 6 12 Times (min) p-erk1/2 Erk1/ WT ADN(-/-)
23 The beneficial Effects of on glucose metabolism and insulin sensitivity are impaired in adiponectin KO mice Glucose(mmol/l) Glucose(mmol/l) Glucose(mmol/l) Glucose(mmol/l) Vehicle WT Vehicle ADN(-/-) Times (min) Times (min) WT Vehicle ADN(-/-) Vehicle Times(min) Times(min) Lin ZF, Cell Metabolism, 213: 7;17:
24 Phosphorylation levels Phosphorylation levels The insulin-sensitizing effects of in the liver are mediated by adiponectin A WT B ADN(-/-) p-akt Akt p-gsk3β GSK3β Insulin p-akt Akt p-gsk3β GSK3β Insulin p-akt/akt p-gsk3 /GSK p-akt/akt p-gsk3 /GSK Insulin Insulin p<.5; p<.1. n=5 in each group
25 ALT(U/L) mrna abundance(au) Adiponectin is required for -mediated alleviation of fatty liver disease in obese mice A STC HFD HFD+ WT ADN(-/-) B C TNF MCP STC HFD STC HFD STC HFD p<.5; p<.1. n=6 in each group
26 TG(mg/g tissue) TG(mg/g tissue) Adiponectin is obligatory for -mediated reduction of HFD-induced lipid accumulation in skeletal muscle Vehicle Vehicle Vehicle Vehicle Soleus Gastrocnemius
27 Phosphorylation levels Phosphorylation levels The insulin-sensitizing effects of in skeletal muscle are dependent on adiponectin A WT B ADNKO p-akt p-akt Akt p-gsk3β Akt p-gsk3β 6 4 GSK3β Insulin p-akt/akt p-gsk3 /GSK3 GSK3β Insulin p-akt/akt p-gsk3 /GSK Insulin Insulin p<.5; p<.1
28 Adiponectin confers the metabolic actions of in the liver and skeletal muscle Adipocytes PPARγ (+) APN mrna Ero1-Lα DsbA-L APN (+)? βklotho FGFR Secretion (+) Blood vessel Insulin Sensitivity (+) Lipid accumulation (-) Muscle Insulin Sensitivity (+) Lipid accumulation (-) Liver Lin ZF, Cell Metabolism, 213: 7;17:779-8
29 Log Visceral fat (%) Serum levels (ng/l) BMI (kg/m 2 ) Human Serum levels are significantly elevated in overweight/obese subjects N=15 N=127 N=232 r² =.229, p<.1 Lean Overweight/obese Log Serum levels r² =.24, P <.1 N=217 Log Serum levels Zhang, X., et al. Diabetes 28 Giannini C et al., J Clin Endocrinol Metab. 213
30 Elevated circulating is associated with a cluster of obesity-related complications Coronary heart disease Lin, Z., et al. PLoS ONE 21 Atherosclerosis Chow WS, et al. ATVB. 213 Diabetes Chen, C., et al. Diabetes Care 211 Yang, M., et al. PLoS ONE 211 Serum Metabolic syndrome Zhang, X., et al. Diabetes 28 Reinehr, T. et al. JCEM 212 Obesity Zhang, X., et al. Diabetes 28 Reinehr, T. et al. JCEM 212 NAFLD Li, H., et al. J Hepatol 21 Dushay, J., et al. Gastroenterology 21 Diabetic Nephropathy Jian, W.X., et al. Metabolism 212
31 Zhang X, et al. Diabetes 28; Fisher FM, et al. Diabetes 21; Hale C, et al. Endocrinology 212 Elevated production in obese animals Tissue Genetic-induced obesity Diet-induced obesity Liver Epid Serum Resistance??
32 Impaired actions of in ob/ob obese mice Fasting glucose and free fatty acid Glucose clamping Berglund ED et al., Endocrinology. 29 ; Fisher FM, et al. Diabetes 21
33 Glucose level (fold change) Glucose level (fold change) Glucose level (fold change) Glucose level (fold change) The glucose-lowering effects of are progressively decreased in High Fat High Cholesterol (HFHC) diet-induced obese mice weeks 8 weeks STC- HFHC- min 3 mins 6 mins 12 mins STC- HFHC- min 3 mins 6 mins 12 mins weeks STC- HFHC weeks STC- HFHC-.5 min 3 mins 6 mins 12 mins.5 min 3 mins 6 mins 12 mins
34 A progress development of resistance during diet-induced obesity Serum triglyceride levels (fold changes) weeks 2 weeks 12 weeks 8 weeks 4 weeks Baseline HFHC diet induction.5 min 3 mins 6 mins 12 mins Time after injection : 1 mg/kg; n=5
35 The ability of recombinant (rm) to increase circulating adiponectin is progressively impaired in diet-induced obesity Serum adiponectin (ug/ml) 2 18 saline 16 rm week 8 week 12 week 24 week High fat high cholesterol diet
36 -induced signal transduction pathways in adipose tissues are impaired in obesity lean obese Ge X, et al. J Biol Chem 211; Fisher FM, et al. Diabetes 21
37 Mechanisms of resistance? Adipocyte P ERK1/2??? FGFR β-klotho?? AMPK SIRT1 SRF SRF Elk-1 Glut1 transcription GLUT1 Lipolysis Glucose uptake PPARγ PGC1α UCP1 Heat dissipation Chow WS, 212
38 A marked down-regulation of β-klotho and FGFR1 in different fat depots in obese mice PVAT BAT Epididylmal β- klotho FGFR1 STC HFHC STC HFHC STC HFHC STC HFHC STC HFHC STC HFHC HFHC: High fat high cholesterol diet
39 A marked down-regulation of β-klotho and FGFR1 in different fat depots in obese mice PVAT BAT STC HFHC STC HFHC β-klotho FGFR1
40 How does obesity cause reduced β-klotho and FGFR1 expression?
41 Involvement of TNFα-JNK pathway in modulating β-klotho expression??? Díaz-Delfín J, et al. Endocrinology. 212
42 Obesity Adipocyte??? TNFα FGFR1 β-klotho Glucose uptake JNK activation
43 resistance as a cause of systemic insulin resistance Adipocytes FGFR1c Autocrine APN βklotho Obesity Secretion Endorcine Blood vessel Muscle Insulin Sensitivity Insulin Sensitivity Liver Systemic Insulin resistance
44 HKU team Acknowledgement Prof. Karen Lam Kyoto University Prof. Nobuyuki Itoh & Dr. Yuhei Hotta Xiangya 2 nd Hospital, Hunan Prof. Zhi-guang Zhou Shanghai Diabetes Center, Jiao Tong University Prof. Jia Weiping, Dr. Li Huating
45
A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationBEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli
BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli Symposium Co-Chairs: Bruce M. Spiegelman (Harvard/Dana Farber) and Sven Enerbäck (U.Gothenburg) April 17-23, 2015 Snowbird Resort,
More informationA microrna-34a/fgf21 Regulatory Axis and Browning of White Fat
A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International
More informationIn The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
More informationAdipose Tissue Dysfunction and Diabetic Cardiovascular Disease
Adipose Tissue Dysfunction and Diabetic Cardiovascular Disease Xin-Liang Ma, MD, PhD Thomas Jefferson University Philadelphia, PA USA CVD As The #1 Causes of Death In USA Male Female Heart Disease and
More informationIL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA
UNIGASTRO Il fegato come centrale metabolica e i fattori di danno oltre ai virus epatitici IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA Dr Elisabetta Bugianesi Divisione di Gastro-Epatologia
More informationThe Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk
Update 2013 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine Denver Health
More informationAnalysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue
Analysis of AVP functions via V1a and V1b receptors with knockout mice Akito Tanoue Department of Pharmacology, National Research Institute for Child Health and Development Arginine-Vasopressin (AVP) is
More information902 Biomed Environ Sci, 2014; 27(11):
902 Biomed Environ Sci, 2014; 27(11): 902-906 Letter to the Editor Curcuminoids Target Decreasing Serum Adipocyte-fatty Acid Binding Protein Levels in Their Glucose-lowering Effect in Patients with Type
More informationAn excessive increase in glutamate contributes to glucose-toxicity in. β-cells via activation of pancreatic NMDA receptors in rodent diabetes
An excessive increase in glutamate contributes to glucose-toxicity in β-cells via activation of pancreatic NMDA receptors in rodent diabetes Xiao-Ting Huang 1, Chen Li 1,3, Xiang-Ping Peng 1, Jia Guo 1,5,
More informationEffects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland
More informationSupplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
More informationKenneth, King-yip CHENG (Assistant Professor)
Kenneth, King-yip CHENG (Assistant Professor) QUALIFICATIONS: 2003 2009 BSc (Hons) Biochemistry, Hong Kong University of Science and Technology PhD, Department of Medicine, The University of Hong Kong
More informationTadalafil ameliorates metabolic syndrome induced alterations in visceral adipose tissue: an experimental study in the rabbit Mario Maggi Sexual
Tadalafil ameliorates metabolic syndrome induced alterations in visceral adipose tissue: an experimental study in the rabbit Mario Maggi Sexual Medicine and Andrology Unit Dept. Experimental and Clinical
More informationInflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra
Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue Rinke Stienstra Obesity promotes the development of insulin resistance and type 2 diabetes County-level Estimates
More informationENHANCEMENT OF BROWN ADIPOSE TISSUE DEVELOPMENT IN VIVO BY A NOVEL INSULIN SENSITIZER
ENHANCEMENT F BRWN ADIPSE TISSUE DEVELPMENT IN VIV BY A NVEL INSULIN SENSITIZER William G. McDonald 1, Serena L. Cole 1, Brian N. Finck 2, Danielle D. Holewa 1, Angela S. Brightwell-Conrad 1, Charles Mackenzie
More informationSupplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
More informationMolecular Medicine. Brown adipose tissue responds to cold and adrenergic
Brown adipose tissue responds to cold and adrenergic stimulation by induction of FGF21 Dionysios V. Chartoumpekis, 1, Ioannis G. Habeos, 1, Panos G. Ziros, 1 Agathoklis I. Psyrogiannis, 1 Venetsana E.
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationUnderstanding the Physiology of FGF21
ANNUAL REVIEWS Further Click here to view this article's online features: Download figures as PPT slides Navigate linked references Download citations Explore related articles Search keywords Annu. Rev.
More informationAdipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University
Adipose Tissue as an Endocrine Organ Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Functions of Adipose Tissue Adipose tissue expresses and secretes a variety of bioactive peptides,
More informationPathogenesis of Diabetes Mellitus
Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia
More informationNASH Bench to Bedside
NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent
More informationRegulation of Lipid Homeostasis: Lipid Droplets
Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells
More informationBrown Adipose Tissue Responds to Cold and Adrenergic Stimulation by Induction of FGF21
Brown Adipose Tissue Responds to Cold and Adrenergic Stimulation by Induction of FGF21 Dionysios V Chartoumpekis, 1* Ioannis G Habeos, 1* Panos G Ziros, 1 Agathoklis I Psyrogiannis, 1 Venetsana E Kyriazopoulou,
More informationHIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD
HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte
More informationA synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationCrosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea
Crosstalk between Adiponectin and IGF-IR in breast cancer Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Obesity Chronic, multifactorial disorder Hypertrophy and hyperplasia
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ
ΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ ΘΩΜΑΣ ΠΑΠΑΔΟΠΟΥΛΟΣ, MD, PHD ΕΠΕΜΒΑΤΙΚΟΣ ΚΑΡΔΙΟΛΟΓΟΣ ΙΑΤΡΙΚΟ ΔΙΑΒΑΛΚΑΝΙΚΟ ΚΕΝΤΡΟ Inflammation as a cause of disease has entered the popular imagination. Diet ( macronutrients )
More informationEffects of Exercise and Physical Activity on Diabetes Mellitus and Obesity
1 EXERCISE IS MEDICINE: The Science Behind the Movement Effects of Exercise and Physical Activity on Diabetes Mellitus and Obesity Rosa Allyn G. Sy, MD, FPCP, FPSEDM Endocrinology, Diabetes, Metabolism
More informationDiabetes Care Publish Ahead of Print, published online October 17, 2008
Diabetes Care Publish Ahead of Print, published online October 17, 2008 Serum FABPs and diabetic nephropathy Circulating levels of adipocyte and epidermal fatty acid-binding proteins in relation to nephropathy
More informationSupplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
More informationSupplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
More informationFigure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
More informationMetabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
More informationMetabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk
Metabolic Syndrome Update 21 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes University of Colorado Denver Denver Health Medical Center The Metabolic
More information3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
More informationYiying Zhang, PhD Research Scientist. Research Summary:
Yiying Zhang, PhD Research Scientist Research Summary: Address: Naomi Berrie Diabetes Center at Columbia University Medical Center Russ Berrie Medical Science Pavilion 1150 St. Nicholas Avenue New York,
More informationFat and HIV persistence, role of fat metabolism and inflammation
NIDDK Workshop Obesity and Fat Metabolism in HIV infected individuals Rockville, MD May 22-23, 2018 Centro de Investigación Biomédica En Red Fisiopatología de la Obesidad y Nutrición Fat and HIV persistence,
More informationSHU, L; Hoo, RLC; WU, X; PAN, Y; LEE, PC; CHEONG, LY; Bornstein, SR; Rong, X; Gua, J; Xu, A. Citation Nature Communications, 2017, v. 8, p.
Title mediates adaptive thermogenesis by promoting intracellular activation of thyroid hormones in brown adipocytes Author(s) SHU, L; Hoo, RLC; WU, X; PAN, Y; LEE, PC; CHEONG, LY; Bornstein, SR; Rong,
More informationTesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies
Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies Copyright 2016. All Rights Reserved. Property of Theratechnologies Inc. Mechanism of Action of Tesamorelin
More informationInterplay between FGF21 and insulin action in the liver regulates metabolism
Research article Interplay between FGF21 and insulin action in the liver regulates metabolism Brice Emanuelli, 1 Sara G. Vienberg, 1 Graham Smyth, 1 Christine Cheng, 2 Kristin I. Stanford, 1 Manimozhiyan
More informationRegulation of adipose tissue remodeling by peripheral serotonin
Regulation of adipose tissue remodeling by peripheral serotonin Sangkyu Park Catholic Kwandong University College of Medicine Department of Biochemistry Serotonin (5-HT) is a signaling molecule Hemostasis
More informationBIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
More informationImplications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss
GG2 Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss Dr Giacomo Gastaldi CHRU Montpellier Folie 1 GG2 19.10.2009 GG_PC; 12.10.2009 Plan Introduction
More information3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.
U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,
More informationAdipose tissue dysfunction in obesity. Gijs Goossens, PhD
Adipose tissue dysfunction in obesity -The role of adipose tissue oxygenation - Gijs Goossens, PhD NUTRIM School of Nutrition and Translational Research in Metabolism Maastricht University Medical Centre
More informationFH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle
A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationChanges and clinical significance of serum vaspin levels in patients with type 2 diabetes
Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes L. Yang*, S.J. Chen*, G.Y. Yuan, D. Wang and J.J. Chen Department of Endocrinology, Affiliated Hospital of Jiangsu
More informationMETABOLISMO E VITAMINA D
CONVEGNO NAZIONALE GIBIS ROMA 14-15 MAGGIO 2015 METABOLISMO E VITAMINA D Alfredo Scillitani UO Endocrinologia Ospedale Casa Sollievo della Sofferenza Holick MF, NEJM 2007 Sindrome Metabolica E un cluster
More informationClinical Role of Inflammation in Metabolic Diseases
Clinical Role of Inflammation in Metabolic Diseases Won-Young Lee Department of Endocrinology and Metabolism Kangbuk Samsung Hospital Sungkyunkwan University Medical School, Seoul, Korea (2009-Nov-19)
More informationDOWNLOAD PDF ADIPOSE TISSUE AND ADIPOKINES IN HEALTH AND DISEASE (NUTRITION AND HEALTH)
Chapter 1 : Adiposity, Adipokines, and Adiposopathy - Sick Fat Explained Adipose Tissue and Adipokines in Health and Disease, Second Edition is a useful resource for physicians interested in adipose tissue
More informationMouse Adiponectin Immunoassay Kit
Antibody and Immunoassay Services Li Ka Shing Faculty of Medicine, The University of Hong Kong Mouse Adiponectin Immunoassay Kit Catalogue Number: 32010 For the quantitative determination of mouse adiponectin
More informationYun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019
Combination Therapy of Seladelpar and Liraglutide Attenuates Obesity, Hepatic Steatosis and Fibrosis in a Diet-induced and Biopsy-confirmed Mouse Model of NASH Yun-Jung Choi, Jiangao Song, Jeff D. Johnson,
More informationInflammation & Type 2 Diabetes Prof. Marc Y. Donath
Inflammation & Type 2 Diabetes 1, MD Chief Endocrinology, Diabetes & Metabolism University Hospital Basel Petersgraben 4 CH-431 Basel, Switzerland MDonath@uhbs.ch Innate immunity as a sensor of metabolic
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationMetabolic Solutions Development Company, Kalamazoo, USA.
New Insulin Sensitizers Produce Differentiation of Brown-like Adipose Cells from a Subcutaneous Fat Depot and Increase Secretion of Adiponectin in vitro William G. McDonald, Serena L. Cole, Danielle D.
More informationCholesterol and Sphingolipids in Non-Alcoholic fatty liver disease.
Cholesterol and Sphingolipids in Non-Alcoholic fatty liver disease. José C. Fernández-Checa Liver Unit, Hospital Clinic CIBEK and IDIBAPS Instituto Investigaciones Biomédicas Barcelona Consejo Superior
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More information1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
More informationObesity as the common soil of non-alcoholic fatty liver disease and diabetes: Role of adipokines
Obesity as the common soil of non-alcoholic fatty liver disease and diabetes: Role of adipokines Elaine Hui 1, Aimin Xu 3,HongBoYang 2,KarenSLLam 1,3 * REVIEW ARTICLE ABSTRACT Non-alcoholic fatty liver
More informationLIPOCALIN 2 DEFICIENCY INFLUENCES TRANSFORMING GROWTH FACTOR-β EFFECT ON INFLAMMATION AND EXTRACELLULAR MATRIX REMODELING IN INGUINAL ADIPOCYTES
LIPOCALIN 2 DEFICIENCY INFLUENCES TRANSFORMING GROWTH FACTOR-β EFFECT ON INFLAMMATION AND EXTRACELLULAR MATRIX REMODELING IN INGUINAL ADIPOCYTES A THESIS SUBMITTED TO THE FACULTY OF THE UNIVERSITY OF MINNESOTA
More informationHSN301 Diet and Disease Entire Note Summary
Topic 1: Metabolic Syndrome Learning Objectives: 1. Define obesity 2. Factors causing obesity 3. Obesity as a risk factor for metabolic syndrome 4. The pathogenesis of metabolic syndrome 5. Treatment of
More informationSuccessful completion of Phase I clinical trial of AMPK activator O304
Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination
More informationMaster class Biomolecular Sciences Molecular Cell Biology.
Master class Biomolecular Sciences Molecular Cell Biology. 04-09-08: Paul van Bergen en Henegouwen. Clathrin-indep Endocytosis 11-09-08: Willem Stoorvogel. Endocytosis and MHC classii 18-09-08: X-track
More informationMetabolic defects underlying dyslipidemia in abdominal obesity
Metabolic defects underlying dyslipidemia in abdominal obesity Professor Marja-Riitta Taskinen Department of Medicine, Division of Cardiology Helsinki University Hospital, Finland Disclosures: Honorariums/
More informationMETABOLIC SYNDROME AND HCV: FROM HCV
METABOLIC SYNDROME AND HCV: FROM THEORY TO PRACTICE HCV Steatosis Insulin resistance Arun J Sanyal M.D. Chairman, Div. of Gastroenterology, Hepatology and Nutrition Virginia Commonwealth University Richmond,
More informationFOR REVIEW. BMB Reports - Manuscript Submission. Manuscript Draft. Manuscript Number: BMB
BMB Reports - Manuscript Submission Manuscript Draft Manuscript Number: BMB-18-095 Title: Insulin Receptor Substrate 2:A Bridge between Hippo and AKT Pathways Article Type: Perspective (Invited Only) Keywords:
More informationSupplementary Figure S1
Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao
More informationObesity, Metabolic Syndrome, and Diabetes: Making the Connections
Obesity, Metabolic Syndrome, and Diabetes: Making the Connections Alka M. Kanaya, M.D. Associate Professor of Medicine & Epi/Biostats University of California, San Francisco February 26, 21 Roadmap 1.
More informationGut microbiota, metabolic syndrome, obesity and the nutrient sensor pathways
Gut microbiota, metabolic syndrome, obesity and the nutrient sensor pathways Department of Gastroenterology, Endocrinology & Metabolism Medical University Innsbruck Herbert Tilg Nothing to disclose Fig.
More informationReviewer #1 (Remarks to the Author)
Reviewer #1 (Remarks to the Author) The authors provide an interesting data set concerning the effects of an ATGL inhibitor on energy balance and indices of insulin action in mice fed a high fat diet.
More informationUp-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice
Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice Shen Yon Toh 1,2,3., Jingyi Gong 2., Guoli Du 2., John
More informationChanges in Cardiotrophin-1 and Fibroblast Growth Factor-21 with Weight Loss. Robert Lawrence Bowers
Changes in Cardiotrophin-1 and Fibroblast Growth Factor-21 with Weight Loss by Robert Lawrence Bowers A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the
More informationa b c Physical appearance of mice Lean mass Adipocyte size d e f
LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte
More informationAltered Mouse Adipose Tissue IGF-1 Expression Influences Glucose Control
Altered Mouse Adipose Tissue IGF-1 Expression Influences Glucose Control Jan Trost Prof. Gudrun A. Brockmann Humboldt Universität zu Berlin Department of Crop and Animal Sciences Breeding Biology and Molecular
More informationE3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination
E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationThe Metabolic Syndrome Update The Metabolic Syndrome Update. Global Cardiometabolic Risk
The Metabolic Syndrome Update 2018 Marc Cornier, M.D. Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine
More informationUNDERSTANDING THE REGULATION OF ADIPOGENESIS AND ADIPOCYTE METABOLISM IN OBESITY
UNDERSTANDING THE REGULATION OF ADIPOGENESIS AND ADIPOCYTE METABOLISM IN OBESITY A DISSERTATION SUBMITTED TO THE FACULTY OF THE UNIVERSITY OF MINNESOTA BY MING ZHAO IN PARTIAL FULFILLMENT OF THE REQUIREMENTS
More informationJaemin Lee, Ph.D. Department of New Biology Daegu Gyeongbuk Institute of Science and Technology (DGIST)
Jaemin Lee, Ph.D. Department of New Biology Daegu Gyeongbuk Institute of Science and Technology (DGIST) No Actual or Potential Conflict of Interest https://www.flickr.com/photos/luchoedu/2453267732/ 1985
More informationCentral injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
More informationGene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
More informationActivation of Bile Acid Signaling Shapes the Gut Microbiota to Improve Diabetes and Fatty Liver Disease
Activation of Bile Acid Signaling Shapes the Gut Microbiota to Improve Diabetes and Fatty Liver Disease John Chiang, Ph.D. Northeast Ohio Medical University Rootstown, OH, USA International Conference
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationGlucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism
Glucose Introduction to Hormonal Regulation of Fuel Metabolism Fasting level 3.5-5 mmol (1 mmol = 18 mg/dl) Postprandial 6-10 mmol Amount of glucose in circulation is dependent on: Absorption from the
More informationLipids Carbohydrate Protein. Fatty Acids Glycerol. Mono/di-saccarides. Aminoacids. Fat Liver Muscle. Triglycerides Glycogen Protein
Lipids Carbohydrate Protein Fatty Acids Glycerol Mono/di-saccarides Fat Liver Muscle Aminoacids Triglycerides Glycogen Protein Microvascular Macrovascular Diabetes-specific Diabetes-enhanced HbA1c 5.7(6.0)
More informationEffect of High-fat or High-glucose Diet on Obesity and Visceral Adipose Tissue in Mice
ACTA ACADEMIAE MEDICINAE SINICAE 410011 0731-85295846 lixia2014@vip. 163. com 4 C57BL /6 20-1 mrna 20 P < 0. 05 O 20 P > 0. 05 M2 P < 0. 05-1 mrna P < 0. 05 P > 0. 05 R589. 2 DOI 10. 3881 /j. issn. 1000-503X.
More informationWEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH
MENOPAUSE WHEN DOES IT OCCUR? The cessation of the menstrual cycle for one year. WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH Jan Schroeder, Ph.D. Chair of The Department of Kinesiology California State
More informationSupporting Information
Supporting Information Charalambous et al. 10.1073/pnas.1406119111 SI Experimental Procedures Serum and Tissue Biochemistry. Enzymatic assay kits were used for determination of plasma FFAs (Roche), TAGs
More informationSupplementary Figures
Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,
More information* Author to whom correspondence should be addressed; Tel.: ; Fax:
Int. J. Mol. Sci. 2014, 15, 6184-6223; doi:10.3390/ijms15046184 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Obesity and Its Metabolic Complications:
More informationRoadmap. Diabetes and the Metabolic Syndrome in the Asian Population. Asian. subgroups 8.9. in U.S. (% of total
Diabetes and the Metabolic Syndrome in the Asian Population Alka Kanaya, MD Associate Professor of Medicine, UCSF Feb 26, 2010 Roadmap 1. Diabetes in Asian Americans Prevalence in the U.S. Risk factors
More informationUniversity of Groningen. Adipose tissue Nies, Vera
University of Groningen Adipose tissue Nies, Vera IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.
More informationTargeting Inflammation in Breast Cancer Pathogenesis
Targeting Inflammation in Breast Cancer Pathogenesis Clifford Hudis, M.D. Chief, Breast Cancer Medicine Service Attending Physician, MSKCC Professor of Medicine, Weill Cornell Medical College August 7,
More informationHormonal regulation of. Physiology Department Medical School, University of Sumatera Utara
Hormonal regulation of nutrient metabolism Physiology Department Medical School, University of Sumatera Utara Homeostasis & Controls Successful compensation Homeostasis reestablished Failure to compensate
More information