Jaemin Lee, Ph.D. Department of New Biology Daegu Gyeongbuk Institute of Science and Technology (DGIST)
|
|
- Iris Hubbard
- 6 years ago
- Views:
Transcription
1 Jaemin Lee, Ph.D. Department of New Biology Daegu Gyeongbuk Institute of Science and Technology (DGIST)
2 No Actual or Potential Conflict of Interest
3
4 1985 No Data <10% 10%-14% (*BMI 30, or ~ 30 lbs. overweight for 5 4 person)
5 1986 No Data <10% 10%-14% (*BMI 30, or ~ 30 lbs. overweight for 5 4 person)
6 1987 No Data <10% 10%-14% (*BMI 30, or ~ 30 lbs. overweight for 5 4 person)
7 1988 No Data <10% 10%-14% (*BMI 30, or ~ 30 lbs. overweight for 5 4 person)
8 1989 No Data <10% 10%-14% (*BMI 30, or ~ 30 lbs. overweight for 5 4 person)
9 1990 No Data <10% 10%-14% (*BMI 30, or ~ 30 lbs. overweight for 5 4 person)
10 1991 No Data <10% 10%-14% 15%-19% (*BMI 30, or ~ 30 lbs. overweight for 5 4 person)
11 1992 No Data <10% 10%-14% 15%-19% (*BMI 30, or ~ 30 lbs. overweight for 5 4 person)
12 1993 No Data <10% 10%-14% 15%-19% (*BMI 30, or ~ 30 lbs. overweight for 5 4 person)
13 1994 No Data <10% 10%-14% 15%-19% (*BMI 30, or ~ 30 lbs. overweight for 5 4 person)
14 1995 No Data <10% 10%-14% 15%-19% (*BMI 30, or ~ 30 lbs. overweight for 5 4 person)
15 1996 No Data <10% 10%-14% 15%-19% (*BMI 30, or ~ 30 lbs. overweight for 5 4 person)
16 1997 No Data <10% 10%-14% 15%-19% 20%-24% (*BMI 30, or ~ 30 lbs. overweight for 5 4 person)
17 1998 No Data <10% 10%-14% 15%-19% 20%-24% (*BMI 30, or ~ 30 lbs. overweight for 5 4 person)
18 1999 No Data <10% 10%-14% 15%-19% 20%-24% (*BMI 30, or ~ 30 lbs. overweight for 5 4 person)
19 2000 No Data <10% 10%-14% 15%-19% 20%-24% (*BMI 30, or ~ 30 lbs. overweight for 5 4 person)
20 2001 No Data <10% 10%-14% 15%-19% 20%-24% 25%-29% (*BMI 30, or ~ 30 lbs. overweight for 5 4 person)
21 2002 No Data <10% 10%-14% 15%-19% 20%-24% 25%-29% (*BMI 30, or ~ 30 lbs. overweight for 5 4 person)
22 2003 No Data <10% 10%-14% 15%-19% 20%-24% 25%-29% (*BMI 30, or ~ 30 lbs. overweight for 5 4 person)
23 2004 No Data <10% 10%-14% 15%-19% 20%-24% 25%-29% (*BMI 30, or ~ 30 lbs. overweight for 5 4 person)
24 2005 (*BMI 30, or ~ 30 lbs. overweight for 5 4 person) No Data <10% 10%-14% 15%-19% 20%-24% 25%-29% 30%
25 2006 (*BMI 30, or ~ 30 lbs. overweight for 5 4 person) No Data <10% 10%-14% 15%-19% 20%-24% 25%-29% 30%
26 2007 (*BMI 30, or ~ 30 lbs. overweight for 5 4 person) No Data <10% 10%-14% 15%-19% 20%-24% 25%-29% 30%
27 2008 (*BMI 30, or ~ 30 lbs. overweight for 5 4 person) No Data <10% 10%-14% 15%-19% 20%-24% 25%-29% 30%
28 2009 (*BMI 30, or ~ 30 lbs. overweight for 5 4 person) No Data <10% 10%-14% 15%-19% 20%-24% 25%-29% 30%
29 2010 In the US, 69% of adult population are overweight and 36% are obese (2010) (*BMI 30, or ~ 30 lbs. overweight for 5 4 person) No Data <10% 10%-14% 15%-19% 20%-24% 25%-29% 30%
30 - Worldwide obesity has increased more than double since In 2014, 18% of adults are obese (600 million) and 39% are overweight. WHO, Business Insider
31 KSSO In Korea, 31.8% of adults obese (BMI 25) and 53.9% overweight (BMI 23) (2013)
32 Diabetes (T2DM) Cancer Hypertension Overweight Obesity Infertility Cardiovascular Diseases Dyslipidemia Modified from Maric-Bilkan (2013), Bonora and Targher (2012) and WHO (2014)
33
34 Healthy Food intake Energy expenditure Modified from Friedman Nat Med
35 Obese/ Leptin resistant Food intake Energy expenditure Modified from Friedman Nat Med
36 Zhang et al. Trends in Pharmacological Sciences (2015)
37 Morris and Rui. American Journal of Physiology - Endocrinology and Metabolism (2009)
38 Obesity, T2DM ER Stress Unfolded proteins
39 ER Stress Unfolded Protein Response (UPR)
40 Unfolded Protein ATF-6 Normal Protein Folding Perk Folded Protein BAX GRP78 Ire-1 BAK Ire-1 ATF-6 Perk BAX BAK ER To Golgi or Final Destination
41 Unfolded Protein ATF-6 ER Stress Perk Unfolded Protein BAX Ire-1 BAK GRP78 ATF-6 ERAD Perk P P P P P P BAX P P P Ire-1 BAK Proteosome-mediated degradation Migration to golgi Proteolytic cleavage by SP1 and SP2 eif2b eif2 eif2 5` 5` XBP-1(unspliced) 3` 3` XBP-1(spliced) NF- B activation TRAF2 ASK1 Active transcription factor (NH 2 terminal) ATF-4 translation Global Translation XBP-1(s) JNK activation ERSE-UPRE XBP-1 Chaperones UPRE-ERSE Chaperones ERAD components ER proliferation Increased ER folding capacity Increased ER folding capacity
42 Hypothalamus Ozcan et al Cell Metabolism
43 Veh 4-PBA Hypothalamus Leptin Leptin Ozcan et al Cell Metabolism Chemical chaperone (4-PBA) treatment restores leptin sensitivity
44 Pharmacological ways - CNS-acting drugs effective, many side effects Phentermine, Lorcaserin (available), many others are withdrawn - Peripherally acting drug Orlistat only drug for long-term treatment, less effective Surgical ways - Bariatric surgeries (so far the most effective, but very intrusive) There is no leptin sensitizing agent as therapeutics
45 Connectivity Map (CMAP) - Gene expression profiles from chemical treatment Lamb et al Science - Providing a list of chemicals with similar or reverse gene expression pattern with query
46 PBA WT Liver Gene Expression PBA ob/ob Liver Gene Expression Overexpressed XBP1s ob/ob Liver Gene Expression Lean and Obese Hypothalamic Gene Expression PBA and TUDCA induced Hypothalamic Gene Expression Selection of top and bottom genes Selection of top and bottom genes CMAP CMAP Liver Absolute Product Score Hypothalamic Absolute Product Score Candidate Selection Candidate Selection Liu, Lee et al Cell
47 COOH Thunder god vine ( 미역줄나무 / 뇌공등 / 雷公藤 ) O H HO Celastrol
48 Food Intake (g/mouse) 50 Diet-induced obese mice 2.5 Body Weight (g) Vehicle Celastrol *** *** Days 0 Vehicle Celastrol Liu, Lee et al Cell Celastrol reduces body weight and food intake of diet-induced obese mice
49 Lean Mass (g) NS Fat (%) *** 0 Vehicle Celastrol 0 Vehicle Celastrol Liu, Lee et al Cell Celastrol reduces only fat, not lean mass
50 Body Weight (g) Vehicle Celastrol Food Intake (g/mouse) NS Days 0 Vehicle Celastrol Liu, Lee et al Cell Celastrol has no effect on body weight and food intake of leptin sensitive lean mice
51 db/db mice ob/ob mice 55 Vehicle Celastrol 55 Body Weight (g) Body Weight (g) Vehicle Celastrol Days Days 24 Liu, Lee et al Cell Celastrol does not reduce body weight in leptin signaling deficient mice (db/db and ob/ob)
52 Vehicle Celastrol Leptin pstat3 Tyr705 Stat3 Actin Liu, Lee et al Cell
53 p-stat3 staining on the hypothalamic samples DMH DMH DMH 3V 3V Veh + Sal Veh+Lep DMH DMH 3V 3V Cel + Sal Cel + Lep TCN in DMH (%) TFI in DMH (%) Veh + Sal Veh + Sal *** ** Veh + Lep Veh + Lep *** *** ** Cel + Sal Cel + Sal * Cel + Lep Cel + Lep Lee et al Nat. Med.
54 p-stat3 staining on the hypothalamic samples VMH VMH VMH Veh + Sal Veh + Lep VMH VMH Cel + Sal Cel + Lep TFI in VMH (%) TCN in VMH (%) Veh + Sal Veh + Sal * Veh + Lep Veh + Lep *** * ** Cel + Sal Cel + Sal Cel + Lep Cel + Lep Lee et al Nat. Med.
55 p-stat3 staining on the hypothalamic samples ARC Veh + Sal Cel + Sal ARC ARC 3V 3V 3V 3V ARC ARC Veh + Lep Cel + Lep TCN in ARC (%) TFI in ARC (%) 250 ** Veh + Sal Veh + Sal ** * Veh + Lep Veh + Lep * Cel + Sal Cel + Sal Cel + Lep Cel + Lep Lee et al Nat. Med.
56 Vehicle Celastrol p-perk PERK Liu, Lee et al Cell Celastrol reduces ER stress in the hypothalamus of obese mice
57 Liver Vehicle Celastrol Lean/ Chow Obese/ HFD Liu, Lee et al Cell Celastrol ameliorates obesity-associated metabolic disorders
58 CMAP Celastrol microarray data Signature selection Connectivity map Enrichment score Hypothalamus gene expression Absolute enrichment score Celastrol Withaferin A O OH O ,000 1,500 Individual drugs H H H H H O O OH Lee et al Nat. Med. In vivo trials
59 Absolute enrichment score Celastrol Withaferin A O OH O ,000 1,500 Individual drugs H H H H H O Lee et al Nat. Med. O OH
60 Body weight (g) Vehicle Withaferin A *** Time (d) Food intake (g) Vehicle *** Withaferin A Lee et al Nat. Med.
61 Lean mass (g) Fat (%) *** 0 Vehicle Withaferin A 0 Vehicle Withaferin A Lee et al Nat. Med.
62 Body weight (g) Vehicle Withaferin A n.s. Food intake (g) Time (d) Vehicle Withaferin A Lee et al Nat. Med.
63 50 db/db mice 60 ob/ob mice Body weight (g) Vehicle Withaferin A Time (d) n.s. Body weight (g) Vehicle Withaferin A Time (d) n.s. Lee et al Nat. Med.
64 *** 2.0 Vehicle Withaferin A p-perk PERK p-perk Thr980 /PERK Vehicle Withaferin A Lee et al Nat. Med.
65 Reversing leptin resistance by reducing hypothalamic ER stress can be promising therapeutics Celastrol and Withaferin A are strong leptin sensitizer and reverse leptin resistance in obese mice CMAP is a powerful tool to discover new drugs
66 Lee and Ozcan JBC
67
68
a Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
More informationA Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationLeptin Intro/Signaling. ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph
Leptin Intro/Signaling ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph Overview Intro to Leptin Definition & Sources Physiology Bound vs. Free Receptors Signaling JAK/STAT MAPK PI3K ACC Experimental findings
More informationOxidative Stress and Diabetic Complications Epigenetics: Mechanisms and Implications for Diabetic Complications
This Review is part of a thematic series on Cardiovascular Complications of Diabetes and Obesity, which includes the following articles: The Impact of Macrophage Insulin Resistance on Advanced Atherosclerotic
More informationBIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
More information1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8
Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory
More informationPeter Walter, UCSF IRE1 Signaling Affects Cell Fate during the Unfolded Protein Response
Peter Walter, UCSF IRE1 Signaling Affects Cell Fate during the Unfolded Protein Response Jenn Hou Burke Group Literature Seminar November 19 th 2016 Protein Synthesis Pathway 4. Final Destination: proteins
More informationHigh Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22
Supplementary Information High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22 Max Gulhane 1, Lydia Murray 1, Rohan Lourie 1, Hui Tong 1, Yong H. Sheng 1, Ran
More informationMetabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
More informationAntibodies for Unfolded Protein Response
Novus-lu-2945 Antibodies for Unfolded rotein Response Unfolded roteins ER lumen GR78 IRE-1 GR78 ERK Cytosol GR78 TRAF2 ASK1 JNK Activator Intron RIDD elf2α Degraded mrna XB1 mrna Translation XB1-S (p50)
More informationInsulin-Leptin Interactions
Insulin-Leptin Interactions Ahmed S., Al-Azzam N., Cao B. Karshaleva B., Sriram S., Vu K. If you understand a system, you can predict it. Agenda - Energy homeostasis Overview of leptin and insulin Signaling
More informationER Stress in Retinal Degeneration in S334ter Rho Rats
ER Stress in Retinal Degeneration in S334ter Rho Rats Vishal M. Shinde 1., Olga S. Sizova 1., Jonathan H. Lin 2, Matthew M. LaVail 3, Marina S. Gorbatyuk 1 * 1 Department of Cell Biology and Anatomy, University
More informationMechanisms of Cell Injury: Loss of Calcium Homeostasis
Mechanisms of Cell Injury: Loss of Calcium Homeostasis SCPA610: Cellular Pathology Amornrat N. Jensen, Ph.D. amornrat.nar@mahidol.ac.th Leading questions Why is intracellular calcium important for the
More informationSupplemental Material:
Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection
More informationGene expression in insulin resistance
Gene expression in insulin resistance Name: Jules Jacobs Date: 4-7-2017 Supervisors: - Mirella Kalafati MSc - Dr. Lars Eijssen Department of Bioinformatics BACKGROUND Obesity Defined as: BMI > 30 kg/m
More informationWhat we know about energy balance
What we know about energy balance New understanding on how and why we gain and lose weight Presented by A/Professor Amanda Salis The Boden Institute of Obesity, Nutrition, Exercise & Eating Disorders The
More informationIntracellular signalling pathways activated by leptin by Gema FRUHBECK. Presentation by Amnesiacs Anonymous
Intracellular signalling pathways activated by leptin by Gema FRUHBECK Presentation by Amnesiacs Anonymous Introduction to Leptin By Ahrial Young Why is Leptin important? Pleiotropic = it controls the
More informationHepatitis C Virus and Cytokine Responses
Hepatitis C Virus and Cytokine Responses Eui-Cheol Shin, M.D., Ph.D. Laboratory of Immunology & Infectious Diseases (LIID), Graduate School of Medical Science & Engineering (GSMSE), KAIST Daejeon, Korea
More informationWhy Obese People are Unable to Keep Weight Off After Losing It
Why Obese People are Unable to Keep Weight Off After Losing It Robert E. Ratner, MD Chief Scientific and Medical Officer American Diabetes Association I have no Pertinent Financial Disclosures Change in
More informationMetabolic Programming. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD
Metabolic Programming Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD nutritional stress/stimuli organogenesis of target tissues early period critical window consequence of stress/stimuli are
More informationSupplementary Information
Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,
More information10/10/2015. Disclosure. Fatty Liver Disease Significance in Children
Mixed Lineage Kinase 3 Mediates Release of C-X-C Motif Ligand 10-earing Extracellular Vesicles from lipotoxic hepatocytes 10/10/2015 Samar H. Ibrahim, Petra Hirsova, Steven F. ronk, Nathan W. Werneburg,
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More information(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),
Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells
More informationSupplementary Information for
Supplementary Information for Anticipatory Estrogen Activation of the Unfolded Protein Response is Linked to Cell Proliferation and Poor Survival in Estrogen Receptor Positive Breast Cancer Neal Andruska
More informationInteractions between bone and the central nervous system Florent Elefteriou, PhD
Interactions between bone and the central nervous system Florent Elefteriou, PhD Department of Medicine Center for Bone Biology VANDERBILT UNIVERSITY Nashville, USA BONE REMODELING Bone marrow cells Estrogen
More informationUniversity of Dundee. DOI: /s Publication date: Document Version Publisher's PDF, also known as Version of record
University of Dundee Bace1-dependent amyloid processing regulates hypothalamic leptin sensitivity in obese mice Meakin, Paul J.; Jalicy, Susan M. ; Montagut, Gemma; Allsop, David J. P.; Cavellini, Daniella
More informationIngestive Behaviors 21. Introduction. Page 1. control and story lines. (a review of general endocrinology) Integration (or the basic reflex arc model)
Ingestive Behaviors 21 (a review of general endocrinology) A neuroendocrine system: components, a reflex arc, the endocrine system, the AN, endocrine / nervous systems as afferents and efferents, the theoretical
More informationWEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH
MENOPAUSE WHEN DOES IT OCCUR? The cessation of the menstrual cycle for one year. WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH Jan Schroeder, Ph.D. Chair of The Department of Kinesiology California State
More informationSupplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress
Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationSH2B1 Regulates Insulin Sensitivity and Glucose Homeostasis by Multiple Mechanisms. David L. Morris
SH2B1 Regulates Insulin Sensitivity and Glucose Homeostasis by Multiple Mechanisms by David L. Morris A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy
More informationLeptin: Amenorrhea, Reproduction, Anorexia. Hazel Leung, Ahrad Nathan, Seja Saddy, Judy Tang
Leptin: Amenorrhea, Reproduction, Anorexia Hazel Leung, Ahrad Nathan, Seja Saddy, Judy Tang Introduction: What is leptin? Adipocyte-derived hormone (WAT) Receptor roles Class I cytokine receptor superfamily
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationEffects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland
More informationInflammation & Type 2 Diabetes Prof. Marc Y. Donath
Inflammation & Type 2 Diabetes 1, MD Chief Endocrinology, Diabetes & Metabolism University Hospital Basel Petersgraben 4 CH-431 Basel, Switzerland MDonath@uhbs.ch Innate immunity as a sensor of metabolic
More informationSex Differences in Central Expression and Effects of Brain-Derived Neurotrophic Factor
Sex Differences in Central Expression and Effects of Brain-Derived Neurotrophic Factor Haifei Shi Department of Biology, Miami University International Conference on Endocrinology October 22, 14 Arcuate
More informationReview Article Endoplasmic Reticulum Stress: Its Role in Disease and Novel Prospects for Therapy
Hindawi Publishing Corporation Scienti ca Volume 2012, Article ID 857516, 26 pages http://dx.doi.org/10.6064/2012/857516 Review Article Endoplasmic Reticulum Stress: Its Role in Disease and Novel Prospects
More informationTHE ROLE OF INSULIN RECEPTOR SIGNALING IN THE BRAIN. COGS 163 By: Pranav Singh Alexandra Villar
THE ROLE OF INSULIN RECEPTOR SIGNALING IN THE BRAIN COGS 163 By: Pranav Singh Alexandra Villar INTRODUCTION Insulin is a hormone produced in the pancreas by the islets of Langerhans that regulates the
More informationInfertility Treatment in Polycystic Ovary Syndrome: Lifestyle Interventions, Medications and Surgery
Macut D, Pfeifer M, Yildiz BO, Diamanti-Kandarakis E (eds): Polycystic Ovary Syndrome. Novel Insights into Causes Infertility Treatment in Polycystic Ovary Syndrome: Lifestyle Interventions, Medications
More informationLack of Association between Endoplasmic Reticulum Stress Response Genes and Suicidal Victims
Kobe J. Med. Sci., Vol. 53, No. 4, pp. 151-155, 2007 Lack of Association between Endoplasmic Reticulum Stress Response Genes and Suicidal Victims KAORU SAKURAI 1, NAOKI NISHIGUCHI 2, OSAMU SHIRAKAWA 2,
More informationperk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
More informationDiabesity. Metabolic dysfunction that ranges from mild blood glucose imbalance to full fledged Type 2 DM Signs
Diabesity Metabolic dysfunction that ranges from mild blood glucose imbalance to full fledged Type 2 DM Signs Abdominal obesity Low HDL, high LDL, and high triglycerides HTN High blood glucose (F>100l,
More informationCentral injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
More informationFGF21 Resistance in Adipose Tissues as a Cause of Insulin Resistance
Resistance in Adipose Tissues as a Cause of Insulin Resistance The ICDM 213 & 5 th AASD Scientific Meeting Seoul, Korea, Nov 8, 213 Aimin Xu Dept of Medicine & Dept of Pharmacology and Pharmacy The University
More informationIngestive Behaviors 33. Introduction. Page 1. control and story lines. (a review of general endocrinology) Integration (or the basic reflex arc model)
Ingestive Behaviors 33 (a review of general endocrinology) A neuroendocrine system: components, a reflex arc, the endocrine system, the AN, endocrine / nervous systems as afferents and efferents, the theoretical
More informationObesity Management in Patients with Diabetes Jamy D. Ard, MD Sunday, February 11, :15 a.m. 11:00 a.m.
Obesity Management in Patients with Diabetes Jamy D. Ard, MD Sunday, February 11, 2018 10:15 a.m. 11:00 a.m. Type 2 diabetes mellitus (T2DM) is closely associated with obesity, primarily through the link
More informationNeurophysiology and pharmacology of obesity
How your brain controls body weight Neurophysiology and pharmacology of obesity Michael Cowley Head of Department of Physiology ANZMOSS, September, 2018, Melbourne. Michael is a consultant to NovoNordisk
More informationOphthalmology, Radiation Oncology,
Supporting Online Material Journal: Nature Neuroscience Article Title: Corresponding Author: All Authors: Affiliations: Tanycytes of the Hypothalamic Median Eminence Form a Diet- Responsive Neurogenic
More informationSupplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with
More informationWhy Obesity Is A Chronic Disease
Why Obesity Is A Chronic Disease Arya M Sharma, MD, FRCP(C) Professor of Medicine Chair in Obesity Research & Management University of Alberta Edmonton, AB, Canada www.drsharma.ca Global Obesity Map 2014
More informationUniversity of California, San Diego La Jolla CA 92093
AD Award Number: W81XWH-11-1-0131 TITLE: Role of Inflammation and Insulin Resistance in Mouse Models of Breast Cancer PRINCIPAL INVESTIGATOR: Jerrold Olefsky, M.D. CONTRACTING ORGANIZATION: University
More informationInsulin demand regulates β cell number via the unfolded protein response
The Journal of Clinical Investigation Insulin demand regulates β cell number via the unfolded protein response Rohit B. Sharma, 1 Amy C. O Donnell, 2 Rachel E. Stamateris, 1 Binh Ha, 1 Karen M. McCloskey,
More informationMechanisms Associated with Dietary Energy Balance Effects on Tumor Development: Alterations in Growth Factor and Energy Sensing Pathways
Mechanisms Associated with Dietary Energy Balance Effects on Tumor Development: Alterations in Growth Factor and Energy Sensing Pathways John DiGiovanni, Ph.D. Professor and Coulter R. Sublett Endowed
More informationExperimental Physiology
Exp Physiol 102.8 (2017) pp 869 884 869 Review Article (2017 Inaugural Review prize winner) Review Article (2017 Inaugural Review prize winner) Endoplasmic reticulum stress in the pathogenesis of hypertension
More informationOver-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,
SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells
More informationThe unfolded protein response is shaped by the NMD pathway
Manuscript EMBOR-2014-39696 The unfolded protein response is shaped by the NMD pathway Rachid Karam, Chih-Hong Lou, Heike Kroeger, Lulu Huang, Jonathan H. Lin and Miles F. Wilkinson Corresponding author:
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationMBB317. Dr D MANGNALL OBESITY. Lecture 2
MBB317 Dr D MANGNALL OBESITY Lecture 2 When the structure of the insulin receptor was first discovered it was assumed that the active beta subunit tyrosine kinase would phosphorylate some intracellular
More informationRegulation of Lipid Homeostasis: Lipid Droplets
Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSupplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
More informationSupplementary Figure 1 a
Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans
More informationManagement of Obesity. Objectives. Background Impact and scope of Obesity. Control of Energy Homeostasis Methods of treatment Medications.
Medical Management of Obesity Ben O Donnell, MD 1 Objectives Background Impact and scope of Obesity Control of Energy Homeostasis Methods of treatment Medications 2 O'Donnell 1 Impact of Obesity According
More informationT he endoplasmic reticulum (ER) is highly sensitive to the microenvironment and alters its functional capacity
OPEN SUBJECT AREAS: MECHANISMS OF DISEASE ENDOPLASMIC RETICULUM Received 16 December 2013 Accepted 21 January 2014 Published 11 February 2014 Correspondence and requests for materials should be addressed
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationInflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra
Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue Rinke Stienstra Obesity promotes the development of insulin resistance and type 2 diabetes County-level Estimates
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationAmylinergic control of food intake in lean and obese rodents
Zurich Open Repository and Archive University of Zurich Main Library Winterthurerstr. 190 CH-8057 Zurich www.zora.uzh.ch Year: 2011 Amylinergic control of food intake in lean and obese rodents Boyle, C
More informationA Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis NTD Number of embryos % among NTD Embryos Exencephaly 52 74.3% Craniorachischisis 6 8.6% Spina bifida 5 7.1% Microcephaly 7 1% B Normal
More informationCell Quality Control. Peter Takizawa Department of Cell Biology
Cell Quality Control Peter Takizawa Department of Cell Biology Cellular quality control reduces production of defective proteins. Cells have many quality control systems to ensure that cell does not build
More informationTHE PERENNIAL STRUGGLE TO LOSE WEIGHT AND MAINTAIN: WHY IS IT SO DIFFICULT?
THE PERENNIAL STRUGGLE TO LOSE WEIGHT AND MAINTAIN: WHY IS IT SO DIFFICULT? Robert Ferraro, MD Medical Director Southwest Endocrinology Associates, PA Diabetes and Weight Management Center OBESITY The
More informationBody Mass Index Chart = overweight; = obese; >40= extreme obesity
Pathophysiology of type 2 diabetes mellitus R. Leibel Naomi Berrie Diabetes Center 25 February 2008 Body Mass Index Chart 25-29.9 = overweight; 30-39.9= obese; >40= extreme obesity 5'0" 5'2" Weight (lbs)
More informationThe unfolded protein response: controlling cell fate decisions under ER stress and beyond
The unfolded protein response: controlling cell fate decisions under ER stress and beyond Claudio Hetz 1 3 Abstract Protein-folding stress at the endoplasmic reticulum (ER) is a salient feature of specialized
More information4/3/2015. Obesity in Childhood Cancer Survivors: Opportunities for Early Intervention. Cancer in Children. Cancer is the #1 cause of diseaserelated
Obesity in Childhood Cancer Survivors: Opportunities for Early Intervention Fang Fang Zhang, MD, PhD Friedman School of Nutrition Science and Policy, Tufts University UNTHSC Grant Rounds April 8, 2015
More informationBi156 lecture 2, 1/6/12. Eating and weight regulation
Bi156 lecture 2, 1/6/12 Eating and weight regulation Introduction: weight regulation in an affluent society In our society much effort and money is expended on regulation of weight. Failure to maintain
More informationOverall Implementation Strategy/Focus:
Worksheet 1. IMPLEMENTATION STRATEGY Overall Implementation Strategy/Focus: RAND 1 Key Guideline Element 1. Routine primary care screening for overweight and obesity. Gaps in Current Practices (Planning
More informationAdipocyte Stress: The Endoplasmic Reticulum and Metabolic Disease. Margaret F. Gregor and Gökhan S. Hotamisligil
Adipocyte Stress: The Endoplasmic Reticulum and Metabolic Disease Margaret F. Gregor and Gökhan S. Hotamisligil Department of Genetics and Complex Diseases, Harvard School of Public Health Boston, MA,
More informationPeripubertal, leptin-deficient ob/ob female mice were used in an investigation of
ESSICK-BROOKSHIRE, ELIZABETH ANN, M.S. The Effects of Peripherally Administered 17-β Estradiol and BIBP3226, a NPY Y1 Receptor Antagonist, on Food Intake, Body Mass, Reproductive Development and Behavior
More informationDefective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance
Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil
More informationProject report October 2012 March 2013 CRF fellow: Principal Investigator: Project title:
Project report October 2012 March 2013 CRF fellow: Gennaro Napolitano Principal Investigator: Sergio Daniel Catz Project title: Small molecule regulators of vesicular trafficking to enhance lysosomal exocytosis
More informationContents Materials and Methods Figs. S1 and S8 References and Notes
Özcan et al., p. 1 Science Supporting Online Material Endoplasmic Reticulum Stress Links Obesity, Insulin ction, and Type 2 Diabetes Umut Özcan, Qiong Cao, Erkan Yilmaz, nn-hwee Lee, Neal N. Iwakoshi,
More informationLeptin and the Central Nervous System Control of Glucose Metabolism
Physiol Rev 91: 389 411, 2011; doi:10.1152/physrev.00007.2010. Leptin and the Central Nervous System Control of Glucose Metabolism GREGORY J. MORTON AND MICHAEL W. SCHWARTZ Diabetes and Obesity Center
More informationReceived 9 July 2009/Accepted 7 June 2010
JOURNAL OF VIROLOGY, Sept. 2010, p. 8446 8459 Vol. 84, No. 17 0022-538X/10/$12.00 doi:10.1128/jvi.01416-09 Copyright 2010, American Society for Microbiology. All Rights Reserved. Coxsackievirus B3 Infection
More informationAn Investigation of Mitochondrial Bioenergetics and the Turnover of Succinated Proteins in the Adipocyte during Diabetes
University of South Carolina Scholar Commons Theses and Dissertations 8-9-2014 An Investigation of Mitochondrial Bioenergetics and the Turnover of Succinated Proteins in the Adipocyte during Diabetes Ross
More informationExtracellular matrix Basic and translational science: Highlights of the congress
Extracellular matrix Basic and translational science: Highlights of the congress Stephane Heymans, Maastricht University Medical Centre, CARIM, Netherlands Speaker The extracellular matrix modulates cardiac
More informationBody Mass Index Chart = overweight; = obese; >40= extreme obesity
Pathophysiology of type 2 diabetes mellitus R. Leibel Naomi Berrie Diabetes Center 26 February 2007 Body Mass Index Chart 25-29.9 = overweight; 30-39.9= obese; >40= extreme obesity 5'0" 5'2" 5'4" Weight
More informationObesity in aging: Hormonal contribution
Obesity in aging: Hormonal contribution Hormonal issues in obesity and aging Hormonal role in regulation of energy balance Genetic component in hormonal regulation Life style contribution to hormonal changes
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationFH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle
A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF
More informationEndoplasmic Reticulum Stress and the Related Signaling Networks in Severe Asthma
Review Allergy Asthma Immunol Res. 2015 March;7(2):106-117. http://dx.doi.org/10.4168/aair.2015.7.2.106 pissn 2092-7355 eissn 2092-7363 Endoplasmic Reticulum Stress and the Related Signaling Networks in
More informationChronic Stimulation of Leptin on Food Intake and Body Weight after Microinjection into the Ventromedial Hypothalamus of Conscious Rats
TAJ December 2006; Volume 19 Number 2 ISSN 1019-8555 The Journal of Teachers Association RMC, Rajshahi Original Article Chronic Stimulation of Leptin on Food Intake and Body Weight after Micro into the
More informationLipogenic transcription factor ChREBP mediates fructose-induced metabolic adaptations to prevent hepatotoxicity
Lipogenic transcription factor ChREBP mediates fructose-induced metabolic adaptations to prevent hepatotoxicity Deqiang Zhang,, M. Bishr Omary, Lei Yin J Clin Invest. 2017;127(7):2855-2867. https://doi.org/10.1172/jci89934.
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP
More informationProtein sorting (endoplasmic reticulum) Dr. Diala Abu-Hsasan School of Medicine
Protein sorting (endoplasmic reticulum) Dr. Diala Abu-Hsasan School of Medicine dr.abuhassand@gmail.com An overview of cellular components Endoplasmic reticulum (ER) It is a network of membrane-enclosed
More informationPROTEIN EXPRESSION ANALYSIS OF INSULIN PRODUCING CELLS EXPOSED TO ENDOPLASMIC RETICULUM STRESS
DEPARTMENT OF CLINICAL SCIENCE AND EDUCATION, SÖDERSJUKHUSET Karolinska Institutet, Stockholm, Sweden PROTEIN EXPRESSION ANALYSIS OF INSULIN PRODUCING CELLS EXPOSED TO ENDOPLASMIC RETICULUM STRESS Victoria
More informationEndoplasmic Reticulum
Endoplasmic Reticulum What s ER? How is ER? Why is ER? definition description functions Nissl s bodies neurons Berg s bodies hepatocytes Organelle structure histocytochemical evidences Ergastoplasm pancreatic
More informationNature Medicine: doi: /nm.4078
Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios
More informationSmoking cessation and weight gain
Smoking cessation and weight gain David McFadden, MD, MPH Mayo Clinic Nicotine Dependence Center 2012 MFMER slide-1 Disclosures I presented lectures for Pfizer-sponsored tobacco treatment seminars in Brazil,
More information