Sex Differences in Central Expression and Effects of Brain-Derived Neurotrophic Factor
|
|
- Conrad Whitehead
- 5 years ago
- Views:
Transcription
1 Sex Differences in Central Expression and Effects of Brain-Derived Neurotrophic Factor Haifei Shi Department of Biology, Miami University International Conference on Endocrinology October 22, 14
2 Arcuate melanocortin system BDNF VMH + BDNF ARC Expenditure Intake 3V + POMC Lepr Leptin Xu, et al., Nat Neurosci 3 Komori, et al., Neuroscience 6 Wang, et al., AJP 7, 1
3 Transgenic mouse models BDNF conditional deficient mice Control Bdnf deficient Rios, et al., Mol Endocrinol 1
4 Estradiol regulates food intake VMH ARC Expenditure Intake 3V estradiol Asarian & Geary, Philos T Roy Soc B 6
5 BDNF in and the estrogen hypothalamus receptor alpha (ERα) in the hypothalamus BDNF ERα Arc VMH 1 µm 1 µm Xu, et al., Nat Neurosci 3 Shi Lab
6 Colocalization of ERα and BDNF in the VMH ER α: brown (DAB) BDNF: blue black (nickel-enhanced DAB) BDNF + ER α Shi Lab ERα: brown BDNF: blue Blurton-Jones, et al., J Comp Neurol 4
7 Potential regulation of BDNF by estradiol VMH BDNF ARC estrogen Expenditure Intake 3V POMC estradiol Leptin
8 Hypothesis: Central BDNF expression and action are regulated by estradiol. Q1: Is central BDNF expression regulated by estradiol? Q2: Is central BDNF action regulated by estradiol? VMH BDNF 3V ARC POMC estradiol Expenditure Intake Leptin
9 Hypothesis: Central BDNF expression and action are regulated by estradiol. Q1: Is central BDNF expression regulated by estradiol? Q2: Is central BDNF action regulated by estradiol? VMH BDNF Estradiol (E2; subcu) 3V ARC POMC Leptin estradiol Expenditure Intake Ovariectomy (OVX)
10 Q1: Is central BDNF expression regulated by estradiol? (1) Does ovariectomy (OVX) or estradiol (E2) replacement modulate VMH BDNF gene expression? Experiment groups Sham-Oil OVX-Oil ad lib OVX-Oil pairfeed (PF) (pairfeed to Sham-Oil) OVX-E2
11 Q1: Is central BDNF expression regulated by estradiol? (1) Does ovariectomy (OVX) or estradiol (E2) replacement modulate VMH BDNF gene expression? 3 Sham-Oil OVX-Oil OVX-Oil PF OVX-E Body weight (g) Plasma estradiol level (pg/ml) Sham-Oil OVX-Oil OVX-Oil PF OVX-E Days # Sham-Oil OVX-Oil OVX-E Days Food intake (g) Bdnf mrna level in VMH (% of Sham females) Sham-Oil OVX-Oil OVX-Oil PF OVX-E2 Zhu, Liu, et al., Horm Behav 14
12 Q1: Is central BDNF expression regulated by estradiol? (2) Do male and female rats have different BDNF expression? Does estrous cycle modulate VMH BDNF gene expression? Experiment groups (Ordered 1-week old male and female rats, sacrificed at 12-week of age) 25 Daily Food Intake Food Intake (g) Food intake (g) 1 Plasma estradiol level (pg/ml) Male Diestrus Proestrus Estrus Metestrus 1 Male D-P P-E E-M M-D 11 Diestrus Proestrus Estrus Metestrus Diestrus Dairy Body Weight Body weight (g) Male D-P P-E E-M M-D Body weight (g) Bdnf mrna level in VMH (% of male) Male Diestrus Proestrus Estrus Metestrus Diestrus Proestrus Estrus Metestrus Zhu, Liu, et al., Horm Behav 14; Liu, Zhu, et al., Physiol Behav 14
13 Summary 1 Q1: Is central BDNF expression regulated by estradiol? BDNF gene expression is regulated in an estradiol-sensitive manner. OVX decreases BDNF gene expression; reversed by estradiol replacement. Estrous female rats have greater BDNF expression than males. BDNF expression is dynamically regulated across estrous cycle with a temporal elevation at estrous phase.
14 Hypothesis: Central BDNF expression and action are regulated by estradiol. Q1: Is central BDNF expression regulated by estradiol? Q2: Is central BDNF action regulated by estradiol? VMH BDNF 3V Clegg, et al., Diabetes 6 de Souza, et al., Eur J Pharmacol 11 Gao, et al., Nat Med 7 ARC POMC Leptin estradiol Expenditure Intake
15 Q2: Is central BDNF action regulated by estradiol? (1) Is central BDNF s anorexic effect regulated by estradiol? Experiment groups Male-Oil Sham-Oil OVX-Oil ad lib OVX-Oil pairfeed (PF) (pairfeed to Sham-Oil Female) OVX-E2
16 Q2: Is central BDNF action regulated by estradiol? (1) Is central BDNF s anorexic effect regulated by estradiol? 6 4 Plasma Estradiol Levels Male Sham Female OVX-Oil Female OVX-Oil PF Female Baseline 24-Hour Food Intake Plasma E2 level (pg/ml) OVX-E2 Female Male Sham-Oil Female Sham-Oil OVX-Oil OVX-Oil PF OVX-E Baseline Body Weights Food Intake (g) Male Sham-Oil Female Sham-Oil OVX-Oil OVX-Oil PF OVX-E2 25 Body Weight (g) # Experiment procedure Light Dark Light Lights i3vt Lights out; 4-hour 24-hour On.1µg,.3µg food intake food intake BDNF or vehicle Zhu, Liu, et al., Horm Behav 14
17 Q2: Is central BDNF action regulated by estradiol? (1) Is central BDNF s anorexic effect regulated by estradiol? food intake (g) 4-hour 8 µg BDNF.1 µg BDNF 6.3 µg BDNF hour food intake (g) 24 µg BDNF 22.1 µg BDNF 18.3 µg BDNF Male Sham-Oil Female Sham-Oil Male Sham-Oil Female Sham-Oil Zhu, Liu, et al., Horm Behav 14
18 Q2: Is central BDNF action regulated by estradiol? (2) Does ovariectomy or estradiol replacement regulate BDNF s anorexic effect? 4-hour food int take (g) 6 µg BDNF.1 µg BDNF.3 µg BDNF 4 2 OVX-E2 OVX-Oil PF OVX-Oil 24-hour food in ntake (g) OVX-E2 OVX-Oil PF OVX-Oil µg BDNF.1 µg BDNF.3 µg BDNF Zhu, Liu, et al., Horm Behav 14
19 Q2: Is central BDNF action regulated by estradiol? (3) Is central BDNF s effect on energy expenditure different between males and females? Experiment procedure Light Dark Light Lights i3vt Lights out; 24-hour On.1µg energy expenditure BDNF or vehicle
20 12 Q2: Is central BDNF action regulated by estradiol? (3) Is central BDNF s effect on energy expenditure different between males and females? Male Rats VO2 ml/kg BW /min saline.1 µg BDNF Time (hour) VO2 ml/kg BW /min 4 saline.1 µg BDNF 3 1 Dark Light RQ 1. saline.1 µg BDNF Dark Light VO2 ml/kg BW /min saline.1 µg BDNF Time (hour) VO2 ml/kg BW /min Dark saline.1 µg BDNF Light RQ Dark Female Rats 1. saline.1 µg BDNF Light Liu, Zhu, Shen, Shi. Unpublished.
21 Summary 2 Q2: Is central BDNF s action regulated by estradiol? Estrous female rats respond to a lower dose of BDNF than male rats to reduce food intake. Estradiol-replaced OVX rats respond to a lower dose of BDNF than oil-injected OVX rats to reduce food intake. Central administration of a low dose (.1 µg) of BDNF increased energy expenditure in female but not male rats. Central administration of a low dose (.1 µg) of BDNF increased lipid oxidation during dark and light phases in females and only during light phase in males.
22 Conclusion Estradiol increases BDNF central expression and action. VMH BDNF ARC Expenditure Intake 3V POMC estradiol Leptin
23 Acknowledgement Graduate students: Zheng Zhu Xian Liu Minqian Shen Shiva Senthil-Kumar Funding: R15DK9823 Undergraduate students: Ashley Goudjo-Ako Sean Pugh Undergraduate research funding Summer research fellowship SDG4528
1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8
Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory
More informationHormonal gain control of a medial preoptic area social reward circuit
CORRECTION NOTICE Nat. Neurosci. 20, 449 458 (2017) Hormonal gain control of a medial preoptic area social reward circuit Jenna A McHenry, James M Otis, Mark A Rossi, J Elliott Robinson, Oksana Kosyk,
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationFukushima-ku, Osaka. Synopsis. and LH release by investigating the effects of exogenous estrogen on the progesteroneinduced
Further Studies on the Causal Relationship between the Secretion of Estrogen and the Release of Luteinizing Hormone in the Rat FUMIHIKO KOBAYASHI, KATSUMI HARA AND TAMOTSU MIYAKE Shionogi Research Laboratory,
More informationControl of energy metabolism on reproduction: a mechanism maintained during evolution
Control of energy metabolism on reproduction: a mechanism maintained during evolution Sara Della Torre Lab. A. Maggi Center of Excellence in Neurodegenerative Diseases (CEND) Department of Pharmacological
More informationPeripubertal, leptin-deficient ob/ob female mice were used in an investigation of
ESSICK-BROOKSHIRE, ELIZABETH ANN, M.S. The Effects of Peripherally Administered 17-β Estradiol and BIBP3226, a NPY Y1 Receptor Antagonist, on Food Intake, Body Mass, Reproductive Development and Behavior
More informationEstrogen receptor α- (ERα), but not ERβ-signaling, is crucially involved in mechanostimulation of bone fracture healing by whole-body vibration
Estrogen receptor α- (ERα), but not ERβ-signaling, is crucially involved in mechanostimulation of bone fracture healing by whole-body vibration Melanie Haffner-Luntzer et.al. published in BONE 1 Abstract
More informationMILLER, COLETTE N., M.S. Estradiol Reduces Inflammation in Rats Fed a High-fat Diet. (2010) Directed by Dr. Lynda M. Brown. 98 pp.
MILLER, COLETTE N., M.S. Estradiol Reduces Inflammation in Rats Fed a High-fat Diet. (2010) Directed by Dr. Lynda M. Brown. 98 pp. Previous research has shown that leptin and insulin resistance can occur
More informationInsights from Rare Obesity Disorders
Insights from Rare Obesity Disorders Ashley Shoemaker, MD, MSCI Ian M. Burr Division of Pediatric Endocrinology and Diabetes Disclosures Research funding: Zafgen, AstraZeneca, Rhythm Member, Zafgen Hypothalamic
More informationThe high incidence of obesity and its associated comorbidities
ENERGY BALANCE-OBESITY Leptin Resistance Is Not the Primary Cause of Weight Gain Associated With Reduced Sex Hormone Levels in Female Mice Regina P. da Silva,* Thais T. Zampieri,* João A.B. Pedroso, Vanessa
More informationPI3Ka inactivation in leptin receptor cells increases leptin sensitivity but disrupts growth and reproduction
PI3Ka inactivation in leptin receptor cells increases leptin sensitivity but disrupts growth and reproduction David Garcia-Galiano,, Jennifer W. Hill, Carol F. Elias JCI Insight. 2017;2(23):e96728.. Research
More informationHypothalamic Expression of Melanocortin-4 Receptor and Agouti-related Peptide mrnas During the Estrous Cycle of Rats
IJMCM Summer 2014, Vol 3, No 3 Original Article Hypothalamic Expression of Melanocortin-4 Receptor and Agouti-related Peptide mrnas During the Estrous Cycle of Rats Mohammad Reza Zandi 1, Mohammad Reza
More informationEffects of gonadal hormones on food intake and body weight in adult Mongolian gerbils.
University of Massachusetts Amherst ScholarWorks@UMass Amherst Masters Theses 1911 - February 2014 1977 Effects of gonadal hormones on food intake and body weight in adult Mongolian gerbils. Christie A.
More informationa Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
More informationRole of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4. glucose metabolism in mice.
Role of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4 Binding Protein neurons in the regulation of whole body energy and glucose metabolism in mice. Eulalia Coutinho Department of Physiological
More informationInteractions between bone and the central nervous system Florent Elefteriou, PhD
Interactions between bone and the central nervous system Florent Elefteriou, PhD Department of Medicine Center for Bone Biology VANDERBILT UNIVERSITY Nashville, USA BONE REMODELING Bone marrow cells Estrogen
More informationPI3K in the ventromedial hypothalamic nucleus mediates estrogenic actions on energy expenditure in female mice
PI3K in the ventromedial hypothalamic nucleus mediates estrogenic actions on energy expenditure in female mice The Harvard community has made this article openly available. Please share how this access
More informationEnergy Balance and Reproduction. BioScience in the 21st Century Candice M. Klingerman 03 October 2011
Energy Balance and Reproduction BioScience in the 21st Century Candice M. Klingerman 03 October 2011 Outline Energy balance Sex and food in conflict Sex and ingestive behavior Motivation is more sensitive
More informationInfluence of ovarian hormones on development of ingestive responding to alterations in fatty acid oxidation in female rats
Influence of ovarian hormones on development of ingestive responding to alterations in fatty acid oxidation in female rats Susan E Swithers, Melissa McCurley, Erica Hamilton, and Alicia Doerflinger Department
More informationKISSPEPTIN AND GNIH CONTROL OF GNRH IN FEMALE MAMMALS
KISSPEPTIN AND GNIH CONTROL OF GNRH IN FEMALE MAMMALS M.J. Zamiri Department of Animal Science, College of Agriculture, Shiraz University, Shiraz, Iran mjzamiri@gmail.com Introduction Since the discovery
More informationSupplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with
More informationFlorida State University Libraries
Florida State University Libraries Electronic Theses, Treatises and Dissertations The Graduate School 2003 Activity-Based Anorexia in Female Rats Deann Dixon Follow this and additional works at the FSU
More informationDose-dependent effects of 17-ßestradiol on pituitary thyrotropin content and secretion in vitro
Brazilian Journal of Medical and Biological Research (1997) 3: 1129-1134 Effect of estrogen on thyrotropin ISSN 1-879X 1129 Dose-dependent effects of 17-ßestradiol on pituitary thyrotropin content and
More informationFacilitation of Luteinizing Hormone Release by Progesterone in Proestrous Rats FUMIHIKO KOBAYASHI, KATSUMI HARA AND TAMOTSU MIYAKE
Facilitation of Luteinizing Hormone Release by Progesterone in Proestrous Rats FUMIHIKO KOBAYASHI, KATSUMI HARA AND TAMOTSU MIYAKE Shionogi Research Laboratory, Shionogi & Co., Ltd., Fukushima-ku, Osaka
More informationHypothalamic TLR2 triggers sickness behavior via a microglia-neuronal axis
Hypothalamic TLR triggers sickness behavior via a microglia-neuronal axis Sungho Jin, *, Jae Geun Kim,, *, Jeong Woo Park, Marco Koch,, Tamas L. Horvath and Byung Ju Lee Department of Biological Sciences,
More informationInsulin-Leptin Interactions
Insulin-Leptin Interactions Ahmed S., Al-Azzam N., Cao B. Karshaleva B., Sriram S., Vu K. If you understand a system, you can predict it. Agenda - Energy homeostasis Overview of leptin and insulin Signaling
More informationCarnitine and carnitine orotate affect the expression of the prolactin-releasing peptide gene
Carnitine and carnitine orotate affect the expression of the prolactin-releasing peptide gene H.S. Zhu, Y.Y. Wang, M.W. Lin, J.X. Du, L.Q. Hang, Y. Chen and L.F. Wang Key Lab of Regulation on Animal Growth
More informationEffect of the estrous cycle and surgical ovariectomy on energy balance, fuel utilization, and physical activity in lean and obese female rats
Am J Physiol Regul Integr Comp Physiol 299: R1634 R1642, 2010. First published October 6, 2010; doi:10.1152/ajpregu.00219.2010. Effect of the estrous cycle and surgical ovariectomy on energy balance, fuel
More informationFigure 1: The leptin/melanocortin pathway Neuronal populations propagate the signaling of various molecules (leptin, insulin, ghrelin) to control
Leptin Deficiency Introduction The leptin/melanocortin pathway plays a key role in the hypothalamic control of food intake. It is activated following the systemic release of the adipokine leptin (LEP)
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationOphthalmology, Radiation Oncology,
Supporting Online Material Journal: Nature Neuroscience Article Title: Corresponding Author: All Authors: Affiliations: Tanycytes of the Hypothalamic Median Eminence Form a Diet- Responsive Neurogenic
More informationJaemin Lee, Ph.D. Department of New Biology Daegu Gyeongbuk Institute of Science and Technology (DGIST)
Jaemin Lee, Ph.D. Department of New Biology Daegu Gyeongbuk Institute of Science and Technology (DGIST) No Actual or Potential Conflict of Interest https://www.flickr.com/photos/luchoedu/2453267732/ 1985
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 3,700 108,500 1.7 M Open access books available International authors and editors Downloads Our
More informationMASAZUMI KAWAKAMI, FUKUKO KIMURA AND TAKASHI HIGUCHI 2nd Department of Physiology, Yokohama City University School of Medicine, Yokohama
Effects of Electrical Stimulation of the Brain on Gonadotropin Secretion in Male Rats MASAZUMI KAWAKAMI, FUKUKO KIMURA AND TAKASHI HIGUCHI 2nd Department of Physiology, Yokohama City University School
More informationDEGREE (if applicable) State University of Paraiba, Brazil Bachelor 1993 Physical Therapist
BIOGRAPHICAL SKETCH NAME Jussara Marcia do Carmo era COMMONS USER NAME jdocarmo EDUCATION/TRAINING INSTITUTION AND LOCATION POSITION TITLE Associate Professor DEGREE (if applicable) YEAR(s) FIELD OF STUDY
More informationYiying Zhang, PhD Research Scientist. Research Summary:
Yiying Zhang, PhD Research Scientist Research Summary: Address: Naomi Berrie Diabetes Center at Columbia University Medical Center Russ Berrie Medical Science Pavilion 1150 St. Nicholas Avenue New York,
More informationBehavioral effects of endogenous or exogenous estradiol and progesterone on cocaine sensitization in female rats
Brazilian Journal of Medical and Biological Research (2014) 47(6): 505-514, http://dx.doi.org/10.1590/1414-431x20143627 ISSN 1414-431X Behavioral effects of endogenous or exogenous estradiol and progesterone
More informationEstrogen receptor α in medial amygdala neurons regulates body weight
The Journal of Clinical Investigation Research article Estrogen receptor α in medial amygdala neurons regulates body weight Pingwen Xu, 1 Xuehong Cao, 1 Yanlin He, 1 Liangru Zhu, 1,2 Yongjie Yang, 1 Kenji
More informationThe hypothalamus controls multiple physiological
RESEARCH ARTICLE JMJD3 Is Crucial for the Female AVPV RIP-Cre Neuron-Controlled Kisspeptin Estrogen Feedback Loop and Reproductive Function Anying Song, 1 Shujun Jiang, 1 Qinghua Wang, 1 Jianghuan Zou,
More informationPhysiological and Behavioral Sequelae Induced by a Predator- Based Psychosocial Stress Model of PTSD
Physiological and Behavioral Sequelae Induced by a Predator- Based Psychosocial Model of PTSD Phillip R. Zoladz, Ph.D. Ohio Northern University Predator-Based Psychosocial Model Daily Social 10 Days 21
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates
More informationThyroid hormone and estrogen interact to regulate behavior
Proc. Natl. Acad. Sci. USA Vol. 93, pp. 12581-12586, October 1996 Neurobiology Thyroid hormone and estrogen interact to regulate behavior (reproduction/hypothalamus/steroid receptors) TAMMY L. DELLOVADE*t,
More informationDEGREE (if applicable)
NAME: Jussara Marcia do Carmo OMB No. 0925-0001 and 0925-0002 (Rev. 09/17 Approved Through 03/31/2020) BIOGRAPHICAL SKETCH Provide the following information for the Senior/key personnel and other significant
More informationEffects of mild food deprivation on the estrous cycle of rats
Physiology & Behavior 73 (2001) 553 559 Effects of mild food deprivation on the estrous cycle of rats Jennifer Tropp, Etan J. Markus* Behavioral Neuroscience Division, Department of Psychology, University
More informationWEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH
MENOPAUSE WHEN DOES IT OCCUR? The cessation of the menstrual cycle for one year. WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH Jan Schroeder, Ph.D. Chair of The Department of Kinesiology California State
More informationMouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were
Supplemental Data Supplemental Materials and Methods Plasma measurements Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were determined using ELISA kits according
More informationBIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
More informationLeptin: A metabolic signal affecting central regulation of reproduction in the pig
Domestic Animal Endocrinology 29 (2005) 186 192 Leptin: A metabolic signal affecting central regulation of reproduction in the pig C.R. Barb a,, G.J. Hausman a, K. Czaja b a USDA/ARS, Animal Physiology
More informationNuclear Receptors. Estrogen and Thyroid Hormone Receptors and their Interaction. Estrogen Hormone Receptor.
SZENT ISTVÁN UNIVERSITY FACULTY OF VETERINARY MEDICINE Nuclear Receptors Estrogen and Thyroid Hormone Receptors and their Interaction Lior Kerner Budapest, 2012 What are Nuclear Receptors? o Proteins located
More informationSupplementary Figure 1
Supplementary Figure 1 Arcuate ChIEF-tdTomato neurons expressed TH These micrographs show that TH-Cre-ChIEF-tdTomato (magenta), expressed by AAV in a TH-Cre mouse, were immunostained with TH (green) in
More informationTanycytes as gatekeepers of the Metabolic Brain
Tanycytes as gatekeepers of the Metabolic Brain Vincent Prevot Inserm team Development and Plasticity of the Postnatal Brain Jean-Pierre Aubert Research Centre, U837, Lille France Metabolic signals and
More informationPAPER Estrogen receptor ß is involved in the anorectic action of estrogen
(2002) 26, 1103 1109 ß 2002 Nature Publishing Group All rights reserved 0307 0565/02 $25.00 www.nature.com/ijo PAPER Estrogen receptor ß is involved in the anorectic action of estrogen Y-Q Liang 1, M Akishita
More informationDepartment of Psychology, University of Michigan Dearborn, Michigan 48128
BEHAVIORAL BIOLOGY, 9, 605-612 (1973) Abstract No. 291 Effects of Intraventricular Norepinephrine and Estradiol Benzoate on Weight Regulatory Behavior in Female Rats JEFFREY J. STERN AND GARY ZWICK Department
More informationKisspeptin and other neuropeptides. New opportunities for reproductive endocrinology Nobel Laureates. Richard A Anderson
Kisspeptin and other neuropeptides Higher centres Timing of puberty Stress New opportunities for reproductive endocrinology E2 +ve E2 -ve Richard A Anderson Obstetrics and Gynaecology University of Edinburgh
More informationCrosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea
Crosstalk between Adiponectin and IGF-IR in breast cancer Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Obesity Chronic, multifactorial disorder Hypertrophy and hyperplasia
More informationBi156 lecture 2, 1/6/12. Eating and weight regulation
Bi156 lecture 2, 1/6/12 Eating and weight regulation Introduction: weight regulation in an affluent society In our society much effort and money is expended on regulation of weight. Failure to maintain
More informationStress and the female brain. The effects of estradiol on the neurobiological reactions to chronic stress. Gerrits, Marjolein
University of Groningen Stress and the female brain. The effects of estradiol on the neurobiological reactions to chronic stress. Gerrits, Marjolein IMPORTANT NOTE: You are advised to consult the publisher's
More informationMode of action (MoA) in toxicology: general concept
Toxicogenomics toxicology at a molecular level (mrna, mirna, proteins, metabolites ) Mode of action (MoA) in toxicology: general concept Chemical substance Key event 1 (Molecular initiating event) Key
More informationRegulation of serum leptin levels by gonadal function in rats
European Journal of Endocrinology (1999) 140 468 473 ISSN 0804-4643 Regulation of serum leptin levels by gonadal function in rats L Pinilla 1, L M Seoane 2, L Gonzalez 1, E Carro 2, E Aguilar 1, F F Casanueva
More informationCues that Elicit Ultrasounds from Adult Male Mice
AMER. ZOOL., 457-463 Cues that Elicit Ultrasounds from Adult Male Mice GLAYDE WHITNEY Department of Psychology Florida State University Tallahassee, Florida 32306 AND JOHN NYBY Department of Psychology
More informationNeuroprotection in preclinical models of Parkinson disease by the NAPVSIPQ peptide
Neuroprotection in preclinical models of Parkinson disease by the NAPVSIPQ peptide Bruce H. Morimoto, Ph.D. Executive Director, Applied Translational Medicine Microtubules Microtubules essential for neuronal
More informationBIOMEDICAL SCIENCES GRADUATE PROGRAM SPRING 2017
THE OHIO STATE UNIVERSITY BIOMEDICAL SCIENCES GRADUATE PROGRAM SPRING 2017 Grant Foglesong PhD Candidate Lifestyle Improvements Enhance Metabolic Function and Mitigate Breast Cancer Progression March 20
More informationFemale Reproductive System. Justin D. Vidal
Female Reproductive System Justin D. Vidal If you cannot identify the tissue, then it is probably part of the female reproductive system! Introduction The female reproductive system is constantly changing,
More informationA synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
More informationFasted Insulin Coincidence of Macrophage Infiltration into White Adipose Tissue and Onset of Hyperinsulinemia During Diet- Induced Obesity
Fasted Insulin Coincidence of Macrophage Infiltration into White Adipose Tissue and Onset of Hyperinsulinemia During Diet- Induced Obesity F4/80 MCP-1 (After: Xu et al, 2003 JCI vol.112) F4/80+ Cells are
More informationThe expression of the clock protein PER2 in the limbic forebrain is modulated by
Biological Sciences/Neuroscience The expression of the clock protein PER2 in the limbic forebrain is modulated by the estrous cycle Jennifer S. Perrin, Lauren A. Segall, Valerie Harbour, Barbara Woodside,
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationMaking a research poster? Helpful hints to make it memorable!
Making a research poster? Helpful hints to make it memorable! February 22, 2018 WCC255, 4:30pm 6:00pm CREATE@AC presents Community of Scholars Dr. Jessica Healy, Interim director CREATE Dr. Renee Countryman,
More informationFOOD REWARD AND MODULATION BY NUTRITIONAL STATUS, INSULIN AND LEPTIN. Dianne Figlewicz Lattemann, Ph.D.
FOOD REWARD AND MODULATION BY NUTRITIONAL STATUS, INSULIN AND LEPTIN Dianne Figlewicz Lattemann, Ph.D. ECOR SYMPOSIUM FEBRUARY 23, 2006 PASSION LIVES HERE, TOO Model for regulation of body adiposity Hypothalamic
More informationArticle begins on next page
Activation of Estrogen Response Element-independent ERα signaling protects female mice from diet-induced obesity Rutgers University has made this article freely available. Please share how this access
More informationGUSTATORY PREFERENCES DURING ESTRUS CYCLE IN RATS
GUSTATORY PREFERENCES DURING ESTRUS CYCLE IN RATS R. KANAKA. S. DUA-SHARMA AND K. N. SHARMA* Department of PhvsiologV, St. John's Medical College, Bangalore - 560 034 Summary : Estrus cycle has been used
More informationEffects of ovarian hormones on GPR120 mrna expression in mouse pituitary gonadotrophs
2017, 64 (1), 1-10 Original Advance Publication doi: 10.1507/endocrj.EJ17-0102 Effects of ovarian hormones on GPR120 mrna expression in mouse pituitary gonadotrophs Ryutaro Moriyama, Kaho Ueda and Chikaya
More informationHormones and Behavior
Hormones and Behavior 59 (2011) 585 593 Contents lists available at ScienceDirect Hormones and Behavior journal homepage: www.elsevier.com/locate/yhbeh The effects of ovariectomy on binge eating proneness
More informationNeurophysiology of the Regulation of Food Intake and the Common Reward Pathways of Obesity and Addiction. Laura Gunter
Neurophysiology of the Regulation of Food Intake and the Common Reward Pathways of Obesity and Addiction Laura Gunter The Brain as the Regulatory Center for Appetite The brain is the integration center
More informationof Medical Laboratory Technology, Ehime College of Health Science, Takooda, Tobe-cho, Iyo-gun, Ehime, Japan
(2002) 26, 610 617 ß 2002 Nature Publishing Group All rights reserved 0307 0565/02 $25.00 www.nature.com/ijo PAPER The hormonal responses of lipoprotein lipase activity and lipolysis in adipose tissue
More informationperk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
More informationThe Influence of Gonadal Hormones on Neuronal Excitability, Seizures, and Epilepsy in the Female
Epilepsia, 47(9):1423 1440, 2006 Blackwell Publishing, Inc. C 2006 International League Against Epilepsy The Influence of Gonadal Hormones on Neuronal Excitability, Seizures, and Epilepsy in the Female
More informationPokrzywinski et al. Biology of Sex Differences (2018) 9:25 (Continued on next page)
Pokrzywinski et al. Biology of Sex Differences (2018) 9:25 https://doi.org/10.1186/s13293-018-0183-9 RESEARCH Open Access Doxorubicin-induced cardiotoxicity is suppressed by estrous-staged treatment and
More informationChronic Stimulation of Leptin on Food Intake and Body Weight after Microinjection into the Ventromedial Hypothalamus of Conscious Rats
TAJ December 2006; Volume 19 Number 2 ISSN 1019-8555 The Journal of Teachers Association RMC, Rajshahi Original Article Chronic Stimulation of Leptin on Food Intake and Body Weight after Micro into the
More informationRat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN
YK051 Rat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC. 2480-1 AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN 418 0011 Contents Introduction 2 Characteristics 3 Composition 4 Method 5-6 Notes
More informationPulse and Surge Profiles of Luteinizing Hormone Secretion in the Mouse
ORIGINAL RESEARCH Pulse and Surge Profiles of Luteinizing Hormone Secretion in the Mouse Katja Czieselsky, Mel Prescott, Robert Porteous, Pauline Campos, Jenny Clarkson, Frederik J. Steyn, Rebecca E. Campbell,
More informationPituitary Leptin-A Paracrine Regulator of Gonadotropes: A Review
The Open Neuroendocrinology Journal, 2011, 4, 25-42 25 Pituitary Leptin-A Paracrine Regulator of Gonadotropes: A Review Noor Akhter, Christopher Crane and Gwen V. Childs* Open Access Department of Neurobiology
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature06310 SUPPLEMENTARY INFORMATION www.nature.com/nature 1 www.nature.com/nature 2 www.nature.com/nature 3 Supplementary Figure S1 Spontaneous duration of wake, SWS and REM sleep (expressed
More informationEstrogen and Brain Development. Kyle Pemberton
Estrogen and Brain Development Kyle Pemberton Estrogens and Estrogen Receptors GPER ERα Nucleus ERβ https://www.pharmacorama.com/en/sections/estrogens_progestins_hormonal_contraceptives_1_1.php Estrogen
More informationBMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects.
Supplementary Figure 1 BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects. Boxplots show the 25% and 75% quantiles of normalized mrna expression levels
More informationCentral Progesterone Involvement in Estrogen- Induced Prolactin and Luteinizing Hormone Secretion Surges in Female Rats
Southern Illinois University Carbondale OpenSIUC Honors Theses University Honors Program 5-10-2014 Central Progesterone Involvement in Estrogen- Induced Prolactin and Luteinizing Hormone Secretion Surges
More informationSupplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
More informationThe core molecular mechanism generating circadian
The expression of the clock protein PER2 in the limbic forebrain is modulated by the estrous cycle Jennifer S. Perrin, Lauren A. Segall, Valerie L. Harbour, Barbara Woodside, and Shimon Amir* Center for
More informationComp Question 2012 NRSA proposal
Comp Question 2012 NRSA proposal For female mammals, reproduction is an energetically expensive function and many aspects of energy balance regulation are altered to meet the energy demands of pregnancy
More informationResearch progress on the use of estrogen receptor agonist for treatment of spinal cord injury
Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury Swapan K. Ray, PhD Professor, Department of Pathology, Microbiology, and Immunology USC School of Medicine,
More informationTestosterone in utero and at birth dictates how stressful experience will affect learning in adulthood
Testosterone in utero and at birth dictates how stressful experience will affect learning in adulthood Tracey J. Shors* and George Miesegaes Department of Psychology and Center for Collaborative Neuroscience,
More informationIngestive Behaviors 33. Introduction. Page 1. control and story lines. (a review of general endocrinology) Integration (or the basic reflex arc model)
Ingestive Behaviors 33 (a review of general endocrinology) A neuroendocrine system: components, a reflex arc, the endocrine system, the AN, endocrine / nervous systems as afferents and efferents, the theoretical
More informationOnset of sexual maturity in female Göttingen minipigs & consequences for toxicity studies
Onset of sexual maturity in female Göttingen minipigs & consequences for toxicity studies Birgit Peter Eveline e Rijk Helle Lorentsen*, Adrian Zeltner* *Joint project with Ellegaard Göttingen Minipigs
More informationComp Question 2012 NRSA proposal
Comp Question 2012 NRSA proposal For female mammals, reproduction is an energetically expensive function and many aspects of energy balance regulation are altered to meet the energy demands of pregnancy
More informationPostnatal Development of Hypothalamic Leptin Receptors
CHAPTER ELEVEN Postnatal Development of Hypothalamic Leptin Receptors Elizabeth C. Cottrell,*,1 Julian G. Mercer, and Susan E. Ozanne* Contents I. Introduction 202 II. The Leptin System 203 A. Sources
More informationDietary Genistein Decreases the Age and Body Weight of Puberty Onset in Female Syrian Hamsters
Dietary Genistein Decreases the Age and Body Weight of Puberty Onset in Female Syrian Hamsters Robert M. Blum, Jamie Swanson and Jill E. Schneider Department of Biological Sciences, Lehigh University,
More informationEdward Fox Purdue University
Growth factor regulation of development and function of vagal sensory innervation of the GI tract Edward Fox Purdue University Intraganglionic laminar endings IGLEs Advances in contraception and industrialized
More informationCURRICULUM VITAE. Jonathan Dickerson B.S. Biology, Wilmington College.
CURRICULUM VITAE Jonathan Dickerson Education: 1999-2003 B.S. Biology, Wilmington College. 2004-2010 Ph.D., Neuroscience Graduate Program, University of Cincinnati. Thesis Advisor: Dr. Kim Seroogy 2007
More informationTHE PEPTIDE hormone prolactin (PRL) is found
13-7227/7/$15./ Endocrinology 18(12):5977 5983 Printed in U.S.A. Copyright 27 by The Endocrine Society doi: 1.121/en.27-2 Prolactin/tin Interactions in the Control of Food Intake in Rats Lindsay Naef and
More information