Trace element supplementation for stable food waste digestion

Transcription

1 Trace element supplementation for stable food waste digestion

2 Research aim To optimise a trace element supplementation strategy Identify essential trace elements for stable food waste digestion Determine the optimal trace element supplementation strength Research approaches Batch flask trials for screening purpose Semi-continuous digester operation to monitor the long-term effect Key parameters Trace elements (TE) concentrations Volatile fatty acids (VFA) concentrations (e.g. acetic acid and propionic acid)

3 Batch screening tests

4 Fractional factorial design Run Pattern Co Ni Mo Se Fe W Zn Cu Mn Al B Se Fe W Mo - Fe W Mo Se Ni - - Fe Ni - Se - W Ni Mo - - W Ni Mo Se Fe Co W Co - - Se Fe Co - Mo - Fe Co - Mo Se - W Co Ni - - Fe W Co Ni - Se Co Ni Mo Co Ni Mo Se Fe W Co Ni Mo Se Fe W Zn Co Ni Mo Se Fe W Zn Cu Mn Co Ni Mo Se Fe W Zn Cu Mn Al B

5 Acetic and Propionic acids degradation profiles Control Se, Mo Fe, Ni VFA (mg l -1 ) VFA (mg l -1 ) Acetic Propionic Total VFAs VFA (mg l -1 ) Se, Mo, Co, W, Fe, Ni, Zn, Cu, Mn, Al, B Se, Mo, Co, W Co, W VFA (mg l -1 ) VFA (mg l -1 ) VFA (mg l -1 )

6 Essential trace elements for food waste digestion Tier Trace element Compound Dosing strength (g tonne -1 ) 1 st Molybdenum (Mo) (NH 4 ) 6 Mo 7 O 24 4H 2 O 0.2 Selenium (Se) Na 2 SeO Cobalt (Co) 2 nd Tungsten (W) Iron (Fe) 3 rd Nickel (Ni) 4 th Zinc (Zn) Copper (Cu) Manganese (Mn) CoCl 2 6H 2 O 1.0 Na 2 WO 4 2H 2 O 0.2 FeCl 2 4H 2 O 5.0 NiCl 2 6H 2 O 1.0 ZnCl CuCl 2 2H 2 O 0.1 MnCl 2 4H 2 O 1.0 Aluminium (Al) AlCl 3 6H 2 O 0.1 Boron (B) H 3 BO 3 0.1

7 Semi-continuous anaerobic digestion trials Supplemented with: Trace element combinations Single trace element

8 Supplementation with combinations of trace elements

9 Organic loading rate (OLR) 5.0 OLR (kg VS m -3 digester day -1 ) Control OLR=2 Control OLR=3 Se, Mo Se, Mo, Co, W Se, Mo, Co, W, Fe, Ni (supplementation ceased from day 112 onwards) Se, Mo, Co, W, Fe, Ni, Zn, Cu, Mn, Al, B

10 Volatile fatty acids profiles Control OLR=2 Control OLR= Se, Mo VFA (mg l -1 ) Se, Mo, Co, W Se, Mo, Co, W, Fe, Ni Se, Mo, Co, W, Fe, Ni, Zn, Cu, Mn, Al, B Trace element supplementation stopped in Se,Mo,Co,W,Fe & Ni Se supplemented accidentally

11 Digestion efficiency Specific biogas production (SBP) 5.00 Volumetric biogas production (VBP) SBP (STP m 3 kg -1 VS) Control OLR=2 Control OLR=3 Se, Mo Se, Mo, Co, W Se, Mo, Co, W, Fe, Ni VBP (STP m 3 m -3 digester day -1 ) Se, Mo, Co, W, Fe, Ni, Zn, Cu, Mn, Al, B

12 Other digester parameters ph Intermediate alkalinity (IA) : partial alkalinity (PA) ph TAN (mg NH 3 -N l -1 ) Control OLR=2 Control OLR=3 Se, Mo Se, Mo, Co, W Se, Mo, Co, W, Fe, Ni IA : PA Se, Mo, Co, W, Fe, Ni, Zn, Cu, Mn, Al, B Total Ammonia nitrogen (TAN) Control OLR=2 Control OLR= Se, Mo 40.0 Se, Mo, Co, W Se, Mo, Co, W, Fe, Ni 35.0 Se, Mo, Co, W, Fe, Ni, Zn, Cu, Mn, Al, B Methane (%) Methane percentage

13 Co and Se dilute-out curves - VFA profile Co, Se (mg l -1 ) Co - measured Se - measured Co - calculated Se - calculated VFA measured VFA (mg l -1 ) Control OLR=2 Control OLR=3 Se, Mo Se, Mo, Co, W Se, Mo, Co, W, Fe, Ni Se, Mo, Co, W, Fe, Ni, Zn, Cu, Mn, Al, B VFA (mg l -1 )

14 Single trace element supplementation

15 Recovery of digesters using Se, Mo, and Co Parameters Values Volatile fatty acids OLR (kg VS m -3 d -1 ) TAN (mg NH 3 -N l -1 ) Methane (%) SBP (STP m 3 kg -1 VS) VBP (STP m 3 m -3 d -1 ) VFA (mg l -1 ) Se Mo Co Control

16 TE required vs TE in the food waste Minimum requirement at a moderate loading rate Hackney, London Luton, South Bedfordshire Ludlow, Shropshire Co ± ±0.002 <0.060 Se ± ±0.14 <0.07 TKN Unit: mg kg -1 fresh matter

17 Microbial community structure analysis

18 Anaerobic conversion process Food waste (Carbohydrates, Proteins, Lipids) Sugars, Amino acids, Long chain fatty acids Volatile fatty acids (VFA) with C>2 Propionate, Butyrate, Valerate Acetate H 2, CO 2, formate Acetoclastic Acetogenesis Methanogenesis Hydrolysis Acidogenesis Hydrogenotrophic Hydrolyticfermentative bacteria Syntrophic oxidising bacteria Methanogens CH 4, CO 2

19 Density gradient centrifugation SEM images

20 Classification of Methanogens Methanogen Order I. Methanobacteriales Order II. Methanococcales Order III. Methanomicrobiales Carbon source CO 2 / H 2 and formate CO 2 / H 2 and formate CO 2 / H 2 and formate Order IV. Methanosarcinales Family I. Methanosaetaceae Acetate Family II. Methanosarcinaceae Acetate Methylated one-carbon compounds CO 2 / H 2 and formate

21 FISH images Archaea Methanomicrobiales Archaea Bacteria Methanosarcinales and Bacteria Methanomicrobiales (food waste digestion) Probe name EUB338 ARC915 MG1200 MS1414 MSMX860 Methanosarcinaceae Target group Bacteria Archaea Methanomicrobiales Methanosarcinaceae Methanosarcinales Methanosarcinaceae (vegetable waste digestion) Probe sequence (5-3 ) GCTGCCTCCCGTAGGAGT GTGCTCCCCCGCCAATTCCT CGGATAATTCGGGGCATGCTG CTCACCCATACCTCACTCGGG GGCTCGCTTCACGGCTTCCCT Fluorescent dye Cy5 6-Fam Cy3 Cy3 Cy5 Fluorescent colour blue green red red blue Formamide (%) 20~50 20~

22 Conclusions

23 Trace elements Selenium and cobalt are the key trace elements needed for the long-term stability of food waste digesters, but are likely to be lacking in the food waste The minimum concentrations recommended in food waste digesters for selenium, cobalt are around 0.16, 0.22 mg l -1 respectively, when running at a moderate organic loading rate A total selenium concentration greater than 1.5 mg l -1 is likely to be toxic to the microbial consortium in the digester Food waste is likely to have sufficient Al, B, Cu, Fe, Mn, and Zn. We are still not sure about Ni, Mo and W

24 Digester operation Following proper trace element supplementation strategy, food waste digesters can be operated stably with low VFA concentrations at an organic loading rate of 5 kg VS m -3 d -1 with a volumetric biogas production of 3.8 STP m 3 m -3 d -1 and specific biogas production of 0.76 STP m 3 kg -1 VS Prevention of VFA accumulation in the digester by trace element supplementation is necessary, as recovery of a severely VFA-laden digester is not a rapid process even when supplements are added

25 Thanks to DEFRA WR1208 Dr Yue Zhang and to EU FP7 VALORGAS for continuing support to take this work forward

26 Thank you