Endochondral Ossification Process of the Turkey (Meleagris gallopavo) During Embryonic and Juvenile Development

Transcription

1 Endochondral Ossification Process of the Turkey (Meleagris gallopavo) During Embryonic and Juvenile Development S. Simsa and E. Monsonego Ornan 1 Faculty of Agriculture, Food and Environmental Quality Sciences, Department of Biochemistry and Nutrition, Hebrew University of Jerusalem, Rehovot 76100, Israel; Department of Poultry and Aquaculture Studies, Agricultural Research Organization, Volcani Center, Bet-Dagan 50250, Israel ABSTRACT The long bones of the developing skeleton turkey during embryonic and juvenile stages. Turkey tibias arise from the process of endochondral ossification, which were collected on embryonic d 11, 14, and 18; and at 3 begins during the embryonic stages and resumes later in and 7 d posthatching, alcian blue and Von Kossa staining, the growth plates located at the extremities of the long alkaline phosphatase activity, and in situ expression of collagen types II and X were studied in these samples. bones. This process includes commitment of cells to the We showed that the principles of bone development in chondrocytic lineage and further differentiation into hypertrophic chondrocytes, which subsequently undergo the initiation of ossification is related to the perichon- the turkey follow the known vertebrate pattern, and that apoptosis and are replaced by osteoblasts laying down drium and compact bone. These results increase the the trabecular bone. In this study we characterize, for the first time, the endochondral bone development of the knowledge about this process in the turkey, which is an important animal in the agricultural industries. Key words: growth plate, chondrocyte, collagen type II, collagen type X, alkaline phosphatase 2007 Poultry Science 86: INTRODUCTION In the developing skeleton, the long bones, such as those of the limbs, arise from the process of endochondral ossification, in which cartilage serves as the initial skeletal element and is later replaced by bone. During embryonic limb development, mesenchymal cells condense and aggregate (Delaisse et al., 2000), creating the outlines of the future skeleton, and then differentiate into chondrocytes. Shortly after formation of the cartilage template, proliferating chondrocytes in the central region of the cartilage undergo full differentiation into hypertrophic chondrocytes, which allow the invasion of blood vessels, osteoblasts, osteoclasts, and hematopoietic cells, resulting in formation of the primary ossification centers. Within these centers, the hypertrophic cartilage matrix is degraded, the hypertrophic chondrocytes die, and bone replaces the disappearing cartilage. These processes resume later, in the growth plates located between the epiphysis and metaphysis of the long bones (Tsumaki and Yoshikawa, 2005). The growth plate contains chondrocytes in different stages of differentiation, which are organized into several horizontal zones: the 2007 Poultry Science Association Inc. Received August 31, Accepted October 31, Corresponding author: ornanme@agri.huji.ac.il Author affiliations were corrected in this reposted paper. resting zone; the proliferative zone, with flattened cells expressing collagen type II; the prehypertrophic or transition zone; and the hypertrophic zone, expressing collagen type X, with a partially calcified matrix and invading capillaries (Gerber and Ferrara, 2000). When compared with the growth plate of mammals, the avian growth plate contains longer columns of chondrocytes, has more cells in each zone, and is highly vascularized (Pines and Hurwitz, 1991; Praul et al., 2000). The proliferative and prehypertrophic zones are vascularized from the proximal side by penetrating epiphyseal vessels, and the hypertrophic zone is vascularized from the distal side by the metaphyseal blood vessels. In other nonmammalian species, limb development in marine reptiles was studied by Caldwell (Caldwell, 2002), skeletal development of the turtle was studied by Sheil (Sheil, 2003), and skeletal ontogeny in lizards was investigated by Maisano (Maisano, 2002). In chickens, bone development in very early embryonic stages was studied as a model for developmental biologists (Tickle, 2004). Another aspect of endochondral bone formation of chickens and turkeys was studied mainly in the context of bone disorders such as rickets (Haynes and Goff, 1991; Sanders and Edwards, 1991) or tibial dyschondroplasia (Capps, 1998; Hocking et al., 2002; Webster et al., 2003), and in the context of the influence of diet on bone strength (Williams et al., 1999; Wu et al., 2003; Zhang et al., 2003). However, information regarding the 565

2 566 SIMSA AND MONSONEGO ORNAN development of the turkey growth plate is very limited. Thus, the purpose of the present study was to increase our knowledge of endochondral bone development in the turkey, which represents an important animal in the agricultural industries. Materials MATERIALS AND METHODS Alcian blue, silver nitrate, levamisol, and eosin were purchased from Sigma Chemical (St. Louis, MO); digoxigenin dutp was from Enzo (Mannheim, Germany); and dig-rna labeling mix, 4-nitroblue tetrazolium (NBT), and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) were from Roche (Wiesbaden, Germany). Animals Turkey embryos and chicks (BUT strain) were obtained from a commercial hatchery (Ramit, Hadera, Israel). The birds were raised for 7 d under the recommended temperature regimen and according to NRC recommendations (NRC, 1994), and were fed ad libitum. All procedures were approved by the Animal Care Welfare Committee of the Institute of Animal Science in Bet Dagan, Israel. Preparation of Probes Probes for in situ hybridization were prepared for chicken collagen types II and X using PCR amplification from cdna of both chicken growth plates and primary cultured chondrocytes, with the following primers: collagen II (accession number I50176): forward: ATATC- CACGCCAAACTCCTG; backward: GCTCCCAGAAC- GTCACCTAC; and collagen X (accession number M13496): forward: CCACCTGGATTCTCCACTGT; backward: TTCAAATCCTGGAAGACCTG. The suitability of those probes for turkey genes was checked by PCR amplifications of the indicated chicken primers, using turkey growth plates and primary cultured chondrocyte cdna as a template. The PCR products were ligated into pgem constructs to be used as probes for in situ hybridization (Tong et al., 2003). Histological Staining and In Situ Hybridization of Growth Plate Sections Bones and growth plates were fixed overnight in 4% paraformaldehyde (Sigma) in PBS at 4 C. The samples were dehydrated in graded ethanol solutions, cleared in chloroform, and embedded in Paraplast (Paraplast Plus, Kendall, Mansfield, MA), and 5- m sections were prepared. Alcian blue and Von Kossa staining was performed with 0.6% Alcian blue 8 GX in 70% ethanol and with 2% silver nitrate exposed to sunlight. Alkaline phosphatase (Gentili et al., 1993) activity was detected with a substrate solution (NBT + BCIP) for the enzyme. For hybridization, the sections were deparafinized in xylene, rehydrated through a graded series of ethanol solutions, rinsed in distilled water (5 min), and incubated in 2 sodium citrate buffer at 55 C for 30 min. The sections were then rinsed in distilled water and treated with proteinase K (10 g/ml in 0.2 M Tris-HCl, 5 mm EDTA, ph 7.5) for 10 min. After digestion, the slides were rinsed with distilled water, fixed in 10% formaldehyde in PBS, blocked in 0.2% glycine, rinsed in distilled water, rapidly dehydrated through graded ethanol solutions, and air-dried for several hours. The sections were then hybridized with digoxigenin-labeled antisense probes or with sense probes as controls. The hybridization was detected using a polyclonal antidigoxigenin antibody attached to alkaline phosphatase that, when it reacts with its substrate (NBT + BCIP), produces a color response. Endogenous alkaline phosphatase was inhibited with levamisole (Knopov et al., 1997). RESULTS Endochondral Ossification of the Turkey Tibia Characterization of the endochondral ossification process of the turkey tibia was done by alcian blue and Von Kossa staining of the cartilage matrix for proteoglycans and minerals, respectively. At embryonic d 11 (E 11), most of the skeletal element was cartilaginous and populated by chondrocytes (Figure 1, E 11). The primary ossification center was already formed at the center of the future bone, with the blood vessel requisite for the beginning of ossification in its center. The chondrocytes surrounding the blood vessel had differentiated to hypertrophic chondrocytes, which were distinguishable from the proliferating chondrocytes that occupy most of the cartilaginous element by their enlarged cytoplasm, also revealed by hematoxylin and eosin staining (Figure 1). At this stage of development, there was little ossified matrix in the central region of the future bone. The beginning of compact bone ossification was also visible in the area surrounding the diaphysis. At embryonic d 18 (E 18), most of the skeletal element was still cartilaginous. The compact bone was more evident around the diaphysis (Figure 1, E 18). The growth plate was being formed between the epiphysis and the diaphysis, as indicated by the chondrocytic markers collagen types II (Figure 2) and X (Figure 3) at this age. At 3dofage, compared with 7 d, the growth plate occupied a large part of the bone, the compact bone was evident, and the matrix around the hypertrophic chondrocytes adjacent to it had undergone calcification (Figure 1, 3 d). At 7 d, most of the bone was already calcified and the growth plate was in its final form (Figure 1, 7 d). Markers of Chondrocyte Differentiation Collagen type II is a known marker of proliferative chondrocytes. The expression of this gene was studied

3 ENDOCHONDRAL OSSIFICATION OF THE TURKEY 567 in the turkey tibia by in situ hybridization analysis. At E 11, most of the chondrocytes in the cartilaginous skeletal element were proliferative, as can be seen in the areas expressing collagen type II at the bone extremities (Figure 2, E 11). At embryonic d 14 (E 14), there was still a wide area of collagen type II expression close to the epiphysis, as well as in the articular cartilage. The resting zone of the growth plate, which is located between those 2 areas, did not express collagen type II (Figure 2, E 14). At E 18, collagen type II was also expressed in the articular cartilage and in the proliferative zone of the growth plate, which was already a defined structure by that stage. When comparing the relative area that collagen type II-expressing cells occupied, it can be seen that it was more narrow than it was at E 14, and the resting zone did not express collagen type II. The transition between the proliferative zone, which expresses collagen type II, and the hypertrophic zone, whose cells do not express this gene, was not homogeneous at this stage (Figure 2, E 18). At 3 d, collagen type II was expressed in the articular cartilage and the proliferative zone of the growth plate. The transition between the proliferative and hypertrophic zones was homogeneous at this stage. The resting zone was narrow compared with the embryonic stages (Figure 2, 3 d). Collagen type X is a known marker of hypertrophic chondrocytes. Its expression in the turkey tibia was also studied by in situ hybridization analysis. At E 11, collagen type X was expressed by hypertrophic chondrocytes in the central region of the cartilaginous skeletal element (Figure 3, E 11). At E 18, the gene was strongly expressed in hypertrophic chondrocytes adjacent to the perichondrium and the compact bone, and scattered expression was seen throughout the hypertrophic zone (Figure 3, E 18). These cells were hypertrophic despite the lack of collagen type X expression because of their location, and especially because their cytoplasm was enlarged. As with collagen type II, collagen type X expression at this stage also demonstrated the nonhomogeneous transition between the proliferative and hypertrophic zones; the areas expressing those genes were complementary to each other. At 3 d, the entire hypertrophic zone strongly expressed collagen type X, and the transition between the proliferative and hypertrophic zones was homogeneous at this stage (Figure 3, 3 d). Alkaline phosphatase (Gentili et al., 1993) activity plays a major role in growth plate mineralization, which is a prerequisite step in the ossification process. In the present research, alkaline phosphatase activity was studied in the turkey tibia. At E 11, there was strong alkaline phosphatase activity in the ossification center, the perichondrium, and the compact bone (Figure 4, E 11). At E 18, alkaline phosphatase was active in the perichondrium, the compact bone, and hypertrophic chondrocytes in close proximity to it. No alkaline phosphatase activity was observed in the proliferative zone nor, surprisingly, in the hypertrophic zone although the cells were hypertrophic in size (Figure 4, E 18). At 3 d, alkaline phosphatase was seen in the perichondrium and compact bone, and also in the hypertrophic zone, but not Figure 1. Endochondral ossification of the turkey tibia was studied by alcian blue and Von Kossa staining at embryonic days 11 (E 11) and 18 (E 18), and at the ages of 3 (3 d) and 7 d (7 d). Areas of the skeletal element at E 11 were revealed by hematoxylin and eosin (H + E) staining. PC = proliferative cells; HC = hypertrophic cells; BV = blood vessel; CB = compact bone; HZ = hypertrophic zone.

4 568 SIMSA AND MONSONEGO ORNAN the proliferative zone of the growth plate (Figure 4, 3 d). At 7 d, alkaline phosphatase was strongly active in the perichondrium, the compact bone, the hypertrophic zone, and the trabecular bone (Figure 4, 7 d). DISCUSSION In this study, we characterized, for the first time, the endochondral ossification process in the turkey tibia during embryonic and juvenile development. It has already been demonstrated that the principles underlying limb development in chickens are applicable to other vertebrates and that the plan of skeletal elements in the wing and leg generally conforms to the basic vertebrate pattern (Tickle, 2004). In the present study, we showed that in the turkey, the principles of bone development follow the known vertebrate pattern namely, formation of cartilaginous skeletal elements, followed by chondrocyte differentiation into hypertrophic chondrocytes, which enables blood penetration and ossification although the temporal sequence seems to differ between species. By using alcian blue and Von Kossa staining, we show that at E 11, a primary ossification center had already developed in the center of the cartilaginous skeletal element, whereas in mice the primary ossification center of the tibia begins to form at E 15 (Colnot et al., 2004). From E 18 on, the longitudinal growth of the bone occurs in the growth plate, where ossification is initiated in close proximity to the perichondrium and the compact bone. This observation correlates with expression of the hypertrophic markers collagen type X and alkaline phosphatase in limited areas adjacent to the perichondrium and the compact bone. The hypertrophy of chondrocytes is a precursory step for ossification, and it is possible that cells of the perichondrium, the compact bone, or both release proossification factors that accelerate differentiation and ossification of the chondrocytes adjacent to them. Moreover, a previous study in our laboratory revealed the Figure 2. Collagen type II expression in the turkey tibia was studied by in situ hybridization analysis at embryonic days 11 (E 11), 14 (E 14), and 18 (E 18), and at 3 d of age (3 d). PC = proliferative cells; HC = hypertrophic cells; PZ = proliferative zone; HZ = hypertrophic zone; RZ = resting zone.

5 ENDOCHONDRAL OSSIFICATION OF THE TURKEY 569 expression patterns of 3 genes from the matrix metalloproteinase (MMP) family, which are known to be expressed by hypertrophic chondrocytes and which are essential for endochondral ossification. These genes, MMP3, MMP-9, and MMP-13, were all found to be first expressed mainly in hypertrophic chondrocytes adjacent to the compact bone at E 18, suggesting that initiation of ossification may be perichondrium and compact bone dependent. Several studies have shown that communication exists between the perichondrial cells and chondrocytes. For example, paracrine secretion of the peptide hormone calcitonin by perichondrial cells stimulated the proliferation and differentiation of chondrocytes (Di Nino and Linsenmayer, 2003) and directly elicited the proliferation of osteoblasts and the synthesis of bone matrix (Farley et al., 1988). Similar to our present results using collagen type X expression and alkaline phosphatase localization, other markers of chondrocyte hypertrophy, such as Indian hedgehog and osteopontin, have been found in areas adjacent to the perichondrium at embryonic d 14 and 15 of mouse development (Colnot and Helms, 2001), which suggests that this pattern is not unique to turkeys. Further support for our hypothesis regarding the importance of the perichondrium to the ossification process comes from the late ossification pattern of the MMP-9/ gelatinase B-null mice, in which ossification of the hypertrophic zone is initiated in close proximity to the compact bone at the age of 4 wk (Vu et al., 1998). This suggests that, in the absence of matrix-degrading enzymes, the process of ossification induced by the perichondrium, the compact bone, or both serves as a substitute for the normal process at this age. We found that at 3 d, the growth plate occupies a large area of the bone, but that at 7 d, most of the bone is already ossified, as can also be seen by the alkaline phosphatase activity. These findings highlight the rapid growth at these ages. Figure 3. Collagen type X expression in the turkey tibia was studied by in situ hybridization analysis at embryonic days 11 (E 11) and 18 (E 18), and at 3 d of age (3 d). PC = proliferative cells; HC = hypertrophic cells; PZ = proliferative zone; HZ = hypertrophic zone; CB = compact bone.

6 570 SIMSA AND MONSONEGO ORNAN The status of the chondrocytic markers collagen types II and X highlights the fact that the growth plate is built gradually: At E 18, the transition was uneven from the proliferative zone, where collagen type II is expressed, to the hypertrophic zone, characterized by collagen type X expression, whereas by 3 d this transition was homogeneous. Another important finding of the present study is the existence of cells that are hypertrophic (as indicated by their location and morphology) but that do not express hypertrophic markers such as collagen type X and alkaline phosphatase. Later in development, these cells exhibit those markers. We speculate that this developmental phenomenon plays a role in one trend of the ossification process: that the fully hypertrophic cells adjacent to the compact bone enable the beginning of ossification in close proximity to it, and only later, when the cells in the inner zone have become fully differentiated, does ossification from the diaphysis become possible. ACKNOWLEDGMENTS This work was supported by Research Grant no. IS from BARD, the United States-Israel Binational Agricultural Research and Development Fund, and by a Poultry Board of Israel grant. REFERENCES Caldwell, M. W From fins to limbs to fins: Limb evolution in fossil marine reptiles. Am. J. Med. Genet. 112: Capps, S. G Effect of tibial dyschondroplasia on broiler growth and cancellous bone mechanical properties. Avian Dis. 42: Colnot, C. I., and J. A. Helms A molecular analysis of matrix remodeling and angiogenesis during long bone development. Mech. Dev. 100: Colnot, C., C. Lu, D. Hu, and J. A. Helms Distinguishing the contributions of the perichondrium, cartilage, and vascular endothelium to skeletal development. Dev. Biol. 269: Delaisse, J. M., M. T. Engsig, V. Everts, M. del Carmen Ovejero, M. Ferreras, L. Lund, T. H. Vu, Z. Werb, B. Winding, A. Lochter, M. A. Karsdal, T. Troen, T. Kirkegaard, T. Lenhard, A. M. Heegaard, L. Neff, R. Baron, and N. T. Foged Proteinases in bone resorption: Obvious and less obvious roles. Clin. Chim. Acta 291: Di Nino, D. L., and T. F. Linsenmayer Positive regulation of endochondral cartilage growth by perichondrial and periosteal calcitonin. Endocrinology 144: Farley, J. R., N. M. Tarbaux, S. L. Hall, T. A. Linkhart, and D. J. Baylink The anti-bone-resorptive agent calcitonin also acts in vitro to directly increase bone formation and bone cell proliferation. Endocrinology 123: Gentili, C., P. Bianco, M. Neri, M. Malpeli, G. Campanile, P. Castagnola, R. Cancedda, F. D. Cancedda Cell proliferation, extracellular matrix mineralization, and ovotransferrin transient expression during in vitro differentiation of chick hypertrophic chondrocytes into osteoblast-like cells. J. Cell Biol. 122: Gerber, H. P., and N. Ferrara Angiogenesis and bone growth. Trends Cardiovasc. Med. 10: Haynes, J. S., and J. Goff Distribution of type X collagen in tibiotarsi of broiler chickens with vitamin D deficiency. Calcif. Tissue Int. 49: Hocking, P. M., G. W. Robertson, and C. Nixey Effects of dietary calcium and phosphorus on mineral retention, Figure 4. Alkaline phosphatase activity was studied in the turkey tibia at embryonic days 11 (E 11) and 18 (E 18), and at 3 (3 d) and 7 (7 d) days of age. Pr = perichondrium; CB = compact bone; HZ = hypertrophic zone; PZ = proliferative zone.

7 ENDOCHONDRAL OSSIFICATION OF THE TURKEY 571 growth, feed efficiency and walking ability in growing turkeys. Br. Poult. Sci. 43: Knopov, V., D. Hadash, S. Hurwitz, R. M. Leach, and M. Pines Gene expression during cartilage differentiation in turkey tibial dyschondroplasia, evaluated by in situ hybridization. Avian Dis. 41: Maisano, J. A Postnatal skeletal ontogeny in callisaurus draconoides and uta stansburiana (Iguania: Phrynosomatidae). J. Morphol. 251: NRC Nutrient Requirements of Poultry. 9th ed. Natl. Acad. Press, Washington, DC. Pines, M., and S. Hurwitz The role of the growth plate in longitudinal bone growth. Poult. Sci. 70: Praul, C. A., B. C. Ford, C. V. Gay, M. Pines, and R. M. Leach Gene expression and tibial dyschondroplasia. Poult. Sci. 79: Sanders, A. M., and H. M. Edwards, Jr The effects of 1,25- dihydroxycholecalciferol on performance and bone development in the turkey poult. Poult. Sci. 70: Sheil, C. A Osteology and skeletal development of apalone spinifera (Reptilia: Testudines: Trionychidae). J. Morphol. 256: Tickle, C The contribution of chicken embryology to the understanding of vertebrate limb development. Mech. Dev. 121: Tong, A., A. Reich, O. Genin, M. Pines, and E. Monsonego- Ornan Expression of chicken 75-kDa gelatinase b-like enzyme in perivascular chondrocytes suggests its role in vascularization of the growth plate. J. Bone Miner. Res. 18: Tsumaki, N., and H. Yoshikawa The role of bone morphogenetic proteins in endochondral bone formation. Cytokine Growth Factor Rev. 16: Vu, T. H., J. M. Shipley, G. Bergers, J. E. Berger, J. A. Helms, D. Hanahan, S. D. Shapiro, R. M. Senior, and Z. Werb MMP-9/gelatinase b is a key regulator of growth plate angiogenesis and apoptosis of hypertrophic chondrocytes. Cell 93: Webster, S. V., C. Farquharson, D. Jefferies, and A. P. Kwan Expression of type X collagen, indian hedgehog and parathyroid hormone related-protein in normal and tibial dyschondroplastic chick growth plates. Avian Pathol. 32: Williams, B., D. Waddington, and C. Farquharson Dietary Ca and P requirements and skeletal quality in broiler chickens. Br. Poult. Sci. 40(Suppl.):S57 S58. Wu, L. N., G. R. Sauer, B. R. Genge, W. B. Valhmu, and R. E. Wuthier Effects of analogues of inorganic phosphate and sodium ion on mineralization of matrix vesicles isolated from growth plate cartilage of normal rapidly growing chickens. J. Inorg. Biochem. 94: Zhang, C., D. Li, F. Wang, and T. Dong Effects of dietary vitamin K levels on bone quality in broilers. Arch. Tierernahr. 57: