Table S1. Quantitative RT-PCR primers Gene Forward Primer Reverse Primer Human ApoB gcaagcagaagccagaagta ccatttggagaagcagtttgg Human ApoA1 gaaagctgcggtgctgac agtggccaggtccttcact Human MTP acggccattcccattgtg gccagagctccgagagagaa Human ARPp0 gtccaactacttccttaagatcatcca acatgcggatctgctgcat Human ELOVL5 cccttccatgcgtccata gattgtcagcacaaactgaagc Human StARD3 acctcacacagtgccaagc ccgacttgagcacgatgaa Human LPGAT1 attcttccggctcctctga tggactccgtcctgtctttc Human MBOAT1 gtttccacagcttgccaga aggtgatgcccaacttgtgt Human NFYC actcaagttgtgcagggac gtgacttgctggatctggtag Human DICER gacctaaccaatctcaaccagc actttcccatttggctttcc 18s rrna agtccctgccctttgtacaca gatccgaggtcactaaac Mouse ApoB tccatattccagacaacctcttc gtttattttgttcctgttcattgtgt Mouse MTP gaccaccctggatctccata agcgtggtgaaagggcttat Mouse ApoA1 ggccgtggctctggtctt ggttcatcttgctgccatacc Mouse ELOVL5 gtcctccatcccgtccat tgattgtcagcacaaactgga Mouse StARD3 ggtggtggatcagatcttgg acacagtgtccccatactcgt Mouse LPGAT1 ttgtagcacggcaggaaaat ggcctcttgatttgcattct Mouse MBOAT1 tcctaactggagtccctgtca ggaagagaggaagtggtgtctg Mouse ABCA1 ttggcgctcaacttttacgaa gagcgaatgtccttcccca Mouse ABCG1 acaacttcacagaggcccag tttcccagagatccctttca sidicer sigl2 simboat1 sistard3 sielovl5 silpgat1 sirna Oligomers sense: auuuagcugauuuccuugg anti-sense: gccaaggaaaucagcuaaa sense: cguacgcggaauacuucgatt anti-sense: cgaaguauuccgcguacg sense: cuuguaacaauuucaaggacutt anti-sense: aguccuugaaauuguuacaag sense: gaccagaucuuggcccaggaatt anti-sense: uuccugggccaagaucugguc sense: uuauauaaguagggauaagautt anti-sense: aucuuaucccuacuuauauaa sense: gauggaauggggagaagauautt anti-sense: auaucuucuccccauuccauc Scr mir-30c AntimiR-30c mir Sequences ucacaaccuccuagaaagaguaga uguaaacauccuacacucucagc gcugagaguguaggauguuuaca 1
Fig S1: Identification of putative mirs that could interact with MTP mrna: (a) TargetScan was used to search for mirs that could interact with the 3 -untranslated region (UTR) of human MTP mrna and the conservation of the binding sites in various mammals. This analysis identified several mirs that could interact with hmtp, but they were poorly conserved through evolution. However, the program also identified conserved sites for mirna families that are conserved among vertebrates. Note that several members of mir-30 family are identified (Arrow). (b) This figure shows putative binding sites for mir-30 family members in different vertebrate MTP mrna. Pairing site for mir-30 in the 3 -UTR of various mammalian MTP sequences are highlighted in white. This analysis showed that mir-30 family binding site is conserved in MTP mrna among vertebrates. 2
Supplementary Seed Fig S2: Base pairing between different mirs and MTP mrna: Sequences of different mir-30 family members and their base pairing is shown with MTP mrna sequence. CAAAUG represents the seed sequence of mir-30 family. Supplementary pairing sites are present in mir-30c and mir-30b. The alignment was performed using TargetScan. Based on crystallographic data, it is believed that the first 5 residue of mir interacts with Argonaute and is not available for interaction with the target mrna 1, 2. 3
Fig S3: mir-30c is present in the intron of NFY-C and is conserved in vertebrates: Top line shows schematic representation of different introns and exons in the human NFY-C gene. mir-30c resides in intron 5 of the gene. In humans, NFY-C gene is on chromosome 1, whereas it is on chromosome 4 in mouse. Intronic sequences from different species were aligned using CLUSTALW to show the conservation of mir-30c. The red box highlights mir-30c sequence. 4
Fig S4: Effect of lentivirus mediated expression of mir-30c on mir-30s, apob mrna, MTP activity, and lipids in different tissues: Male C57Bl/6J mice (5/group) were injected with different viruses and started on a Western diet. After 3 weeks different tissues were collected for analyses. (a) mir-30c, mir-30b and mir-30e levels were measured in the heart, jejunum and kidney. MTP activity (b) and mrna (c) were measured in the heart, jejunum and kidney. (d) ApoB mrna was measured in the heart, jejunum, kidney and liver. (e) ApoA1 mrna was measured in liver and jejunum. ABCA1 mrna (f) and ABCG1 mrna (g) were measured in the liver. Weekly plasma samples were used to measure AST (h) and ALT (i). 5
Fig S5: Lipid biosynthesis is targeted by mir-30c: (a) Predicted target genes of mir-30c from TargetScan were used to identify pathways affected using Gene Ontology. This program identified several lipid biosynthetic processes targeted by mir-30c. (b) Different genes targeted by mir-30c in various pathways are listed 3. Figure S6. Effect of lentivirus mediated expression of mir-30c in male liver-specific MTP knockout mice. L-MTP -/- mice (4/group; 8 weeks old) were injected with different lentiviruses and started on a Western diet for 5 weeks. (a) During this time, plasma triglyceride and cholesterol were measured weekly. (b) At the end of the 5 weeks, plasma samples were used to precipitate apoblipoproteins to measure triglyceride and cholesterol in total and HDL fractions. Non-HDL fraction is the difference of total and HDL plasma lipids. (c) Triglyceride and cholesterol in the livers of these mice were measured at the end of the experiment. Levels of hepatic glycerol were subtracted from total triglyceride to obtain liver triglycerides. Representative data of 2 independent experiments. 6
Fig S7: Effect of lentivirus mediated expression of mir-30c in male MTTP fl/fl mice. Mice (5/group; 8 weeks old) were injected with different lentiviruses and started on a Western diet. After 3 weeks, liver samples were used to measure mir-30c, mir-30b, and mir-30e (a) and hepatic cholesterol and triglyceride (c). (b) During the 3 week experiment, plasma triglyceride and cholesterol were measured weekly. Fatty acid oxidation (d), and fatty acid, triglyceride and phospholipid synthesis (e) were measured in liver slices at the end of the experiment. Data from 1 experiment. 7
Fig S8: Effect of mir-30c and antimir-30c on plasma lipids and atherosclerosis: Female Apoe -/- mice (7/group) were injected with lentiviruses expressing mir-30c or Scr mir and started on a Western diet. (a) Plasma cholesterol, triglyceride, AST and ALT were measured weekly. # p<0.05; ## p<0.01, ### p<.001, #### p<0.0001; significance calculated by two-way ANOVA. (b-f) Aortic arches were exposed and photographed (b). Sections from the cardiac/aortic junctions were stained with H & E (c). Junctions were also stained for macrophages (d).whole aortas were stained with Oil Red O (e). The lipid stains in the whole aortas were quantified using Image J (f). Representative data of 2 independent experiments. 8
Fig S9: Regulation of lipid synthesis and lipoprotein secretion by mir-30c: mir-30c is hypothesized to reduce expression of different genes to lower lipid synthesis and lipoprotein secretion. Reductions in lipid synthesis might avoid steatosis whereas reductions in lipoprotein secretion might lower atherosclerosis. 9
Reference List 1. Ma,J.B. et al. Structural basis for 5'-end-specific recognition of guide RNA by the A. fulgidus Piwi protein. Nature 434, 666-670 (2005). 2. Bartel,D.P. MicroRNAs: target recognition and regulatory functions. Cell 136, 215-233 (2009). 3. Huang,d.W., Sherman,B.T., & Lempicki,R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 4, 44-57 (2009). 10