Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Similar documents
a Supplementary Figure 1 Celastrol Withaferin A Individual drugs

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Supplementary Figure 1.

Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Metabolic responses to leptin in obese db/db mice are strain dependent

Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1

Ruth B. S. Harris, Tiffany D. Mitchell, Xiaolang Yan, Jacob S. Simpson and Stephen M. Redmann, Jr.

SUPPLEMENTARY INFORMATION

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

FGF19 Action in the Brain Induces Insulin- Independent Glucose Lowering

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

SUPPLEMENTARY INFORMATION

perk/erk STAT5B

a b c Physical appearance of mice Lean mass Adipocyte size d e f

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

Supplementary Table 1.

Control 7 d cold 7 d CL

People Living with And Inspired by Diabetes

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

Metformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production

Interplay between FGF21 and insulin action in the liver regulates metabolism

Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

Supplementary Fig. 1: TBR2+ cells in different brain regions.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8

Supplementary Figure 1

Supplemental Information. The Hormone FGF21 Stimulates Water Drinking. in Response to Ketogenic Diet and Alcohol

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

Expanded View Figures

Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota

islets scored 1 week month months

Food Intake Regulation & the Clock. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

SUPPLEMENTARY INFORMATION

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Hypothalamic TLR2 triggers sickness behavior via a microglia-neuronal axis

Figure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney

SUPPLEMENTARY INFORMATION

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity

Supporting Information

Supplementary Figure 1

Control. csarnt -/- Cre, f/f

Nature Medicine: doi: /nm.4324

BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects.

Metabolic Solutions Development Company, Kalamazoo, USA.

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

The reduction of feed intake and gluconeogenesis during hyperketonemia in dairy cows indicates a signal of abundant energy availability

Supplementary legends

SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.

Supplementary Materials for

Nature Medicine: doi: /nm.3891

Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Supplementary Information

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of

Supplementary Figure 1

Nature Medicine doi: /nm.3150

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice

Inhibition of 11β-hydroxysteroid dehydrogenase type 1 reduces food intake and weight gain but maintains energy expenditure in diet-induced obese mice

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

a! b! c! Supplementary Fig. 1! Diameter (μm) S1P (LogM) U (LogM) enos! β-actin! Nogo-B! MLEC! nnos! β-actin!

Table S2: Anthropometric, clinical, cardiovascular and appetite outcome changes over 8 weeks (baseline-week 8) by snack group

HSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells.

Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream signals in in vitro Symbol Gene ID RefSeqID Clone ID

Transcription:

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko Stefanovski, Richard N Bergman 5, Hong T Nguyen 1, Mauricio D Dorfman 1, Louise Lantier, David H Wasserman, Zaman Mirzadeh 7, Terry G Unterman,9, Gregory J Morton 1 & Michael W Schwartz 1 SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE 1 Effect of i.c.v. on glucoregulatory hormones in diabetic mice. (a) Plasma levels of insulin (left) and glucagon (right) in h fasted ob/ob (B) mice 1 weeks after a single i.c.v. injection of either 3 µg of m (n = 9) or veh (n = ). (b) Time course of blood glucose levels (left), food intake (middle) and body weight (right) from adlib-fed ob/ob (B) mice following a single injection of m (3 µg; n = 1) or veh (n = ) into the 3 rd ventricle. Throughout, data are the mean ± s.e.m. (a) P = n.s., i.c.v. m versus veh as determined by two-tailed Student s t-test. (b) P <.1 for group (veh versus ) by repeated measures designs by linear mixed-model analyses. P <.5, icv m versus veh by mixed factorial analyses. SUPPLEMENTARY FIGURE Effect of i.c.v. on plasma corticosterone levels in diabetic mice. Plasma levels of corticosterone obtained h after injection of m (3 µg) or veh into either (a) the 3 rd ventricle (veh, n = ;, n = 1) or (b) the lateral ventricle (veh, n = 1;, n = 1) from ob/ob (B) mice. (c) Plasma levels of corticosterone levels in ob/ob (B) mice 1 weeks after a single i.c.v. injection of either m (3 µg; n = 9) or veh (n = ). In all Nature Medicine: doi:1.13/nm.11

instances, plasma was obtained during mid-light cycle following a h fast. Throughout, data are mean ± s.e.m. P = n.s., i.c.v. m versus veh as determined by two-tailed Student s t-test. SUPPLEMENTARY FIGURE 3 Effect of i.c.v. on food intake and body weight across multiple rodent models of TD. (a) Time course of food intake (left) and body weight (right) from ad-lib-fed db/db mice following i.c.v. injection of either 3 µg of m (n = ) or veh (n = 9). (b) Time course of food intake (left) and body weight (right) from ad-lib-fed DIO WT mice in which hyperglycemia was induced with low-dose STZ (DIO-LD STZ) following i.c.v. injection of either m (3 µg; n = ) or veh (n = ). (c) Time course of food intake (left) and body weight (right) from ad-lib-fed ob/ob (B) mice following a single i.c.v. injection of either h (3 µg; n=), m (3 µg; n = ) or veh (n = ). (d) Time course of food intake (left), body weight (middle), and fat mass (right) from ad-lib-fed ZDF rats following a single i.c.v. injection of either r (3 µg; n = 1) or veh (n = 1). Throughout, data are the mean ± s.e.m. (a c) P <.5, i.c.v. m versus veh; # P <.5, i.c.v. h versus veh by mixed factorial analyses. (d) Significant main effects in (left) (P <.1) and (middle) (P =.) reflected group differences at earlier time points (treatment by day interaction is significant (P <.1). P-values for group (veh versus ) by repeated measures designs by linear mixed-model analyses. SUPPLEMENTARY FIGURE Effect of i.c.v. on BAT Ucp1 gene expression and plasma lipid levels. (a) Brown adipose tissue (BAT) Ucp1 gene expression in ob/ob (B) mice that underwent a basal glucose turnover study followed by an FSIGT 7 d after a single i.c.v. Nature Medicine: doi:1.13/nm.11

injection of m (3 µg; n = 13) or veh (n = 9). (b) Plasma levels of triglycerides (left), cholesterol (middle) and non-esterified free fatty acids (NEFA; right) in h fasted ob/ob (B) mice from samples obtained d following a single i.c.v. injection of either h (3 µg; n = ), m (3µg; n = ) or veh (n = ). (c) Plasma levels of triglycerides (left), cholesterol (middle), and NEFA (right) in h fasted db/db mice from samples obtained d following a single i.c.v. injection of either m (3 µg; n = ) or veh (n = 9). Throughout, data are mean ± s.e.m. P <.5, i.c.v. h versus veh as determined by one-way ANOVA analyses. SUPPLEMENTARY FIGURE 5 Effect of severe hyperglycemia on central -mediated glucose lowering. (a) Time course of blood glucose levels from severely hyperglycemic, ad-libfed db/db mice following i.c.v. injection of m (n = ) or veh (n = 9). (b) Time course of blood glucose levels from severely hyperglycemic, ad-lib-fed DIO WT mice treated with high dose-stz (DIO-HD STZ) following i.c.v. injection of m (n = ) or veh (n = 3). (c) Time course of blood glucose levels from severely hyperglycemic, ad-lib-fed ob/ob (BTBR) mice following i.c.v. injection of m (n = ) or veh (n = ). (d) Food intake (left), body weight (middle) and blood glucose (right) levels from ad-lib-fed DIO WT mice receiving continuous s.c. infusion of the insulin receptor antagonist S91 that received i.c.v. injection of either veh (n = 1) or m (3 µg; n = 11). Throughout, data are mean ± s.e.m. (d) For the time course of food intake (left), the groups differed on days 1 and (P <.1 and P =.3, respectively). P-values for group (veh versus ) by repeated measures designs by linear mixed-model analyses. Nature Medicine: doi:1.13/nm.11

SUPPLEMENTARY FIGURE Effect of i.c.v. in LIRFKO and littermate IRF control mice made hyperglycemic by systemic administration of the insulin receptor antagonist S91. Food intake (left) body weight (middle) and blood glucose levels (right) from ad-lib-fed littermate IRF controls (a) and LIRFKO mice (b) in which hyperglycemia was induced by continuous s.c. infusion of the insulin receptor antagonist S91, following i.c.v. injection of either veh (IRF, n = 1; LIRFKO, n = 1) or m (3 µg; IRF, n = 13; LIRFKO, n = 11). Throughout, data are mean ± s.e.m. P<.5, i.c.v. m versus veh by mixed factorial analyses. SUPPLEMENTARY FIGURE 7 (a) Representative immunofluorescence images of c-fos (red) in the hypothalamus of mice euthanized 9 min after a single i.c.v. injection of either veh saline (left, of n = images), m (3 µg; middle, of n = 1 images) or h9 (3 µg; right, of n = 1 images) (original magnification, x; Scale bar: µm). (b) C-Fos immunoreactive nuclei quantified from cells (both ependymal and tanycytes) lining the 3 rd ventricle (3V) from anatomically matched sections from the hypothalamus of mice treated with either i.c.v. veh (n = ), m (n = ) or h9 (n = ). (c) Hypothalamic levels of Hspb1 mrna (encoding HSP5) obtained from chow-fed WT mice h after a single i.c.v. injection of either veh (n = 9) or m (3 µg; n = ). (d) Western blot image (left) and densitometry quantification of synaptophysin protein levels (right) in hypothalamus (normalized to the loading control, β- tubulin III) from ob/ob mice obtained 1 week following a single i.c.v. injection of either m (3 µg; n = ) or veh (n = 5). Throughout, data are mean ± s.e.m. P <.5, i.c.v. m versus veh as determined by one-way ANOVA analysis or by Student s two-tailed t-test. Nature Medicine: doi:1.13/nm.11

Supplementary Figure 1 a Insulin (ng/ml) 15 1 5 Glucagon (pmol/liter) 1..5 b 3 5 15 1 5 1 1 1 Nature Medicine: doi:1.13/nm.11

Supplementary Figure a b c Corticosterone (ng/ml) 5 15 1 5 Corticosterone (ng/ml) 5 15 1 5 Corticosterone (ng/ml) 5 15 1 5 Nature Medicine: doi:1.13/nm.11

Supplementary Figure 3 a 1 1 - m 7 1 1 5 3 1 7 1 1 b 5 3 1 _ m 1 3 5 3 1 _ 1 3 c d Food intake (g/rat/day) 1 1 3 1 h m # # 7 9 Time (h) 5 1 15 5 3 # r 7 5 3 1 ####### h m 7 1 1 5 3 1 5 1 15 5 3 Fat mass (g) 15 1 5 r 3 Nature Medicine: doi:1.13/nm.11

Supplementary Figure a BAT Ucp1 mrna (fold change) 1 m b Triglycerides (mg/dl) 15 1 5 h m Cholesterol (mg/dl) 5 15 1 5 NEFA (mmol/liter) 1.5 1..5 c Triglycerides (mg/dl) 15 1 5 m Cholesterol (mg/dl) 5 15 1 5 NEFA (mmol/liter) 1.5 1..5 Nature Medicine: doi:1.13/nm.11

Supplementary Figure 5 a b c 5 3 1 _ 1 _ 7 7 1 1 5 3 1 1 5 3 1 7 1 1 d 3 1 _ 1 1 Osmotic pump Icv injection 5 3 1 1 1 3 1 _ 1 1 Nature Medicine: doi:1.13/nm.11

Supplementary Figure a 1 1 1 1 1 1 3 5 15 1 5 1 1 1 1 5 3 1 1 1 1 1 Osmotic pump Icv injection b 1 1 1 1 111 Osmotic pump Icv injection 3 5 15 1 5 1 1 111 5 3 1 1 1 111 Nature Medicine: doi:1.13/nm.11

Supplementary Figure 7 a b 3V lining c-fos count (immunoreactive nuclei/section) 15 1 5 9 c Hypothalamic Hspb1 mrna (fold change ) 1 d Hypothalamic synaptophysin/ -tubulin III (a.u.) 1.5 1.5 Nature Medicine: doi:1.13/nm.11

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback