Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1. IL-27 induces the expression of Tim-3 and IL-10 in CD8 + T cells. Naïve CD8 + T cells were activated with anti-cd3 and anti-cd28 antibodies under neutral (Tc0) or Tc1 (IL-12 treatment) culture conditions with or without the presence of IL-27 for 24 hours. Cells were then rested for 4 days. To analyze the protein expression of Tim-3 and IL-10, the cells were restimulated by anti-cd3 Supplementary and anti-cd28 antibodies Figure 1. for IL-27 24 induces hours and the were expression subjected of Tim-3 to Tim-3 and and IL-10 in CD8 + T IL-10 detection cells. Naïve by CD8 flow + T cytometry. cells were activated Data are with representative anti-cd3 and of anti-cd28 at least antibodies 2 under independent neutral experiments (Tc0) or Tc1 with (by similar IL-12 treatment) results. culture conditions with or without the presence of IL-27 for 24 hours. Cells were then rested for 4 days. To analyze the protein expression of Tim-3 and IL-10, the cells were restimulated by anti-cd3 and anti-cd28 antibodies for 24 hours and were subjected to Tim-3 and IL-10 detection by flow cytometry. Data are representative of at least 2 independent experiments with similar results.
Supplementary Figure 2. IL-27 is one of most potent cytokines to induce transcription. Naïve CD4+ T cells were activated by anti-cd3 and anti-cd28 antibodies in the presence of various cytokines for 48 hours. cdna was prepared for real time PCR to quantify the expression of (mean s.d). expression was normalized to the -actin signal. Results represent at least 3 independent experiments.
Rela+ve"Expression" Rela+ve"Expression" Rela+ve"Expression" a 400" & b 1500" & 300" 1200" 900" 200" 600" 100" 300" 0" 0" Un" Iono" c 400" Havcr2& 300" 200" 100" 0" Un" Iono" Supplementary Figure 3. RT-qPCR analyses for and Tim-3 expression. (a) B6 mice were infected with either LCMV clone13 (Cln13) or Armstrong (Arm). Viral antigen-specific CD8 + T cell mrna was isolated 8 days or 40 days after infection. transcription was detected by RT-qPCR. (b) and (c) In vitro differentiated Th1 cells were treated with 0.5 M ionomycin for 16 hours to induce T cell anergy (Immunity 2004, 21:167-177). RNA samples were isolated and subjected to RT-qPCR to detect (b) and Tim-3 (Havcr2) (c) transcription without (Ctrl) or with (Iono) T cell anergy induction results (a, b, c: mean s.d).
a b Un IL-27 38.2 54.6 WT& 400 300 200 25.5 42.3 -/- 100 0 10 0 10 1 10 2 10 3 10 4 Tim-3 Supplementary Figure 4. is important for Tim-3 expression in CD8 + T cells. (a). Naïve CD8 + T cells were activated by anti-cd3 and anti-cd28 with or without the presence of IL-27. Three days after TcR activation, the mrna expression of Tim-3 (Havcr2) was determined by RT-qPCR. (b) To examine Tim- 3 protein expression, cells were restimulated with anti-cd3 and CD28 for 24 hours and subjected to detection of the expression of Tim-3 by flow cytometry. Data are representative of at least 2 independent experiments with similar results (a: mean s.d)
Tim-3 PD-1 LAG-3 CD160 NKG2D FAS Th0 100 80 60 40 Th1 20 0 10 0 10 1 10 2 10 3 10 4 Tim-3 Shaded: GFP Empty: Supplementary Figure 5. Ectopic expression of results in the induction of Tim-3 expression. Naïve CD4 + T cells were activated with anti-cd3 and anti- CD28 antibodies under Th0 or Th1 condition, and were subsequently transduced with expressing retrovirus () or empty control retrovirus (GFP). The expression of indicated inhibitory receptors on transduced cells was examined by flow cytometry.
Relative Enrichment (fold) Relative Enrichment (fold) 2 kb Tim-3 Primer b 6 4 1 2 3 4 5 6 7 8 9 10 1 1 12 13 14 15 16 17 18 T-bet WT T-bet-/- 2 c 0 4 3 2 1 0 T-bet pre-gtigg pre-
d m m Supplementary Figure 6. Cooperative binding of T-bet and in the intronic (d) To generate Tim-3-luc promoter, genomic DNA sequence that contains partial intron 1 to region of the locus. (a) Summary of ChIP-seq data analysis. Sequencing distal promoter region ( from 283bp down stream to about 1.5kb upstream of the transcription reads initiation were site) mapped of Tim-3 gene to the was mouse sublconed reference into pgl3 basic genome luciferase (mm9) reporter using vector the Bowtie aligner (Promega), (Genome where Biology, and T-bet 2009, binding 10:R25). sites are identified Uniquely by ChIP-PCR mapped and ChIP-seq. reads with two or 293T cells were transfected with either only or T-bet, or combination of both. Tim-3 fewer mismatches were retained for downstream peak calling analysis. Peak promoter-driven firefly luciferase activities were normalized with an internal control, CMV detection promoter-driven was Renilla performed luciferase (Promega) by the (mean Model-based ± s.d.). Analysis of ChIP-Seq (MACS) program (Genome Biology, 2008, 9:R137) using the isotype sample as the control (peak p-value<10-5 and FDR<=0.05). ChIP-seq dataset of T-bet (GSM836124) was obtained from a previous publication (Immunity, 2011, 35:919 31). All the identified peaks were mapped to the UCSC Genes in the UCSC Genome Browser (http://genome.ucsc.edu/). The motif sequences of all the TF were analyzed by the MEME-ChIP program (Bioinformatics, 2011, 27:1696 7) from ChIP-seq identified peaks. (b) T-bet -/- and WT CD4 + T cells were activated by anti-cd3 and anti-cd28 antibodies under Th1 culture condition in the presence of IL-27. Four days after T cell activation, the cells were subjected to ChIP-qPCR to analyze T-bet enrichment to the Tim-3 locus. (c) Competition ChIP-qPCR. WT CD4 + T cells were activated by anti-cd3 and anti-cd28 antibodies under Th1 culture condition in the presence of IL-27. Four days after T cell activation, the chromatin sample was prepared and precleared with an antibody to or control goat IgG (gtigg) prior to T-bet ChIP. Locations for PCR primer sets marked in red indicate previously identified binding region in Figure 5f. (d) To generate Tim-3-luc promoter, genomic DNA sequence that contains partial intron 1 to distal promoter region (from 283bp down stream to about 1.5kb upstream of the transcription initiation site) of Tim-3 gene was sublconed into pgl3 basic luciferase reporter vector (Promega), where and T-bet binding sites are identified by ChIP-PCR and ChIP-seq. 293T cells were transfected with either only or T-bet, or combination of both. Tim-3 promoter-driven firefly luciferase activities were normalized with an internal control, CMV promoter-driven Renilla luciferase (Promega) (mean s.d.).
CNS 28 a 0 10,000 20,000 30,000 40,000 kb b CNS 6 Tim-3 CNS 12 CNS 13 CNS 15
CNS 15 CNS 28 Supplementary Figure 7. Computational analysis of the human and mouse Tim-3 locus (Havcr2). (a) CNSs in the Tim-3 locus. By aligning the human and mouse Tim-3 Supplementary locus in the ECR Figure Browser 7. Computational (http://www.dcode.org/), analysis 36 of CNSs, the human having 70% and or mouse greater Tim- 3 locus identity (Havcr2). over at least (a) CNSs 100bp in length, the Tim-3 were identified locus. By between aligning human the and human mouse and mouse Tim-3 Tim-3 locus. locus CNSs in predicted the ECR to have Browser potential -binding (http://www.dcode.org/), sites were marked 36 in red. CNSs, having (b) 70% CNSs or with greater significant identity over enrichment at least that 100bp were identified in length, by were ChIP-QPCR. identified between Numbers human are the and positions mouse relative Tim-3 to the locus. start of CNSs predicated predicted CNS sequence to have identified potential by the ECR Browser. Sequences in red are putative binding sites. -binding sites were marked in red. (b) CNSs with significant enrichment that were identified by ChIP-QPCR. Numbers are the positions relative to the start of predicated CNS sequence identified by the ECR Browser. Sequences in red are putative binding sites.
a b Supplementary Figure 8. Measurement of intestinal pathology. (a) Gut inflammation scored by crypt damage and immune cell infiltration. Two randomly selected sections from each individual mouse were scored to represent the final grade of gut pathology. Each section represents about 11-14 cm of intestine and 3-4 cm of colon. Inflammation were graded as follows: none = 0, a few areas of inflammation detected = 1, mild inflammation in proximally ¼ of the gut = 2, extensive inflammation in the majority of the gut = 3, extensive inflammation with hyperplasia = 4. Scale bars represent 200 m in length. (b) Histological result representing mice free from gut inflammation after transferring -transduced T cells. T cells were detected Peyer s paches in but failed to cause tissue damage. Scale bar represents 50 m in length.
Supplementary Figure 9. IL-27-suppressed Th1-mediated colitis is dependent. (a) Naïve CD4 + T cells from WT FoxP3-GFP KI and -/- x FoxP3- GFP KI mice (CD4 + CD62L + GFP - ) were activate by plate-bound anti-cd3/cd28 in the presence of IL-12, anit-tgf 1-2-3 antibody (Clone 1D11, R&D Systems), and anti-il-4 antibody. The cells were simultaneously treated with or without IL- 27. On day 6, cells were sorted again to deplete GFP + (FoxP3 + ) cells, and were peritoneally injected into Rag1 -/- recipients to induce colitis. 8 weeks after transfer, the recipient mice were killed to analyze colon pathology. The images represent pathology from each experimental group. Scale bars represent 100 m in length. (b) In vitro differentiated CD4 + T cells as described in (a) were transferred into Rag1 -/- recipient mice. After 5 weeks, T cells were isolated from mesenteric lymph nodes and analyzed for Tim-3 and IL-10 expression by flow cytometry. (WT Th1 n=4; WT Th1+IL-27 n=4; -/- Th1 n=4; -/- Th1+IL- 27 n=3. mean ± SEM, t test)
Supplementary Figure 10. WSX-1 -/- mice are resistant to tumor growth. (a) Lewis Lung carcinoma (LLC) cells were implanted into C57BL/6 (WT) (n=10) and WSX-1 -/- (n=9) mice and tumor growth was monitored in two dimensions. Statistics was based on combination of total animals from two independent experiments. (b) The expression of Tim-3 and PD-1 on CD8 + TILs from WT (n=4) and WSX-1 -/- (n=4) recipient tumor-bearing mice was determined by flow cytometry. (a and b: mean SEM, t test).
Supplementary Figure 11. -/- T cells suppress tumor growth. (a) WT or -/- T cells were transferred into Rag-1 -/- mice (WT: n=4; -/- : n=5). Recipient mice were then innoculated with 5x10 5 B16F10 melanoma cells. Tumor growth was monitored in two dimensions. Mean tumor growth is shown. (P=0.0317, t test). (b) Summary data showing mean tumor size at termination. (c) Summary data showing Tim-3 expression on CD4 + (P=0.046, t test) and CD8 + (n.s., t test) TILs (WT: n=3; -/- : n=3).
Supplementary Figure 12. Full Western blots. (a) Full Western blot for and -actin expression. Cropped figures were shown in manuscript Figure 3c. (b) Full Western blot for detection of -T-bet interaction by co-ip. Cropped figures were shown in manuscript Figure 5g.
No. Forward primers Reverse primers 1 ATTCAGTCCACCGTCTTTGC GAACACAATGTAATTTTATCGTAATGG 2 CCTGAAGCTCACCAAACCTC TGGCAGTCTTTGCTTCCTTT 3 GATCCCGCATTTTTAAGAGG GCTGCACTGTTGCGACTTC 4 CTCTCAGGAAGGGCTGACAC GGAAGGGGGACTTTGAACAT 5 AGTGCCTTGCAGGGTGTATC TCCTGAGTCCCCAGAATCAC 6 AAGGAGGAGGGATGTCCTGT ACCAGACCAGGAACGATGAC 7 TGTCAACTGGTTGCTTGCTC AAGATGCCGCAGGATATTTG 8 AAGGCTCACAGCATCGTCTT CTTCTGGGACAGCTTTCAGC 9 aacaaaaccaaatcaaaccaaa TCCTGGGGAACTCAAGACTG 10 GTTGCTGGGTGAAGCTCTTG CCGCAACTGTTCTAAAGGGTA 11 AAAAGACTGCGAACCACCAT GCTTGGGACCACCCTAATCT 12 CTAGGCACCTCAGCCTTTTG GGAGGGTCACCAGTGTCTGT 13 GGGGGCAGGTGAGATAAAAT CCCTAGTTCAAATCCCAGCA 14 TGTGGGCACATAAAATAAAGG AACTGGCAGCATTTGGAAAG 15 AGATCCCAATGTTCCCATCA TGAACACCAGAGATGGCCTA 16 CATGTGTTGCTTGCTTGCTT GATCGGGTTGGTGTCAAAAC 17 AAGGGCTGTCCTGAAAGTCA TCCTAAGCACGAGGCTTGTT 18 CATTCCTGGAGGAAACTGGA ATAGATGGGAGCCAGCACAG 19 ACTGCCCAGGAGTCATCTGT CCCAAAGATTTGATCCCTCA Supplementary Table 1. Sequences for Tim-3 ChIP-PCR primers.