a) SSR with core motif > 2 and repeats number >3. b) MNR with repeats number>5.

Similar documents
MODULE NO.14: Y-Chromosome Testing

New genomic typing method MLST

To test the possible source of the HBV infection outside the study family, we searched the Genbank

Prevalence of HPV-16 genomic variant carrying a 63-bp duplicated sequence within the E1 gene in Slovenian women

Multi-clonal origin of macrolide-resistant Mycoplasma pneumoniae isolates. determined by multiple-locus variable-number tandem-repeat analysis

HLA TYPING AND EXPRESSION: POTENTIAL MARKER FOR IDENTIFYING EARLY DYSPLASIA AND STRATIFYING THE RISK FOR IBD-CANCER

PREVENTION OF HAEMOGLOBINOPATHIES: New methodologies and procedures Non-invasive Prenatal Diagnosis

FONS Nové sekvenační technologie vklinickédiagnostice?

Listeria whole-genome-sequencing EFSA Project. Anses Statens Serum Institut Public Health England University of Aberdeen

ASSESSMENT OF THE RISK FOR TYPE 1 DIABETES MELLITUS CONFERRED BY HLA CLASS II GENES. Irina Durbală

MRC-Holland MLPA. Description version 08; 30 March 2015

Evidence for the Emergence of Non-O1 and. Pathogenic Potential by Exchange of O-Antigen Biosynthesis Regions

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.

SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A

Inge H.M. van Loo Kees J. Heuvelman Audrey J. King Frits R. Mooi. Journal of Clinical Microbiology accepted

Abstract. Introduction. RBMOnline - Vol 8. No Reproductive BioMedicine Online; on web 10 December 2003

Elucigene Male Factor Infertility Products Guide to Interpretation

Nature Biotechnology: doi: /nbt Supplementary Figure 1. PL gene expression in tomato fruit.

Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice

Utilisation du système CRISPR pour identifier les STEC du Top7

PRADER WILLI/ANGELMAN

Supplementary methods:

Supplementary information

Supplementary Material

Genetic and phylogenetic analysis of Vibrio parahaemolyticus reveals distinct differences in strains from the Pacific Northwest of the U.S.

ITS accuracy at GenBank. Conrad Schoch Barbara Robbertse

iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).

Consortium partners key persons

Mouse Clec9a ORF sequence

Supplemental Data: Detailed Characteristics of Patients with MKRN3. Patient 1 was born after an uneventful pregnancy. She presented in our

SALSA MLPA KIT P050-B2 CAH

Drug Metabolism Disposition

Epigenetics and Chromatin Remodeling

Received 29 June 2009/Returned for modification 7 September 2009/Accepted 11 October 2009

Figure S1. Molecular confirmation of the precise insertion of the AsMCRkh2 cargo into the kh w locus.

SUPPLEMENTARY INFORMATION

XMRV among Prostate Cancer Patients from the Southern United States and Analysis of Possible Correlates of Infection

Extended Multilocus Sequence Typing System for Campylobacter coli, C. lari, C. upsaliensis, and C. helveticus

Viral and Host Factors in Vulvar Disease DR MICHELLE ETHERSON 26 TH OF APRIL 2016

MOLECULAR DIVERSITY BASED CLUSTERING OF CHICKPEA (CICER ARIETINUM L.) GERMPLASM

Genotypic Characteristics of Vibrio cholerae Strains from Myanmar: Comparison between Past and Recent Isolates

Pappas G. (2009) Int J Parasitol. 39:

Genetic Analysis of Helicobacter pylori Strain Populations Colonizing the Stomach at Different Times Postinfection

The Human Major Histocompatibility Complex

HIV-1 Dual Infection and Neurocognitive Impairment

Molecular typing insight on diversity and antimicrobial resistance of Campylobacter jejuni from Belgian chicken meat

Simplified Preimplantation Genetic Diagnosis of Common Determinants. of Hemoglobin Bart s Hydrops Fetalis Syndrome Using a Multiplex-

SALSA MLPA probemix P315-B1 EGFR

Genotype Is Correlated with but Does Not Predict Virulence of Vibrio vulnificus Biotype 1 in Subcutaneously Inoculated, Iron Dextran-Treated Mice

Supporting Information

MRC-Holland MLPA. Description version 52; 22 July 2015

Problem set questions from Final Exam Human Genetics, Nondisjunction, and Cancer

MALBAC Technology and Its Application in Non-invasive Chromosome Screening (NICS)

Supplemental Information For: The genetics of splicing in neuroblastoma

DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK

Molecular profiling of single circulating tumor cells with diagnostic intention

Evidence for enteroviral persistence in humans

Tuberculosis Genotyping in British Columbia

CHAPTER IV RESULTS Microcephaly General description

OVERVIEW OF CURRENT IDENTIFICATION SYSTEMS AND DATABASES

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.

gliomas. Fetal brain expected who each low-

Supplementary Figure S1A

Original language: English AC30 Inf. 8 CONVENTION ON INTERNATIONAL TRADE IN ENDANGERED SPECIES OF WILD FAUNA AND FLORA

Investigation of the genetic differences between bovine herpesvirus type 1 variants and vaccine strains

The evidential value of STRs

Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.

Genomic Epidemiology of Salmonella enterica Serotype Enteritidis based on Population Structure of Prevalent Lineages

SUPPLEMENTARY INFORMATION

Species identification of mutans streptococci by groesl gene sequence

Supporting Online Material for

Supporting Online Material for

# For the GWAS stage, B-cell NHL cases which small numbers (N<20) were excluded from analysis.

Transcriptome maps of Populus tomentosa: Characteristics and its applications

Optimal Combination of VNTR Typing for Discrimination of Isolated Mycobacterium tuberculosis in Korea

LUCIAN BLAGA UNIVERSITY FROM SIBIU FACULTY OF MEDICINE VICTOR PAPILIAN INSULIN RESISTANCE IN POLYCYSTIC OVARIAN SYNDROME SUMMARY

MRC-Holland MLPA. Related SALSA MLPA probemixes P190 CHEK2: Breast cancer susceptibility, genes included: CHEK2, ATM, PTEN, TP53.

An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice

University of Warwick institutional repository:

Monitoring for Drug Resistance by Genotyping. Urvi M Parikh, PhD MTN Virology Core Lab

Any inbreeding will have similar effect, but slower. Overall, inbreeding modifies H-W by a factor F, the inbreeding coefficient.

The Geographic Origin of Helicobacter pylori Influences the Association of the homb gene with Gastric Cancer

Molecular Diagnostics Overview JAN A. NOWAK, PHD, MD PATHOLOGY AND LABORATORY MEDICINE MOLECULAR DIAGNOSTICS LABORATORY FEBRUARY 15, 2018

Intronic BCL-6 mutations are preferentially targeted to the translocated allele in t(3;14)(q27;q32) non-hodgkin B-cell lymphoma

Marker assisted selection of low phytic acid trait in maize (Zea mays L.)

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research

Genomic structural variation

Nature Structural & Molecular Biology: doi: /nsmb.2419

Title:Validation study of candidate single nucleotide polymorphisms associated with left ventricular hypertrophy in the Korean population

Sample collection. To extend our previous molecular epidemiological survey of

Genetics and Genomics in Medicine Chapter 8 Questions

MRC-Holland MLPA. Description version 08; 18 November 2016

Methylation reprogramming dynamics and defects in gametogenesis and embryogenesis: implications for reproductive medicine

Significance of the MHC

MRC-Holland MLPA. Description version 14; 28 September 2016

Y. Zhan, C. Li, Q. Gao, J. Chen, S. Yu and S.G. Liu. Corresponding author: Y. Zhan

BMC Microbiology. Open Access. Abstract. BioMed Central

Received 2 December 2002/Accepted 28 January 2003

Exploring the Importance of Single Nucleotide Polymorphisms of HSPA9 in DNA of Sarcoma Patients

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction

Transcription:

1 2 APPENDIX Legends to figures 3 4 5 Figure A1: Distribution of perfect SSR along chromosome 1 of V. cholerae (El-Tor N191). a) SSR with core motif > 2 and repeats number >3. b) MNR with repeats number>5. 7 Figure A2: L-SSR based dendrogram presenting the variation and phylogenetic relations 8 9 10 among 32 isolates of V. cholerae constructed by UPGMA cluster analysis of L-SSR data at 8 loci. The analysis was based on 54 polymorphic points (8 loci number of alleles in each locus). 11 12 13 14 Figure A3: Sequence based dendrogram presenting the variation and phylogenetic relations among 32 V. cholerae isolates constructed by UPGMA cluster analysis of sequence data at 7 MNR-MLST loci. 15 1 17 18 19 Figure A4: Sequence types based dendrogram presenting the variation and phylogenetic relations among of 32 isolates of V. cholerae constructed by UPGMA cluster analysis of 8 MNR-MLST loci in non-parametric analysis. The analysis was based on 52 polymorphic points (8 MNR loci number of alleles in each locus). 1

1 2 3 Table A1: DNA sequences of primers for 17 SSR loci, their annealing temperatures (Tm) and their expected size in V. cholerae O1 El Tor SSR designation a Sense primer 5 to 3' Antisense primer 5' to 3' Tm ( C) b Size (bp) c 4 5 7 8 9 10 L-SSR VC0147- () 9 -FAM-GGATACTCAAACGCAGGATGA CTTTCGGTCGGTTTCTCTTGT 2 183 VC0437- (7) 7 HEX-CGAGGTTAAAGGTCCTAACAA ATCAGGCTACATTCAGGTCTA 0 192 VC0500- (7) 4 HEX-TTGCTCTGGTGTCATAGGTG CAGTGCGGAATTTAGACTCG 0 189 VC1418- (3) 5 -FAM-CAGTATGGATGAACACAGATG TTTGGGTGTCAGTAAGACTTG 0 179 VC1457- (7) 4 -FAM-TCAGGAGGTCTAGAATCTGCC CTGTGGGTAGAAGTGAAACGG 5 28 VC150- (9) 7 -FAM-GTCAAATTACTGGGTGAACGC TTCTGGGTTAGGCTGTTCTG 0 144 VCA0171- () 23 d HEX-TGCTGATGAGTCTTCTTGCG TTAGACGTGGTCAAAGCTGC 2 210 VCA0283- () 14 HEX-AAATATCTGTAGCCTCCTCAG TTTCTTCCGATGAACTCTCTG 0 242 VCA1082- (3) 4 -FAM-GGATGATTGCGGTGTTTATTC TCTTTCTTCTCCAGATAAGGC 0 154 MNR VC0332- (A) 9 GCTTAAACCCGATTACAGTGA CAGCATCTCATAACGACATCT 0 200 VC0929- (G) 8 GGAACAGTCAATGACAGTGG GAGACAGTGAGTGAATGGAAG 2 200 VC1132- (A) 9 AAGCCAAAGTGAGCAAACAGG ATCTCCCGAAAGACACCTTAG 2 290 VC1490- (A) 9 GGTACGAAACAGCATATCATC TACTGAGGAAATGTCTAACGC 0 224 VC1833- (T) 9 e ACACTTTATGAGCAAGGCTTC ATCACTTATCCCGCTTAATCG 0 23 VCA0107- (T) 8 TTCAACCATGATGCTTACTGG TGCTGCCATGTATCAGTTATC 0 20 VCA019- (A) 8 AAGAGTTGAGTGTTACAGAGG GACGACCACTATGTTTGAAAG 0 32 VCA103- (T) 8 CAGTACATCCACCACTTCACG TTGCTGAGCGATTTCCTGC 2 15 a The SSR locus designation is named after the position of the downstream ORF (30). b Tm- the annealing temperatures used in the PCR. c Expected amplicon size according to the Vibrio cholerae EL Tor N191 complete genome (GenBank accessions NC_002505, NC_00250). d This locus was previously studied by Vodopyanov et al. (83). e This locus was previously published by us (18). 2

Table A2: Distribution of L-SSR alleles, presented as number of repeats in 32, clinical and environmental isolates of Vibrio cholerae Strain VC0147-() 9 VC0437-(7) 7 VC0500-(7) 4 VC1418-(3) 5 VC1457- (7) 4 VC150-(9) 7 VCA0171-() 23 VCA0283-() 14 VCA1082-(3) 4 O1 Og-1 (+) 10 5 4 5 4 7 11.2 23 4 O139-3 (+) 9 7 4 5 3 9 23.5 11 4 O9-5 (-) 5 3 np np np 4 18.3 np 4 O1- (+) 8 7 4 5 4 8 1.3 20 4 O1 In-7 (+) 7 4 5 4 8 15.2 20 4 O1 In-8 (-) 7 4 5 np 7 11.2 15 4 O139-9 (+) 11 8 4 5 3 9 22.5 13 4 O139-10 (-) 13 3 np np np 4 11.2 np 4 O141-11 (+) 11 3 np np 4 5 12.2 np 4 O141-18 (-) 10 4 np np np 4 24.5 np 4 O140-20 (-) 8 4 np np np 2 9.2 np 4 O140-21 (-) 8 4 np np np 2 9.2 np 4 O2-25 (-) 10 4 np np np 3 24.5 np 4 O2-27 (-) 7 3 np np np 5 13.2 np 4 O79-28 (-) 4 11 np np np 2 1.3 np 4 O79-29 (-) 4 11 np np np 2 1.3 np 4 O2-30 (-) 5 3 np np np 4 18.3 np 4 O2-32 (-) 5 3 np np np 4 18.3 np 4 O1 Og ET-108 (+) 7 7 4 5 4 9 9.2 20 4 O1 Og ET-109 (-) 10 5 4 5 np 7 10.2 24 NP O22-110 (-) 9 4 np np np 5 24.5 np 4 O1 Og ET-118 (+) 8 7 4 5 5 7 13.2 20 4 O1 Og ET-119 (-) 10 5 4 5 np 7 10.2 23 4 O1 Og-120 (+) 7 4 np 5 4 3 8.0 21 4 O1 In-121 (+) 7 4 5 4 7 11.2 1 4 O1 In ET-122 (+) 10 5 np 5 4 7 10.2 23 4 O1 In-123 (+) 7 4 np 5 3 12.2 24 4 O1 In-124 (+) 7 4 np 5 5/ 3 12.2 25 4 O10-125 (-) 8 4 np np np 4 14.2 np 4 O10-12 (-) 8 4 np np np 4 15.2 np 4 O49-128 (-) 8 4 np np np 2 9.2 np 4 O37-129 (-) 2 4 np np np 1.3 np 4 np = no amplification product.

Table A3: Distribution of polymorphic MNR alleles in 32, clinical and environmental isolates of Vibrio cholerae. Strain VC0332-(A) 9 VC0929-(G) 8 VC1132-(A) 9 VC1833-(T) 9 VCA0107-(T) 8 VCA019-(A) 8 VCA103-(T) 8 O1 Og-1 (+) (A) 9 (A), (G) 8 (T) 7 (T) 9 (T) 8, (T) 4 (G) 4 (A) 8 (T) 8 O139-3 (+) (A) 9 (A), (G) 8 (T) 7 (T) 9 (T) 8, (T) 4 (G) 4 (A) 8 (T) 8 O9-5 (-) (A) 8 (A) 5, (G) 5 TG (T) 7 (T) 7 (T) 8, (T) 5 (G) 3 (A) 8 (T) 7 O1- (+) (A) 9 (A), (G) 8 (T) 7 (T) 9 (T) 8, (T) 4 (G) 4 (A) 8 (T) 8 O1 In-7 (+) (A) 9 (A), (G) 8 (T) 7 (T) 9 (T) 8, (T) 4 (G) 4 (A) 8 (T) 8 O1 In-8 (-) (A) 9 (A), (G) 8 (T) 7 (T) 9 (T) 8, (T) 4 (G) 4 (A) 8 (T) 8 O139-9 (+) (A) 9 (A), (G) 8 (T) 7 (T) 9 (T) 8, (T) 4 (G) 4 (A) 8 (T) 8 O139-10 (-) (A) 8 (A) 5, TGGTGTG (T) 7 (T) (T) 8, (T) 5 (G) 3 (A) 8 (T) 7 O141-11 (+) (A) 8 (A) 5, (G) 7 (T) 2 (T) (T) 7, (T) 5 (G) 3 (A) 8 (T) 7 O141-18 (-) (A) 9 (A) 5, TGGTGTG (T) 8 (T) 4 (T) 8, (T) 5 (G) 3 (A) 8 (T) 7 O140-20 (-) (A) 8 np (T) 7 (T) 9 (T) 8, (T) 5 (G) 3 (A) 8 (T) 7 O140-21 (-) (A) 8 np (T) 7 (T) 9 (T) 8, (T) 5 (G) 3 (A) 8 (T) 7 O2-25 (-) (A) 8 (A) 5, (G) 5 TG (T) (T) (T) 8, (T) 5 (G) 3 (A) 8 (T) 7 O2-27 (-) (A) 8 (A) 5, (G) 7 (T) 7 (T) 9 (T) 8, (T) 5 (G) 3 (A) 8 (T) 7 O79-28 (-) (A) 8 (A) 5, (G) (T) 8 (T) (T) 8, (T) 5 (G) 3 (A) 8 (T) 7 O79-29 (-) (A) 8 (A) 5, (G) (T) 8 (T) (T) 8, (T) 5 (G) 3 (A) 8 (T) 7 O2-30 (-) (A) 8 (A) 5, (G) 5 TG (T) 7 (T) 7 (T) 8, (T) 5 (G) 3 (A) 8 (T) 7 O2-32 (-) (A) 8 (A) 5, (G) 5 TG (T) 7 (T) 7 (T) 8, (T) 5 (G) 3 (A) 8 (T) 7 O1 Og ET-108 (+) (A) 9 (A), (G) 8 (T) 7 (T) 9 (T) 8, (T) 4 (G) 4 (A) 8 (T) 8 O1 Og ET-109 (-) (A) 9 (A), (G) 8 (T) 7 (T) 9 (T) 8, (T) 4 (G) 4 (A) 8 (T) 8 O22-110 (-) (A) 8 (A) 5, (G) 4 TG (T) 7 (T) (T) 8, (T) 5 (G) 3 (A) 7 (T) 7 O1 Og ET-118 (+) (A) 9 (A), (G) 8 (T) 7 (T) 9 (T) 8, (T) 4 (G) 4 (A) 8 (T) 8 O1 Og ET-119 (-) (A) 9 (A), (G) 8 (T) 7 (T) 9 (T) 8, (T) 4 (G) 4 (A) 8 (T) 8 O1 Og-120 (+) (A) 9 (A), (G) 8 (T) 7 (T) 9 (T) 8, (T) 5 (G) 3 (A) 8 (T) 8 O1 In-121 (+) (A) 9 (A), (G) 8 (T) 7 (T) 9 (T) 8, (T) 4 (G) 4 (A) 8 (T) 8 O1 In ET-122 (+) (A) 9 (A), (G) 8 (T) 7 (T) 9 (T) 8, (T) 4 (G) 4 (A) 8 (T) 8 O1 In-123 (+) (A) 9 (A), (G) 9 (T) 7 (T) 9 (T) 8, (T) 5 (G) 3 (A) 8 (T) 8 O1 In-124 (+) (A) 9 (A), (G) 9 (T) 7 (T) 9 (T) 8, (T) 5 (G) 3 (A) 8 (T) 8 O10-125 (-) (A) 8 (A) 5, (G) 5 TG (T) 7 (T) (T) 8, (T) 5 (G) 3 (A) 8 (T) 7 O10-12 (-) (A) 8 (A) 5, (G) 5 TG (T) 7 (T) (T) 8, (T) 5 (G) 3 (A) 8 (T) 7 O49-128 (-) (A) 8 np (T) 7 (T) 9 (T) 8, (T) 5 (G) 3 (A) 8 (T) 7 O37-129 (-) (A) 10 (A) 5, (G) 4 TG (T) 7 (T) 9 (T) 8, (T) 5 (G) 3 (A) 8 (T) np = no amplification product. 5

Figures a) Total SSR length (bp) 5 4 3 2 1 0 0.25 0.5 0.75 1 1.25 1.5 1.75 2 2.25 2.5 2.75 Location among chromosome 1 (Mb) b) MNR length (bp) 12 11 10 9 8 7 5 0 0.25 0.5 0.75 1 1.25 1.5 1.75 2 2.25 2.5 2.75 Location among chromosome 1 (Mb) Figure A1:

O140-21(-) O49-128(-) O140-20(-) O10-125(-) O10-12(-) O22-110(-) O141-18(-) O2-25(-) O37-129(-) O79-28(-) O79-29(-) O141-11(+) O2-27(-) O139-10(-) O9-5(-) O2-30(-) O2-32(-) O1Og-120(+) O1In-123(+) O1In-124(+) O1Og ET-119(-) O1In ET-122(+) O1Og-1(+) O1Og ET-109(-) O1In-8(-) O1In-121(+) O139-9(+) O139-3(+) O1Og ET-108(+) O1In-7(+) O1-(+) O1Og ET-118(+) 0.4 0.3 0.2 0.1 0.0 Genetic Distance Figure A2:

8 88 77 4 57 O1 Og ET-108 (+) O1 Og ET-119 (-) O1 In-121 (+) O1 Og-1 (+) O1- (+) O1 In-7 (+) O1 Og ET-118 (+) O1 In ET-122 (+) O1 In-8 (-) O1 Og ET-109 (-) O139-3 (+) O139-9 (+) O1 Og-120 (+) O1 In-123 (+) O1 In-124 (+) O37-129 (-) O2-27 (-) 72 99 99 O140-21 (-) O140-20 (-) O49-128 (-) O79-28 (-) O79-29 (-) 58 99 99 O9-5 (-) O2-32 (-) O2-30 (-) O22-110 (-) O139-10 (-) O2-25 (-) O10-125 (-) O10-12 (-) O141-11 (+) O141-18 (-) 0.002 Figure A3: 8

O1 In-121 (+) O1 In ET-122 (+) O1 Og ET-119 (-) O1 Og ET-118 (+) O1 Og ET-109 (-) O1 Og ET-108 (+) O139-9 (+) O1 In-8 (-) O1 In-7 (+) O1- (+) O139-3 (+) O1 Og-1 (+) O1 Og-120 (+) O1 In-123 (+) O1 In-124 (+) O37-129 (-) O141-11 (+) O22-110 (-) O10-125 (-) O10-12 (-) O140-21 (-) O49-128 (-) O140-20 (-) O2-27 (-) O2-30 (-) O2-32 (-) O9-5 (-) O139-10 (-) O2-25 (-) O79-28 (-) O79-29 (-) O141-18 (-) 0.4 0.3 0.2 Genetic Distance 0.1 0. Figure A4: 9

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback