Supplementary information Supplementary Figure -9 Supplementary Table -4 The mir-99a/brm/egr axis is a determinant of anchorage-independent growth in epithelial tumor cell lines Kazuyoshi Kobayashi, Kouhei Sakurai, Hiroaki Hiramatsu, Ken-ichi Inada 3, Kazuya Shiogama 3, Shinya Nakamura, Fumiko Suemasa, Kyosuke Kobayashi, Seiya Imoto 2, Takeshi Haraguchi, Hiroaki Ito, Aya Ishizaka, Yutaka Tsutsumi 3 & Hideo Iba Division of Host-Parasite Interaction, Department of Microbiology and Immunology 2 Laboratory of DNA Information Analysis, Human Genome Center, Institute of Medical Science, University of Tokyo, Tokyo, Japan. 3 First Department of Pathology, Faculty of Medicine, Fujita Health University, Aichi, Japan Corresponding author: Hideo Iba, Division of Host-Parasite Interaction, Department of Microbiology and Immunology, Institute of Medical Science, University of Tokyo, 4-6- Shirokanedai, Minato-ku Tokyo, 8-8639, Japan Phone: 8-3-5449-573, Fax: 8-3-5449-5449, E-mail: iba@ims.u-tokyo.ac.jp
RLU RLU RLU RLU EV shcre#4 shbrm#4 EV shcre#4 shbrm#4 H299 shbrm#5 shbrm#5. 5 Days. 2 4 6 8 2 Days EV shcre#4 shbrm#4 shbrm#5 EV shcre4 shbrm#4 shbrm#5 Panc-. 2 4 6 8 Days 2 4 6 8 2 Days Supplementary Figure. Growth curve analysis of four type cell lines that were transduced with retroviral vector expressing shbrm (#4 or #5) or shcre#4 (negative control). EV = transduced with an empty vector (psssp).
SW3 HuTu8 H522 C33A H299 KB Panc- DLD- HT29 HCT6 SW3 HuTu8 H522 C33A H299 KB Panc- DLD- HT29 HCT6 Relative expression levels SW3 HuTu8 H522 C33A H299 KB Panc- DLD- HT29 HCT6.5.5.5 PPARD (mir-99a-5p, -24) JAG (mir-99a-5p, -24).2.8.6.4.2.5 MAP3K5 (mir-99a-5p) IKBKB (mir-99a-5p).5 SMAD4 (mir-99a-5p).5.2.8 KRT4 (mir-99a-5p).6.5.5.4.5.5.5 CADM (mir-99a-5p) DDR (mir-99a-5p).5.5.2.8 NFKB (mir-99a-5p) RELA (mir-99a-5p).2.4.2.8.6.4.2 KRT9 (mir-99a-5p).5.6.4.5 GSK3B (mir-99a-5p).2.5 SIRT (mir-99a-5p).5.5 Supplementary Figure 2. mrna expression profiles of each mir-99a-5p target gene in the epithelial tumor cell line panel, as determined by quantitative RT-PCR. The relative expression levels are shown by taking the highest levels as.. Red break lines indicate the boundary between type 2 and type cell lines.
SW3 HuTu8 H522 C33A H299 KB Panc- DLD- HT29 HCT6 SW3 HuTu8 H522 C33A H299 KB Panc- DLD- HT29 HCT6 SW3 HuTu8 H522 C33A H299 KB Panc- DLD- HT29 HCT6 Relative expression levels.5.5.2.8.6.4.2.2.8.6.4.2.2.8.6.4.2.2.8.6.4.2 STAT3 (mir-99a-3p, -24) AKT (mir-99a-3p) FN (mir-99a-3p) GATA3 (mir-99a-3p) MTOR (mir-99a-3p).2.8.6.4.2.2.8.6.4.2.2.8.6.4.2.2.8.6.4.2.2.8.6.4.2 PDGFRA (mir-99a-3p) SMAD (mir-99a-3p) KRT7 (mir-99a-3p) EZH2 (mir-24) NOS3 (mir-24).2.8.6.4.2 2.5.5.5 NOTCH2 (mir-24) PTEN (mir-24).5 KRT5 (mir-24) 2.5.5 KRT6A (mir-24) Supplementary Figure 3. mrna expression profiles of each target gene for mir-99a-3p and mir-24 in the epithelial tumor cell line panel, as determined by quantitative RT-PCR. The relative expression levels are shown by taking the highest levels as.. Red break lines indicate the boundary between type 2 and type cell lines.
Relative expression levels SW3 HuTu8 H522 C33A H299 KB Panc- DLD HT29 HCT6 Supplementary Figure 4. Protein expression profiles in the epithelial tumor cell line panel. Western blots shown in Fig. 2b were used for quantification after normalization by b--actin bands (internal control). The relative expression levels are shown by taking the highest levels as.. Red break lines indicate the boundary between type 2 and type cell lines. SW3 HuTu8 H522 C33A H299 KB Panc- DLD HT29 HCT6.2..8.6.4.2..2..8.6.4.2..2..8.6.4.2..2..8.6.4.2..2..8.6.4.2..2..8.6.4.2. Brm p<. BRG p<.5 SIRT p=.7 IKKB p=.67 RELA p=.5 GSK3B p=.9.2..8.6.4.2..2..8.6.4.2..2..8.6.4.2..2..8.6.4.2..2..8.6.4.2. CAV p<. MET p<. CD44 p<.5 CAV2 p<. PTEN p=.2
a CD44 b-actin b MET b-actin c CAV b-actin d CAV2 b-actin Supplementary Figure 5. Knockdown efficiency of shrnas against CD44, MET, CAV, and CAV2 were determined by western blot analysis of cells. Cells were transduced with shrna-expressing retroviral vectors against CD44 (a), MET (b), CAV (c) or CAV2(d), and Cre#4 (negative control), and total proteins were prepared and analyzed by western blotting using the corresponding antibody. EV=transduced with an empty vector (psssp).
Supplementary Figure 6. Full-length images of the immunoblots. Red line boxes indicate the cropped images used in Figure 2b. b-actin was used as an internal control. Blots in a black line box are originated from the same gel. In gels in a blue broken line box, the same set of protein samples was charged. Arrowheads indicate the position of protein markers (#6-374; BIO-RAD).
Supplementary Figure 6. Continued
Supplementary Figure 6. Continued
Supplementary Figure 6. Continued
Supplementary Figure 7. Full-length images of the immunoblots. Red line boxes indicate the cropped images used in Figure 3c. b-actin was used as an internal control. Blots in a black line box are originated from the same gel. In gels in a blue broken line box, the same set of protein samples was charged. Arrowheads indicate the position of protein markers (#6-374; BIO-RAD).
EV EGR EV EGR M M M M CD44 75 kda b-actin 5 kda 37 kda CAV 25 kda 2 kda Supplementary Figure 8. Full-length images of the immunoblots. Red line boxes indicate the cropped images used in Figure 5b. b-actin was used as an internal control. Blots in a black line box are originated from the same gel. M means Protein size marker (#6-374; BIO-RAD). Arrowheads indicate the position of marker proteins.
EV EGR EV EGR MET M M M M 25 kda 5 kda kda EGR 75 kda 5 kda b-actin 37 kda CAV2 Long exposure 25 kda 2 kda Supplementary Figure 8. Continued
SW3 HuTu8 H522 A427 H23 H299 HT29 HCT6 SW62 MKN45 MDA-MB23 HCC937 H596 MIA Paca2 PLC/PRF/5 Huh7 a Brm qpcr p<. Database P=.6.... Relative expression levels Relative expression levels.2 EGR qpcr P<. Database P=.6.8.6.4.2 Supplementary Figure 9. Expression profiles of Brm and EGR mrna in 7 epithelial tumor cell line panel obtained from our quantitative PCR data using Brm- and EGR- primer pairs (blue bars) and Sanger Database (red bars). The each relative expression levels are shown by taking the highest levels as.. Red break lines indicate the boundary between type and type 2 cell lines.
Supplementary Table. List of the examined target genes of mir-99a-5p, -3p and mir-24 Gene Accession Reported mirna a b Number to target Genes c d Reference PPARD NM_6238 99a-5p, 24 Cell Metab 8, 34-54 (23) JAG NM_24 99a-5p, 24 5p:, 24:x RNA Biol 9, 35-6 (22) KRT8 NM_8257 99a-5p, 24 - CADM NM_4333 99a-5p J Biol Chem 288, 845-53 (23) DDR NM_954 99a-5p Mol Cancer 9, 227 (2). GSK3B NM_293 99a-5p Cancer Lett 35, 89-97 (22) IKBKB NM_556 99a-5p Oncogene 27, 472-23 (28) MAP3K5 NM_5923 99a-5p - NFKB NM_3998 99a-5p Am J Respir Crit Care Med 89, 263-73 (24) RELA NM_2975 99a-5p Am J Respir Crit Care Med 89, 263-73 (24) SIRT NM_2238 99a-5p Circ Res 4, 879-86 (29) SMAD4 NM_5359 99a-5p Nucleic Acids Res 4, 9286-97 (22) CAV NM_753 99a-5p PLoS Genet 9, e329 (23) KRT4 NM_526 99a-5p - KRT9 NM_2276 99a-5p Confirmed by our group STAT3 NM_35 99a-3p, 24 3p:, 24: Mol Cancer Ther, 337-45 (2) AKT NM_563 99a-3p - FN NM_226 99a-3p - GATA3 NM_25 99a-3p - MTOR NM_4958 99a-3p Mol Cancer Ther, 337-45 (2) Cancer Res 7, 584-93 (2) PDGFRA NM_626 99a-3p - SMAD NM_59 99a-3p J Biol Chem 284, 326-35 (29) CAV2 NM_233 99a-3p J Cell Sci 24, 2826-36 (2) CD44 NM_6 99a-3p Biochem Biophys Res Commun 43, 2-5 (2) FEBS J 279, 247-59 (22) KRT7 NM_5556 99a-3p Int J Cancer 25, 345-52 (29) MET NM_245 99a-3p Mol Cancer Ther, 337-45 (2) Cancer Res 7, 584-93 (2) EZH2 NM_4456 24 Mol Cell 36, 6-74 (29) NOS3 NM_63 24 Eur J Pharm Sci 38, 37-7 (29) NOTCH2 NM_2448 24 - PTEN NM_34 24 Cancer Res 68, 425-33 (28) KRT5 NM_424 24 - KRT6A NM_5554 24 - a. mirna.org : (http://www.microrna.org/microrna/home.do), b. PicTar : (http://pictar.mdc-berlin.de/) c. TargetScan : (http://www.targetscan.org/), d. mirtarbase : (http://mirtarbase.mbc.nctu.edu.tw/)
Supplementary Table 2. Relative protein expression levels of EGR, CD44, MET, CAV and CAV2 after EGR introduction into A-549 or. Three western blots (one of them was shown in Fig5b) were used for quantification after normalization by -actin (internal control). The protein bands of cells transduced with the empty vector (EV) were taken as. and P-values were calculated by the student s t-test (n=3). Protein Relative expression levels P value Relative expression levels P value EGR 2.6±.62 p<..9±.25 p<. CD44.96±. p=.42.6±.7 p=.7 MET 75±.3 p<..8±. p<.5 CAV.77±.6 p<..6±.2 p<. CAV2.76±.2 p<..62±.3 p<.
Supplementary Table3. Epithelial tumor cell lines used in this study and their classification Cell lines used in Fig.a as the original panel are shown in blue. Cell lines that are newly added in Fig.7 are shown in white. For Brm and EGR mrna, qpcr data using primer pairs Brm- and EGR- were used (Fig. 7). The relative expression levels are shown by taking the highest levels as.. Criteria for classification of three expression levels (+,±, -) are summarized in the upper part. Brm EGR mir-99a-3p +.<.5<. ±.2-..6-.5 - - <.2 <.6 <. Type Cell line Origin Brm EGR 99a-3p 2 SW3 Adrenal carcinoma..45.7 2 HuTu8 (AZ52) Duodenum adenocarcinoma..99.32 2 NCI-H522 NSCLC..43. 2 C33A Cervical carcinoma...8 2 A427 Lung carcinoma..6.7 2 H23 NSCLC..26. Lung carcinoma.34.. H299 NSCLC.28.. HT29 Colorectal adenocarcinoma.46.8. HCT6 Colorectal adenocarcinoma.5.5.5 Cervical carcinoma.44.. KB Cervical carcinoma.4.. Panc- Pancreatic carcinoma.5.. DLD- Colorectal adenocarcinoma.58.3. SW62 Colorectal adenocarcinoma.89.5.4 MKN45 Gastric adenocarcinoma.2.4. MDA-MB23 Mammary adenocarcinoma..4. SUM49PT Ductal carcinoma.37.2. HCC937 Ductal carcinoma.72.6.3 H596 Lung adenosquamous carcinoma.96.3. MIA Paca2 Pancreatic carcinoma.2.4. PLC/PRF/5 Hepatoma.9.3. Huh7 Hepatoma.2.2. 3 MCF7 Mammary adenocarcinoma.78.9.4 3 GCIY Stomach carcinoma..4.4 3 MKN Stomach adenosquamous carcinoma.3.79.3
Supplementary Table 4. List of primer pairs used for qpcr and oligonucleotides used for shrna expression vector construction. Gene F R Gene F R KRT8 tcagctgaagaaggacctgg caactccacgaagctctcca CD44v tctttcaatgacaacgcagca ttgggtctcttcttccacctg CADM cgtgacagtgatcgagggag tttcctgtgggggatcggta KRT7 aatgagtttgtggtgctgaagaag gtcaactccgtctcattgaggg DDR gctggaaggaccgctgg agtcgggcaaccatgggg MET atgtgagatgtctccagcatttt gcaaagctgtggtaaactctgtt GSK3B tagtcgagccaaacagacgc tccaacaagaggttctgcgg EZH2 ctgcttcctacatcgtaagtgc tgagagcagcagcaaactcc IKBKB agactcagatctccccacgg ctgctgagacatggaagcca NOS3 gagtatgacgtggtgtccctc tccatcagggcagctgcaaa MAP3K5 accgggacataaagggtgaca tatgccagcaagcctctttga NOTCH2 agcactcaggtgtctgcatc ttctggcagggctgattctg NFKB ttctggaccgcttgggtaac aatggcattcagaccgtccc PTEN agtggcggaacttgcaatcctca tcccgtcgtgtgggtcctgaa RELA cctcctgttgtctcgaaccc tgccttttgcttcccaatcg KRT5 tggagggcgaggaatgcag catatccagaggaaacactgcttg SIRT tcagtgtcatggttcctttgc gttcatcagctgggcaccta KRT6A ttggtaaagcccagcccttcc agcaggactaggaatcaggctc SMAD4 ctggcctgttcacaatgagc tgtgcaaccttgctctctca Brm- acaaagggaaaggcaagaaaag gtcccacttccttctgactgtt CAV cgcgaccctaaacacctcaa gccgtcaaaactgtgtgtcc Brm-2 taagagtgcccggcagaaaa gagcttaattttcaccttgactga KRT4 aggagatcgccacctaccg cacatctctggatgactgcga Brm-3 cagggcgacagctcagtgaa ggctccggtacttatgattacga KRT9 gcgactacagccactactacac aatcctggagttctcaatggtg Brm-4 tgaccaaatgggcctcaaaga aaccaggcacaatcaaaccg STAT3 cccttggattgagagtcaaga aagcggctatactgctggtc EGR4 tcttcaacctcatgtcgggc gatccggggagtaaaggtcc AKT ggcaaggtgatcctggtgaa ggtcgtgggtctggaaagag BRG gagtgacgatgacagtgaggag atgccatctcagctctggac FN agtggaagtgtgagaggcac tgaggctgcggttggtaaac EGR- agcagcagcagcaccttc tctcgttgttcagagagatgtca GATA3 ctcttcgctacccaggtgac acgactctgcaattctgcga EGR-2 ccttcaaccctcaggcggac agcggccagtataggtgatg MTOR caggctggctcttgctcata ggtcacctgagggtgaactg EGR-3 ctacgagcacctgaccgc agtggtttggctggggtaac PDGFRA gtctggagcgtttgggaaggt gatctggccgtgggttttagc EGR-4 gggacatgctcacctctagc tctggagaaccgaagctcag SMAD cacccgtttcctcactctcc aaccgcctgaacatctcctc EGR2 ctttgaccagatgaacggagt gtctggtttctaggtgcagagac CAV2 ctcgcatctcaagctgggct tgaaggcagaaccattaggca EGR3 agagaaatgcctcggatgcc agatcaaactgccctgaggc CD44 tggcgcagatcgatttgaata ccgtccgagagatgctgtag EGR4 tcttcaacctcatgtcgggc gatccggggagtaaaggtcc shrna sense antisense Brm#5 tttgaagaaatgtggataaagatcgcttcctgtcacgatctttatccacatttcttcttttttg aattcaaaaaagaagaaatgtggataaagatcgtgacaggaagcgatctttatccacatttctt CD44# tttgaggaaacatttgacttatctgcttcctgtcacagataagtcaaatgtttcctcttttttg aattcaaaaaagaggaaacatttgacttatctgtgacaggaagcagataagtcaaatgtttcct CD44#2 tttgcccattgttcattcttgtgcgcttcctgtcacgcacaagaatgaacaatgggcttttttg aattcaaaaaagcccattgttcattcttgtgcgtgacaggaagcgcacaagaatgaacaatggg MET# tttgccactcatttagaattctaggcttcctgtcacctagaattctaaatgagtggcttttttg aattcaaaaaagccactcatttagaattctaggtgacaggaagcctagaattctaaatgagtgg MET#2 tttgtaatttgttgataaatatttgcttcctgtcacaaatatttatcaacaaattacttttttg aattcaaaaaagtaatttgttgataaatatttgtgacaggaagcaaatatttatcaacaaatta CAV# tttggtaatttgagagaaatatgagcttcctgtcactcatatttctctcaaattaccttttttg aattcaaaaaaggtaatttgagagaaatatgagtgacaggaagctcatatttctctcaaattac CAV#2 tttggaataagttcaaattcttctgcttcctgtcacagaagaatttgaacttattccttttttg aattcaaaaaaggaataagttcaaattcttctgtgacaggaagcagaagaatttgaacttattc CAV2# tttgctttagtacaatagtatacagcttcctgtcactgtatactattgtactaaagcttttttg aattcaaaaaagctttagtacaatagtatacagtgacaggaagctgtatactattgtactaaag CAV2#2 tttgctaataagtgacaaataagagcttcctgtcactcttatttgtcacttattagcttttttg aattcaaaaaagctaataagtgacaaataagagtgacaggaagctcttatttgtcacttattag