Control 7 d cold 7 d CL

Similar documents
Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT

SUPPLEMENTARY INFORMATION

Suppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

SUPPLEMENTARY INFORMATION

Thermogenic adipocytes promote HDL turnover and reverse cholesterol transport

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism

Supplementary Materials for

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Supplementary Figure 1

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

High density lipoprotein metabolism

Supplementary Information

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

The use of mass spectrometry in lipidomics. Outlines

Supporting Information

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota

Supplementary Figure 1

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

Lipids digestion and absorption, Biochemistry II

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

Nature Genetics: doi: /ng.3561

Reviewer #1 (Remarks to the Author)

2.5. AMPK activity

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Lipoproteins Metabolism

Niacin Metabolism: Effects on Cholesterol

Lipid/Lipoprotein Structure and Metabolism (Overview)

Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)

Quantitative Real-Time PCR was performed as same as Materials and Methods.

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR

SUPPLEMENTARY INFORMATION

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

Supplementary Figure 1

Enrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents

glpx Rv1100 Probe 4.4 kb 75 kda 50 kda 37 kda 25 kda 20 kda

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Laboratory for Experimental Vascular Medicine, Leiden University Medical Center, Leiden, the

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

Supplemental Information

Metabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients

Supporting Information Table of content

Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue

PLASMA LIPOPROTEINS AND LIPIDS DETERMINATION OF PLASMA CHOLESTEROL AND TRIGLICERIDE LEVEL

Supplemental Material. Results

Modulation of VLDL triglyceride metabolism

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Pathophysiology of Lipid Disorders

Reduction in Serum Lecithin:Cholesterol Acyltransferase Activity Prior to the Occurrence of Ketosis and Milk Fever in Cows

Mfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity

Supplementary Figure 1.

Supplementary Information

The role of apolipoprotein D in lipid metabolism and metabolic syndrome

Mass Spectrometry based metabolomics

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Table S1. Quantitative RT-PCR primers

Supplementary Figure 1.

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization

Chapter VIII: Dr. Sameh Sarray Hlaoui

stable I. Diet Ingredients Diet Group (g/100 g Dry Weight) High!-3 Low!-3 High!-6 Variable diet fat Palm oil Olive oil Safflower oil 0

SUPPLEMENTARY INFORMATION

Is it really that simple? Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics

SUPPLEMENTARY INFORMATION

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplemental Material:

Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1

Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia

The ddy mouse: a model of postprandial hypertriglyceridemia in response to dietary fat

SUPPLEMENTARY INFORMATION

Cover Page. The handle holds various files of this Leiden University dissertation

Supplemental information

SUPPLEMENTARY,INFORMATIONS,,,, mtorc1,is,required,for,brown,adipose,tissue,recruitment,and, METABOLIC,ADAPTATION,TO,COLD,!! Sébastien!M.!

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

WILL ABSENCE OF GPAT1 IMPROVE DIET-INDUCED ATHEROSCLEROSIS IN APOE HETEROZYGOUS MICE? PEI-CHI WU

Cover Page. Author: Boon, Mariëtte Title: Turning up the heat : role of brown adipose tissue in metabolic disease Issue Date:

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.

Transcription:

Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with 3-adrenergic receptor agonist 316,243 () for 7 days. Interscapular rown adipose tissue (ibat), inguinal white adipose tissue (iwat) and gonadal white adipose tissue (gwat) were dissected, fixed in paraformaldehyde and paraffin sections were HE-stained. Bar = 5 µm.

Ucp1 mrna expression per 1 6 Tp Ppargc1a mrna expression per 1 4 Tp a 12 8 16 12 8 4 4 ibat epiwat gwat ingwat iwat ibat epiwat gwat ingwat iwat Supplementary Figure 2. BAT activation and WAT rowning indicated y increased Ucp1 and Ppargc1a expression. C57BL6/J wild-type mice were exposed to 4 C or treated with 316,243 () for 7 days. (a) Ucp1 and () Ppargc1a gene expression were determined in interscapular rown adipose tissue (ibat), inguinal white adipose tissue (iwat) and gonadal white adipose tissue (gwat). Values are means ± s.e.m. (n=5 per group). Significance was calculated using unpaired two-tailed Student s t-test. P.5, P.1, P.1, versus mock.

HDL protein content (ng/ml) HDL protein content (ng/ml) HDL protein content (ng/ml) ApoA1 ApoA5 ApoC3 3, 15 25 25, 2 2, 15, 1, 1 5 15 1 5, 5 warm cold warm cold warm cold Supplementary Figure 3. Apolipoprotein levels in isolated HDL are unchanged upon cold exposure. C57Bl/6J wild-type mice were housed under thermoneutral (warm) or cold conditions for 7 days. HDL were isolated y FPLC from plasma samples of fasted mice (n=4 per group) and apolipoprotein content of murine ApoA1, ApoA5 and ApoC3 associated with HDL were determined y commercial ELISAs (Cloud Clone Corp, USA). Values are means ± s.e.m.

Triglycerides (mg/dl) Triglycerides (mg/dl) Triglycerides (mg/dl) Triglycerides (mg/dl) Triglycerides (mg/dl) Triglycerides (mg/dl) a c 3 2 1 3 2 1 C57BL/6J Apoa5 / E3L.CETP 3 TRL 4 TRL TRL 3 2 2 1 1 14 28 14 28 14 28 d e f 14 28 Supplementary Figure 4. Plasma lipoprotein triglyceride profiles determined y FPLC. C57BL/6J wild-type mice, Apoa5 / mice and E3L.CETP mice were either mock-treated, exposed to cold or treated with 316,243 () for 7 days. Individual plasma samples were separated y FPLC and triglyceride levels were determined in each fraction. Values are means (n=4-5 per group). 14 28 C57BL/6J Apoa5 / E3L.CETP 3 TRL 4 TRL 2 3 cold TRL 2 1 1 14 28

a c PC 4:6 PC 38:6 PC 38:5 PC 38:4 PC 36:3 PC 36:2 PC 36:1 PC 34:3 PC 34:2 PC 34:1 CE 2:4 CE 18:2 CE 18:1 CE 16:1 CE 16: Change (% of total PC) -1 1 Apoa5 / Apoa5 / Change (% of total CE) -2-1 1 2 d E3L.CETP Change (% of total PC) -1 1 E3L.CETP Change (% of total CE) -1 1 Supplementary Figure 5. Lipidomic changes of TRL from Apoa5 / and E3L.CETP mice after thermogenic activation. Apoa5 / mice and E3L.CETP mice were either mocktreated, exposed to cold or treated with 316,243 () for 7 days. Lipids of TRL from (a,c) Apoa5 / and (,d) E3L.CETP mice were determined y MS-CID (Lyso-PCs were undetectale). Changes of (a,) PC and (c,d) CE species are presented relative to mocktreated mice as change of % (weight) of total lipid class. For example, if a PC species has an aundance of 2% of total PC and increases to 25% of total PC after thermogenic stimulation, this is shown as +5%. Calculated values are mean ± s.e.m. (n= 4-5 per group). P<.5, P<.1, P<.1, versus mock (Student s t-test).

Triglycerides (mg/dl) Triglycerides (mg/dl) a 15 1 TRL Lean Control 15 1 TRL Oese Control 5 5 14 28 14 28 Supplementary Figure 6. Triglyceride lipoprotein profiles of plasma samples from lean and oese humans efore and after cold activation. Plasma lipoprotein profiles from (a) lean and () oese sujects untreated (control) or cold exposed (cold) were determined y FPLC. Values are mean ± s.e.m. (n= 1 per group).

LPL activity (mu) LPL activity (mu) LPL activity (mu) a 2, iwat 2, gwat 1,5 1, 1,5 1, 5 5 fasted re-fed fasted re-fed fasted re-fed fasted re-fed fasted re-fed fasted re-fed c 3, 2,5 ibat 2, 1,5 1, 5 fasted re-fed fasted re-fed fasted re-fed Supplementary Figure 7. LPL activity in adipose tissues in fasted and refed mice after cold or 3-adrenergic receptor stimulation. Mice were exposed to 4 C or treated with 1 mg/kg 316,243 () for 7 days. Tissues were harvested after a 4 h fasting period or after 4 h fasting and susequent 3 h re-feeding. LPL activity was determined in tissue homogenates of (a) iwat, () gwat and (c) ibat using radioactive sustrate as descried (1). Values are means ± s.e.m. (n=5-6 per group). Significance was calculated using unpaired two-tailed Student s t-test. P.5, P.1, P.1, fasted versus re-fed. 1.) Dijk W, Heine M, Vergnes L, Boon MR, Schaart G, Hesselink MK, Reue K, van Marken Lichtenelt WD, Olivecrona G, Rensen PC, Heeren J, Kersten S. ANGPTL4 mediates shuttling of lipid fuel to rown adipose tissue during sustained cold exposure. Elife. 215; 4. pii: e8428.

a 125 I-HDL (cpm/mg organ) 15 1 5 Fasted warm Fasted cold 125 I-HDL (cpm/mg organ) 5 4 3 2 1 Refed warm Refed cold c d 125 I-HDL (cpm/mg organ) 16 12 8 4 125 I-HDL (cpm/mg organ)l 2 16 12 8 4 Scar1-/- / Supplementary Figure 8. -induced accelerated HDL-turnover is dependent on adipocyte LPL and SR-BI. 125 I-protein shell- and 3 H-cholesterolether core-laeled HDL were injected into fasted (a) and refed () C57BL/6J wild-type mice () which had een either cold-exposed for 7 days (cold) or kept under control conditions at 28 C (warm). Doule-laeled HDL were also injected into fasted mice with adipocyte-specific LPL knockout () (c) and Scar1 / mice (d) and controls, all cold-treated for 7 days. 125 I-HDL organ uptake was measured 5 h after injection. Values are mean ± s.e.m. (n= 5-7 per group). P<.5, P<.1, P<.1 (Student s t-test).

Cholesterol (mg/dl) Cholesterol (mg/dl) Triglycerides (mg/dl) Triglycerides (mg/dl) Triglycerides (mg/dl) Cholesterol (mg/dl) a 4 15 3 2 1 1 5 c 3 2 d 3 2 1 1 e 1 8 14 28 FPLC fraction f 1 8 14 28 FPLC fraction 6 6 4 4 2 2 14 28 FPLC fraction 14 28 FPLC fraction Supplementary Figure 9. LPL-dependent plasma lipid and lipoprotein profiles after thermogenic activation. Adipocyte-specific LPL knockout () mice and wild-type littermate control () mice were treated for 7 days with the β3-adrenergic agonist 316,243 () or saline (mock). Total plasma (a) triglycerides and () cholesterol levels. FPLC profiles of (c, d) triglycerides and (e, f) cholesterol of wild type (c, e) and (d, f) mice. Values are mean ± s.e.m. (n= 4 per group). P<.5 (2-way ANOVA). For FPLC analysis, plasma samples from each group were pooled.

a Change (% of total TRL PC) -1-5 5 1 Change (% of total TRL TG) -7-4 4 7 PC 4:6 TG 54:5 PC 38:6 TG 54:4 PC 38:5 TG 54:3 PC 38:4 PC 36:3 PC 36:2 PC 36:1 TG 54:2 TG 52:4 TG 52:3 TG 52:2 PC 34:3 TG 5:3 PC 34:2 TG 5:2 PC 34:1 TG 5:1 c Change (% of total TRL CE) -15-8 8 15 CE 2:4 CE 18:2 CE 18:1 CE 16:1 CE 16: Supplementary Figure 1. Changes in TRL lipid composition induced y thermogenic activation are dependent on LPL. Adipocyte-specific LPL knockout () mice and wild-type littermate control () mice were treated for 7 days with the β3-adrenergic agonist 316,243 () or saline (mock). Lipids of TRL particles isolated y FPLC analysis (fractions 3-6; see supplementary figure 8) were determined MS-CID. Changes of (a) PC, () TG and (c) CE species are presented relative to mock-treated mice as change of % (weight) of total lipid class. For example, if a PC species has an aundance of 2% of total PC and increases to 25% of total PC after thermogenic stimulation, this is shown as +5%.

a Change (% of total HDL PC) Change (% of total HDL TG) -5-3 3 5-5 -3 3 5 PC 4:6 TG 54:5 PC 38:6 TG 54:4 PC 38:5 PC 38:4 PC 36:3 TG 54:3 TG 54:2 TG 52:4 PC 36:2 TG 52:3 PC 36:1 TG 52:2 PC 34:3 PC 34:2 PC 34:1 TG 5:3 TG 5:2 TG 5:1 c Change (% of total HDL LysoPC) -12-6 6 12 d Change (% of total HDL CE) -5-3 3 5 Lyso-PC 2:4 Lyso-PC 18:2 Lyso-PC 18:1 Lyso-PC 18: Lyso-PC 16: CE 2:4 CE 18:2 CE 18:1 CE 16:1 CE 16: Supplementary Figure 11. Changes in HDL lipid composition induced y thermogenic activation are dependent on LPL. Adipocyte-specific LPL knockout () mice and wild-type littermate control () mice were treated for 7 days with the β3-adrenergic agonist 316,243 () or saline (mock). Lipids of HDL isolated y FPLC analysis (fractions 17-2; see supplementary figure 8) were determined MS-CID. Changes of (a) PC, () TG, (c) Lyso-PC and (d) CE species are presented relative to mock-treated mice as change of % (weight) of total lipid class. For example, if a PC species has an aundance of 2% of total PC and increases to 25% of total PC after thermogenic stimulation, this is shown as +5%.

Control 82 64 49 37 SR-BI -actin Control 82 64 49 37 SR-BI -actin Supplementary Figure 12. Hepatic SR-BI expression is unaltered after cold exposure in wild type mice. C57BL/6 wild-type mice were housed at warm conditions (control) or exposed to cold for 7 days. Western lot of liver memrane fractions from two independent experiments are shown (n=3-4 per group). Molecular weights are given in kda.

Compound Product Purity Concentration in Supplier Numer (%) extract (µg/ml) 1 1,2-Dipentadecanoyl-sn-glycero-3- phosphatidylcholine P7285 Sigma aldrich 99 6.25 2 Cholest-5-en-3ß-yl heptadecanoate 11864 Avanti polar 99 31.25 3 Glyceryltritridecanoate T7517 Sigma aldrich 99 6.25 4 N-Heptadecanoyl-D-erythrosphingosine 5 1-Heptadecanoyl-2-hydroxy-snglycero-3- phosphocholine 6 1,2-diheptadecanoyl-sn-glycero-3-86517 Avanti polar 11686 Avanti polar 11886 Avanti polar phosphoethanolamine 7 1-pentadecyl-3-(9Z-octadecenyl)-racglycerol 11593 Avanti polar 8 1,3(d5)-Dipentadecanoyl-glycerol 11536 Avanti polar 9 N-Heptadecanoyl-D-erythro- 86585P 99 6.25 99 6.25 99 6.25 99 6.25 99 6.25 Avanti polar 99 6.25 s phingosylphosphorylcholine 1 1,2-Di-O-tridecyl-sn-glycero-3-999988P Avanti polar 99 6.25 phosphocholine 11 1,2-Ditetradecanoyl-sn-glycero-3-8433 Avanti polar 99 6.25 phospho-l-serine 12 1,2-Diheptadecanoyl-sn-glycero-3-83856P Avanti polar 99 6.25 phosphate 13 Heptadecanoic acid H35 Sigma aldrich 98 13.5 Suppl. Tale 1: Constituent compounds serving as internal standards for high resolution lipidomic measurements

Lipid species Fatty acid compostion Precursor ion (measured) m/z PC 4:6 18:/22:6 [M-H] - 832.5861 283.27 327.21 PC 38:6 18:2/2:4 [M-H] - 84.5548 33.22 279.22 PC 38:5 2:4/18:1 [M-H] - 86.574 33.24 281.25 PC 38:4 2:4/18: [M-H] - 88.5861 33.24 283.24 PC 36:3 18:1/18:2 [M-H] - 782.575 281.25 279.24 PC 36:2 18:2/18:, 18:1/18:1 Product ions (measured) m/z [M-H] - 784.5861 279.24 281.24 283.24 PC 36:1 18:1/18: [M-H] - 786.618 281.25 283.27 PC 34:3 no MS/MS [M-H] - 754.5392 PC 34:2 18:2/16: [M-H] - 756.5548 28.23 255.24 PC 34:1 18:1/16: [M-H] - 758.575 281.25 255.24 TG 5:1 16:/16:/18:1 [M+NH4] + 85.7858 577.51 551.5 TG 5:2 18:1/16:1/16:, 18:1/18:1/14: [M+NH4] + 848.771 549.47 575.5 577.51 63.53 TG 5:3 18:1/16:1/16:1 [M+NH4] + 846.7754 547.47 575.5 TG 52:2 18:1/18:1/16: [M+NH4] + 876.814 577.51 63.53 TG 52:3 18:1/18:1/16:1 [M+NH4] + 874.7854 575.5 63.53 TG 52:4 16:1/18:1/18:2 [M+NH4] + 872.771 61.51 573.48 575.5 TG 54:3 18:1/18:1/18:1 [M+NH4] + 92.817 63.53 TG 54:4 18:1/18:1/18:2 [M+NH4] + 9.814 61.51 63.53 TG 54:5 18:1/8:2/18:2 [M+NH4] + 898.7857 599.5 61.51 TG 56:6 no MS/MS [M+NH4] + 924.814 TG 56:7 no MS/MS [M+NH4] + 922.7857 TG 56:8 no MS/MS [M+NH4] + 92.771 TG 58:9 no MS/MS [M+NH4] + 946.7857 sn-position not determined Suppl. Tale 2: Fatty acid (FA) composition of lipid species esterified with more than 2 FAs

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback