Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

Similar documents
Supplementary Figure 1

SUPPLEMENTARY INFORMATION

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse

TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement

GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!

Supplementary Table 1. List of primers used in this study

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

SUPPLEMENTARY INFORMATION

Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY FIGURES

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Neocortex Zbtb20 / NFIA / Sox9

Supplemental Figures Supplemental Figure 1:

Supplementary Materials

Zhu et al, page 1. Supplementary Figures

Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells

Supplementary Information

SUPPLEMENTARY LEGENDS...

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

SUPPLEMENTARY FIGURES

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

SUPPLEMENTARY INFORMATION

Supplementary Materials

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Supplementary Figure 1

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous

An unconventional role for mirna: let-7 activates Toll-like receptor 7 and causes neurodegeneration

Supplementary Information

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms

Supplemental Table S1

Supplemental Figures:

Research Development: Bedside to Bench and Back

Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table. File Name: Peer Review File Description:

mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons

In vivo reprogramming reactive glia into ipscs to produce new neurons in the

Nature Neuroscience: doi: /nn Supplementary Figure 1

Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts

Expanded View Figures

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.

TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge

Nature Neuroscience: doi: /nn Supplementary Figure 1

Supplementary Information

SUPPLEMENTARY INFORMATION

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

Cord blood monocytes as a source of cell therapy products for treatment of brain injuries ISCT/CBA 2015 Cord Blood Workshop Wednesday, May 27, 2015

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

SUPPLEMENTARY INFORMATION. The Calcium-activated Chloride Channel Anoctamin 1 acts as a Heat. Sensor in Nociceptive Neurons

Supplementary Figure 1

supplementary information

Supplementary Figure 1

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB

Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/-

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis

Supplemental Information. Ca V 2.2 Gates Calcium-Independent. but Voltage-Dependent Secretion. in Mammalian Sensory Neurons

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad

Chapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit

Supplementary Figure 1. Microglia do not show signs of classical immune activation following MD a-b. Images showing immunoreactivity for MHCII (a)

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Supplementary Figure 1

Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1.

Supplementary Figure 1: Kv7 currents in neonatal CA1 neurons measured with the classic M- current voltage-clamp protocol.

SUPPLEMENTARY FIGURE LEGENDS

T H E J O U R N A L O F C E L L B I O L O G Y

Supplementary Materials for

Nature Medicine: doi: /nm.4324

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Nature Neuroscience: doi: /nn.2275

Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of

Transcription:

Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang, Yuehong Gao, Guimiao Chen, Hui Lin, Yu Hu, Di Wu, Meng Shi, Wenting Xie, Hao Sun, Zhicheng Shao, Huifang Li, Kunkun Zhang, Wei Mo, Timothy Y. Huang, Maoqiang Xue, Zengqiang Yuan, Xia Zhang, Guojun Bu, Huaxi Xu, Qi Xu, and Jie Zhang

Supplemental Information for Menin deficiency leads to depressive-like behaviors in mice by modulating astrocyte-mediated neuroinflammation Inventory of Supplemental Information: Supplemental Figures and Figure Legends: 1

Figure S1. Mouse menin levels are attenuated and IL-1 levels are elevated in the Nucleus accumbens after CUMS, related to Figure 1 and Figure 3. Male C57BL/6 mice were exposed to chronic unpredictable mild stress (CUMS). A. Men1 mrna levels in the Nucleus accumbens of CUMS/Control mouse brain. n=6 experimental replicates/group. B. IL-1 mrna levels in the Nucleus accumbens of CUMS/Control mouse brain. n=6 experimental replicates/group. Data represent mean±sem, *p<0.05, ***p<0.001, one-way ANOVA with Turkey post hoc test. 2

Figure S2. Menin expression in neurons, microglia, astrocytes, and oligodendrocyte progenitor cells (OPCs), and oligodendrocytes in GcKO and control mouse brain, related to Figure 1 and 2. (A) Primary neurons, astrocytes, microglia, OPCs and oligodendrocytes were cultured as described in Methods. Neurons were stained with MAP2 and DAPI; astrocytes were stained with GFAP and DAPI, Microglia were stained with Iba1 and DAPI; OPC were stained with PDGFR and DAPI; Oligodendrocytes were stained with CC1 (Anti-adenomatous polyposis coli-apc) and DAPI; as indicated in Red (Iba1: Green) and Blue respectively. Scale bar: 100um. Purity of primary neurons or astrocyte cultures were also provided respectively. (B-C) Menin levels were detected by western blotting (B) and Real-time PCR (C) in the indicated cell types (neurons, microglia, astrocyte, OPC and Oligodendrocyte). TuJ1, Iba1, GFAP and Oligo2 were used as cell-specific markers for neurons, microglia, astrocytes and oligodendrocytes respectively, GAPDH served as a loading control. Data represent mean±sem, n=3 experimental replicates/group; **p<0.01, ***p<0.001, one-way ANOVA with Tukey s post hoc test. (D) Double immunofluorescence staining of menin (green) with CC1 (Red) or PDGFR (red) in mouse cortex regions. Arrows indicate that menin is barely detectable in oligodendrocytes in vivo (Scale bar: 100μm) (E) MBP (Myelin basic protein) staining in cortex (E1) and hippocampus (E2) of GcKO/control mice indicates that myelination is not significantly changed in GcKO animals. (Scale bar: 100μm) 3

Figure S3. GFAP-Cre and Fgfr3-iCre(ER) mediated Men1 reduction in mice (GcKO and FcKO), related to Figure 2. (A) Body weight of GcKO and littermate Control mice (control:n=20 mice;gcko: n=12 mice). (B) Brain weight of one-month old GcKO and littermate control mice. (C) Kaplan-Meier survival curves from GcKO and control mice. (Control mice: n>50, GcKO mice: n>50). (D) Menin and PSD95 protein levels were significantly lower in cortex from GcKO mice compared to controls. n = 3 mice per group. (E-F) Double immunofluorescence staining of menin (green) with GFAP (E) or NeuN (F) reveal reductions in menin expression in astrocytes in GcKO mouse cortex. (Scale bar: 20μm). Astrocyte and neuron numbers were also quantified and presented in the adjacent panels (right). n > 100 cells from 6 slices from 3 mice respectively. (G) Brain sections from postnatal three-month GcKO and Control mice were subjected to Nissl staining. Layer I, Layer II-V, and Layer VI measurements were quantified by Image J. Scale bar: 100μm, 20μm, 20μm respectively. (H-J) Tamoxifen-induced menin reduction in FcKO mice; (H) Menin protein levels were significantly reduced in tamoxifen-treated FcKO mouse cortex compared to controls. n=3 mice per group. (I) Double immunofluorescence staining to detect menin (green) and GFAP (red) in tamoxifen-treated FcKO and control mouse cortex; menin expression is markedly reduced in astrocytes in FcKO mouse cortex (Scale bar: 20μm). Astrocyte numbers was also quantified and presented in the panels on the righthand side. n > 100 cells from 6 slices from3 mice respectively. (J) No significant difference in brain weight was observed between 1 month old FcKO and control mice. (Control: n=11 mice;fcko: n=10 mice) Data represent mean±sem, n.s.: not significant, *p<0.05, ***p<0.001, A, unpaired t test,b-j, one-way ANOVA with Tukey s post hoc analysis. 4

Figure S4. Behavioral tests in GcKO and control mice, related to Figure 2. (A) GcKO and control mice behavior in Rotarod tests. (B) GcKO and control mice behavior in Open field tests. (C) GcKO and control mice behavior in High plus maze tests. (D-E) GcKO and control mice behavior in Morris Water Maze test. (Control: n=15mice;gcko: n=12 mice) Data represent mean±sem, n.s.: not significant,*p<0.05, **p<0.01, one-way ANOVA with Tukey s post hoc analysis. 5

Figure S5. Iba1 staining in the mpfc region of control and GcKO mice treated with IL-1 -RA, related to Figure 3 and Figure 5. (A) GcKO and control mice brain slices were subjected to Iba1 (red) and DAPI (blue) staining. Scale bar: 20μm, 5μm respectively. (B) Characterizing Iba1-positive cells number, morphological parameters include cell body size and total processes length in microglia. At least 20 cells each from three mice were selected to quantify the morphological parameters. (n > 20 cells from 6 slices from 3 mice respectively) (C) Iba1 staining in the mpfc region of Control and GcKO mice treated with saline or IL-1 -RA. Scale bar: 20μm, 5μm respectively. (D) Analyses of Iba1 positive cell number, size of cell body and total processes length in microglia. At least 20 cells each from three mice were selected to quantify the morphological parameters. (n > 20 cells from 6 slices from 3 mice respectively) Data represent mean±sem. n.s.: not significant, *p<0.05, **p<0.01, ***p<0.001, one-way ANOVA with Tukey s post hoc analysis. 6

Figure S6. p65 subcellular localization, IL-1 expression and NF B-mediated transactivation in CHG5 and HEK293 cells with LPS, related to Figure 3. (A) MEN1 and IL-1 expression levels as determined by qrt-pcr in CHG5-MEN1 stable and control cells. Menin protein expression is shown in the lower panel. n=3 experimental replicates/group. (B) NF B-mediated transactivation in CHG5 cells with stable MEN1 overexpression compared to controls. n = 6/group/experiment. (C) IL-1 protein levels in CHG5 cells measured by ELISA. n=6 experimental replicates/group. (D) Menin expression in HEK293T cells transfected with GFP control, GFP-MEN1, scrambled sirna, or shmen1 sirna. (E-F) NF B-mediated transactivation in HEK293T cells with menin overexpression (E) or knockdown (F). n=6 experimental replicates/group. (G) HEK293T cells were transfected with GFP and GFP-MEN1 plasmids, and subsequently treated with LPS as indicated. NF B-dependent transactivation was measured by Luciferase assay. (H) Menin and p65 protein levels in cytoplasmic and nuclear fractions from GcKO and control mouse brain cortex. Quantification of p65 levels are shown in the right panels, n=3 experimental replicates/group. (I) Menin and p65 protein levels in cytoplasmic and nuclear fractions from CHG-5 control vector (CHG- 5V) and CHG-5-MEN1 (CHG-5M) stably expressing cell lines. Quantification of p65 levels are shown in the right panels, n=3 experimental replicates/group. Data represent mean±sem, n.s.: not significant, *p<0.05, **p<0.01, ***p<0.001, one-way ANOVA with Tukey s post hoc analysis. 7

Figure S7. Synaptic proteins levels and IL-1 expression in GcKO and control mice treated with saline or IL-1 -RA, related to Figure 5. Two-month old GcKO and littermate controls mice treated with an NF- B inhibitor (PDTC) or an IL- 1β-R-Antagonist (IL-1 -RA) for 7 days. After behavioral analysis, cortex and hippocampus were processed for western blotting, ELISA and RT-PCR. Western blot analysis of protein expression in cortex (A-B) and hippocampus of GcKO (E-F) and control mice received saline or IL-1 -RA. Immunoblots were probed with antibodies against the indicated proteins. n=4 experimental replicates/group. IL-1 protein and mrna levels were measured in cortex (C-D) and hippocampus (G-H) of GcKO and control mice treated with saline or IL-1 -RA. n=4 experimental replicates/group. Data represent mean±sem. *p<0.05, **p<0.01, ***p<0.001, one-way ANOVA with Tukey s post hoc analysis. 8

Figure S8. rs375804228 (G503D) does not alter transcription, protein expression, protein turnover, or cellular localization profiles in menin, related to Figure 6. (A-B) HEK293T cells transfected with a GFP control vector, or GFP-WT-MEN1, GFP-MEN1-G503D, GFP-MEN1-D418D, and GFP-MEN1-A541T were processed for mrna (A) and protein (B) expression analysis by qrt-pcr/western blotting. Quantitation is shown in the bottom panels. n = 6 experimental replicates/group. (C-D) HEK293T cells were transfected with GFP control vector, GFP-WT-MEN1, GFP-MEN1(G503D), GFP-MEN1(D418D), and GFP-MEN1(A541T) constructs. Cells were exposed to cycloheximide for the time indicated, and menin degradation was determined by western blotting. Representative blots are shown in panel C; Quantification of menin protein turnover is shown in D. Menin levels were standardized to GAPDH and normalized to time 0 (set to 100%). n=3 experimental replicates/group. (E) Menin and p65 localization was determined by GFP and p65 co-staining in HEK293T cells transfected with GFP, GFP-MEN1(WT), GFP-MEN1(D418D), GFP-MEN1(G503D) and GFP- MEN1(A541T) plasmids. (Scale bar: 20μm). (F) p65 protein levels in HEK293T cytoplasmic and nuclear fractions in cells transfected with GFP, GFP- MEN1 or GFP-MEN1(G503D) as determined by western blotting. Quantification of band intensities are presented on right panel, n=3 experimental replicates/group. Data represent mean±sem. n.s.: not significant,***p<0.01, one-way ANOVA with Turkey post hoc test. 9