formance Inflammation Recovery Digestion Fertility Endurance Calm

Similar documents
Understanding Blood Tests

Clinician Blood Panel Results

10 Essential Blood Tests PART 1

Multiphasic Blood Analysis

Is Your Feeding Program up to Snuff?

HEMOTOLOGY. B. Helps stabilize body temperature -heats up and cools down slowly which moderates body temp

Routine Clinic Lab Studies

The Blood Chemistry Panel Explained

Blood Test Results Report

M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017

Clinician Blood Panel Results

Gastrointestinal Markers

Results Report. Welcome to Your ABT Report!

Complete Medical History

UNDERSTANDING YOUR WATER PROFILE PRESENTED BY POULTRY PARTNERS AND AHPD

Get to know yourself better. Attend our health screening event.

Chapter 15 Food and Digestion

Rapid Laboratories In House Tests

Buckeye Nutrition Products

Premium E & Se Powder

CULINARY HERBS AND SPICES

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1

TABLE OF CONTENTS. Introduction...5 What the Wrong Kind of Water...5 Benefits of Alkaline Water...8

Delta Check Calculation Guide

Update nutrition technology that s made. promoter or without additional hormone

TEST NAME:Cells and Health TEST ID: GRADE:08 - Eighth Grade SUBJECT:Life and Physical Sciences TEST CATEGORY: School Assessment

Chickens for Fattening Tolerate Nonanoic Acid Added to Diet at Levels up to 1000 mg/kg Feed

Results Report. Welcome to Your ABT Report! Introduction to the ABT Report

ZOOLOGY/SCIENCE OF ANIMAL NUTRITION AG

Get to know yourself better. Attend our health screening event.

What Does My Blood Test Mean

VITAMINS, MINERALS AND THE GUT

Topic 3.1 Nutrients. - Lipids are an essential part of the and are a part of cell in the body.

What is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of

Clinician Blood Panel Results

Animal Digestion and Nutrition. Objective 7.02: Understand the digestive process

EFFECT OF AN ALUMINUM SUPPLEMENT ON NUTRIENT DIGESTIBILITY AND MINERAL METABOLISM IN THOROUGHBRED HORSES

Arbonne PhytoSport. Collection Focus Guide. Did You Know? SCIENCE AND EDUCATION. Carbohydrates. Proteins

Animal Digestion and Nutrition

LOOK, FEEL AND LIVE BETTER

*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible:

no concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis

Nutrition and Energy 1

Unit Seven Blood and Immunity

BENEFITS OF STOP HUNGER NOW MEALS TO CHILDREN

Chapter 15 Food and Digestion

Chapter 11: Range Animal Nutrition

Laboratory Accreditation Programmes

WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

6 Nutrients Essential for Life

Nutrition #3 Created for Canadian Pony Club Education By Lezah Williamson

Arbonne PhytoSport. Collection Focus Guide. Did You Know? SCIENCE AND EDUCATION. Carbohydrates. Proteins

NORMAL LABORATORY VALUES FOR CHILDREN

Ruminant Health, Vitamin, Minerals & Nutrition. Presented by Marty Ulrich

Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS

CULINARY HERBS AND SPICES

Nutrition. University of Wyoming D. Karen Hansen, PhD 2007 Stephen R. Schafer, EdD

Kathryn Jones 8/11/2015

BC Biomedical Laboratories Adult Reference Ranges

Bioavailability of Low Dose Plant Derived Minerals and Amino Acids, ph BALM (ph balanced, Bio Available Living Minerals)

EXSC- STANDARD 14. Nutrients

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

SMITH, JOHN D.C. Functional Health Report. Patient Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units

ROUTINE LAB STUDIES. Routine Clinic Lab Studies

a) Determine the HgB values for the patient samples to fill in the table below. (15 points total) (g/dl) (%) 1 (Female)

A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis.

FulvicForce offers an ideal replacement for. creatine. FulvicForce boosts immune system and fights. inflammation. FulvicForce is effective in weight

Section 5 Feeds and Feeding of Commercial Poultry Notes

Name Date Class. 2. Is the following sentence true or false? Food is required for the body to. maintain homeostasis, keeping a steady internal state.

CPT David J. Licciardello, DVM Veterinary Advisor

Modified Monogastric Digestive System

Pigeon Health & Performance Products. Product information Instructions for use & dosage.

EquuSSource Webinar. Welcome to the EquuSSource Webinar. We will be starting shortly.

Feed Supplements and Veterinary Products

Arbonne, PhytoSportM. Collection Focus Guide. Did You Know? SCIENCE AND EDUCATION ARBONNE. Carbohydrates. Proteins

Nutrition is the study of the nutrients in food and how they nourish the body.

Total Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest

SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units

There are six general classes of nutrients needed in the horse s diet: water carbohydrates fats protein minerals vitamins.

DEVELOPMENT OF BEVERAGE PRODUCTS FROM YACON (Smallanthus sonchifolius)

Study Report Effects of Corn Distillers Dried Grains with Solubles (DDGS) Under Hot Summer Conditions in Lactating Dairy Cows

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)

SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION

CHARACTERISTICS. Recovery rate. Spore of Bacillus licheniformis

CONCEIVED, RESEARCHED & FORMULATED BY TEXANS

BUILDING HEALTHY SOILS AND PLANTS. Summary

SAFETY ASPECTS OF MIDAZOLAM

Frequently Asked Questions (FAQs)

Capillary Action and Blood Components. Biology 20 Unit D: Body Systems Circulation

Biacid: A EU approved natural growth promoter for Broilers

INTERPRETING FORAGE QUALITY TEST REPORTS

BARIKI ORGANICS 2015

BASIC METABOLIC PANEL

MUNs - It s only a Piece of the Puzzle!

Fighting Inflammation, Naturally

Online catalog

Section 4: Exercise Physiology. Diet and nutrition and their effect on physical activity and performance

Archival copy: for current recommendations see or your local extension office.

Transcription:

formance Inflammation Recovery Digestion Fertility Endurance Calm Inflammation Anti-Oxidant Endurance Fitness Performance Calmness

erformance Inflammation Recovery Digestion Fertility Endurance Ca EQUI-BOOST PLUS IS A 100% ORGANIC, NATURAL FORMULA SPECIFICALLY DESIGNED TO PROVIDE LONG-TERM DIGESTIVE SYSTEM HEALTH & JOINT SUPPORT WITHOUT ANY SIDE EFFECTS Equi-Boost Plus formula is designed to be an all-inclusive daily supplement to improve health and performance for all horses. It strongly supports digestive wellness, which increases nutrient absorption and helps build a stronger immune system. Our combination of 2 functional oils, Cashew Nut Shell Liquid and Castor Oil, contains active compounds of Ricinoleic Acid, Cardol and Cardanol. These ingredients have a natural anti-microbial effect, which helps to eliminate harmful bacteria and protozoa. The powerful anti-inflammatory properties of our active ingredients benefit all types of joint stiffness and muscular inflammation. BENEFITS (AFTER 21 DAYS OF DAILY SUPPLEMENTATION): Assists with joint pains related to inflammation. Supports an increase in blood oxygen levels resulting in improved fitness, endurance and performance. Supports improved recovery times from exercise, including reduced stiffness. Supports intestinal health resulting in a regular digestive system and greater absorption of nutrients in food. Supports a healthy coat. Supports fertility and increases sperm production in studs. Supports a stronger immune system. Supports balanced PH levels. Strong antioxidant compounds. An increased state of calmness. ALL INGREDIENTS ARE FDA APPROVED AND ARE MANUFACTURED IN THE USA. flammation Anti-Oxidant Endurance Fitness Performance Calmness

lmness Anti-oxidant Immunity Fitness Performance Inflammation Re FREQUENTLY ASKED QUESTIONS WHAT IS EQUI-BOOST PLUS MADE OF AND WHAT ARE THE ACTIVE COMPONENTS? Equi-Boost Plus is a combination of two functional oils; castor oil and cashew nut shell liquid (not the nut itself). The active components are ricinoleic acid, cardol, and cardanol. Ricinoleic acid comes from castor oil, with cardol and cardanol coming from cashew nut shell liquid. Vermiculite (silica) is used as a carrier. WHAT ARE THE TARGETED MICROBIAL CHALLENGES THAT EQUI-BOOST PLUS WILL HELP TO ALLEVIATE? The natural antimicrobial activity in Equi-Boost Plus has two modes of action (disrupting both monovalent and divalent cations) to disturb and destroy the cell walls of grampositive bacteria and protozoa. Having two modes of action not only makes the product more effective, but also significantly reduces the chances of resistance developing. Equi-Boost Plus is able to target strains of Eimeria, the protozoa that causes coccidiosis, as well as Clostridium, which causes necrotic enteritis. HOW DO I KNOW THAT THE RESULTS ARE GOING TO BE CONSISTENT? The levels of ricinoleic acid, cardol and cardanol get tested in the raw materials, during manufacturing, and of course in the final product. Using NIRS (near infrared spectroscopy) the levels of these three active components can even be tested after it has been mixed in feed. WHAT KIND OF CERTIFICATIONS ARE ASSOCIATED WITH THE PRODUCT AND ITS MANUFACTURING? Equi-Boost Plus has received the FAMI-QS Certification, a more stringent and feed additive/premix specific version of GMP. HOW IS EQUI-BOOST PLUS DIFFERENT THAN OTHER PHYTOGENICS (ESSENTIAL OILS)? Phytogenics, or essential oils, can be easily confused with Equi-Boost Plus due to the name and that both are plant based. However, phytogenics are made from herbs and spices with some of the most common being: thyme, rosemary, cinnamon, chili, and oregano. The active components of these ingredients are usually not standardized, which results in inconsistent and unreliable performance. The functional oils in Equi-Boost Plus are able to pass through the stomach and target the intestinal tract, where the microbial challenge is, whereas some phytogenics get broken down in the stomach. ARE THERE ANY RISKS OF TOXICITY? There has been no evidence or indications of toxicity or risk with over-dosing with Equi-Boost Plus. The castor bean plant is occasionally associated with the toxin ricin, however ricin is hydrophilic (water affinity) whereas castor oil is lipophilic (oil affinity). The process used to get castor oil eliminates ricin from contaminating the oil. Castor oil is also a common ingredient for many cosmetic products, as well as used as a laxative on its own. Recovery Immunity Digestion Fertility Anti-Oxidant Endurance Fitnes

erformance Inflammation Recovery Digestion Fertility Endurance Ca WILL I SEE ANY LAXATIVE EFFECTS? WHAT WILL I NOTICE IN FECES QUALITY? Quite the contrary, there will be a positive effect on feces quality. Equi-Boost Plus has a dosage of castor oil that can maintain its biological activity, without having a laxative effect. Between the decrease in microbial challenge and improved nutrient absorption, the feces will be drier and less odorous. Improvement in feces is commonly the first observed sign of activity after supplementing Equi-Boost Plus. CAN I INCLUDE EQUI-BOOST PLUS WITH OTHER FEED INGREDIENTS? Feed ingredients like acidifiers, pre/pro/syn-biotics, or enzymes can be included at the same time with no counter-indications. If there is a need for antibiotic treatment, the animal s response will be improved with Equi-Boost Plus due to improved overall health and immune response. HOW STABLE ARE THE ACTIVE COMPONENTS OF EQUI-BOOST PLUS? HOW SHOULD IT BE STORED AND WHAT IS THE SHELF LIFE? The activity of Equi-Boost Plus can handle a 3-year shelf life from date of manufacturing. The product should be kept out of direct sunlight and avoid getting wet (high humidity has no effect). The active ingredients can also handle high temperatures and are unaffected by extrusion, even for dog food (at ~150C). Equi-Boost Plus can undergo any processing for feed (pelleting, crumbles, extrusion, etc.) without losing activity or disrupting feed quality. WHAT IS THE RECOMMENDED DOSAGE OF EQUI-BOOST PLUS FOR HORSES? There has been research on the application of Equi-Boost Plus in horses, with a recommended dosage of 10g per day per horse, to be added to their feed as a supplement. WHEN SHOULD EQUI-BOOST PLUS BE INCLUDED IN THE DIET? Equi-Boost Plus should be supplemented to the feed ration of horses at the earliest stage possible. Including the product in the early stages of life will increase the probability of a healthy and well performing animal throughout its lifespan. The longer Equi-Boost Plus is included in the diet, the better performance the animal will have. When added to parent feed rations, the resulting offspring will be healthier and off to a better start. WHAT OTHER COUNTRIES ARE USING THIS PRODUCT? The ingredients of Equi-Boost Plus were developed in Brazil about 10 years ago but have been recently registered and now sold in: Malaysia, Philippines, Indonesia, South Korea, Vietnam, Thailand, South Africa, Colombia, Mexico and Spain. Several other countries are in the registration process with many more intended to begin registration. WHAT KIND OF CERTIFICATIONS ARE ASSOCIATED WITH THE PRODUCT AND IT S MANUFACTURING? The ingredients of Equi-Boost Plus are all FDA approved. Equi-Boost Plus has received the FAMI-QS Certification, a more stringent and feed additive / premix specific version of GMP. flammation Anti-Oxidant Endurance Fitness Performance Calmness

lmness Anti-oxidant Immunity Fitness Performance Inflammation Re EQUI-BOOST PLUS MODE OF ACTION Shown by own research Field trial observations backed by other research INTESTINAL FLORA METABOLISM Anti-Gram Positive Bacteria Enhanced Fibrolytic Microflora Improved Vasodilation Anti- Inflammatory Anti-Diaretic Anti-Oxidant Immunostimulant Less Acidosis No Glucose Peaks Better Cell Integrity Reduced Endotoxin Production Better Fiber Digestion Better Nutrient Absorption Better Heat Dissipation Reduced Laminitis Better Digestibility Better Carbohydrate Utilization Less Colic Less Colitis More Muscle Mass Less Muscle Problems Better Disease Resistance Recovery Immunity Digestion Fertility Anti-Oxidant Endurance Fitnes

erformance Inflammation Recovery Digestion Fertility Endurance Ca INTERNAL RESEARCH EFFECTS OF EQUI-BOOST PLUS SUPPLEMENTATION ON BLOOD PARAMETERS IN THOROUGHBRED HORSES UNDER HEAVY TRAINING OBJECTIVES To evaluate the effects of the supplementation of Equi-Boost Plus (composition: castor oil, cashew nut shell oil and carrier) in horses submitted to strenuous physical exercise. MATERIALS AND METHODS Seven Throughbred horses under heavy training were supplemented with 10 g/day of Equi-Boost Plus during 21 days. Blood samples were taken at the beginning and the end of the experiment and the following parameters were analyzed: white blood cells (WBC), red blood cells (RBC), hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), platelets, neutrophyls, lymphocytes, monocytes, eosinophyls, basophyls, sodium, potassium, chlorine, glucose, blood urea nitrogen (BUN), creatinine, calcium, phosphorus, total protein, albumin, AST, alkaline phosphatase, total bilirrubin, CGTP and CPK. Statistics. An ancova was done using Equi-Boost Plus supplementation and animal as discreet variables and serum albumin concentration as a covariate. Serum albumin gives an indication of the hydration state of the animals. RESULTS AND DISCUSSION Mean corpuscular volume and calcium significantly increased (P < 0.05) and phosphorus decreased (P < 0.01) after supplementation. There was a tendency (P < 0.1) for a decrease in sodium and CPK. Mean corpuscular volume is a measure of the average red blood cell volume, which would indicate higher oxygen transport capacity in the animals after supplementation. Equi-Boost Plus antioxidant activity might be increasing the red blood cells life span, increasing the final total number. Other values related to MCV like RBC or HCT were numerically higher for the horses after supplementation. Phosphorus is one of the main buffering systems in the blood and lower numbers indicate less need for buffering. This would indicate an improved energy metabolism and lower metabolic acidosis. An improved energy metabolism would also result in less oxidative stress and would relate to the lower CPK levels. As CPK indicates tissue destruction, lowers levels indicate better cell membrane integrity. Again, this indicates either a better antioxidant capacity, a more efficient energy production system or both. flammation Anti-Oxidant Endurance Fitness Performance Calmness

lmness Anti-oxidant Immunity Fitness Performance Inflammation Re CONCLUSION Equi-Boost Plus supplementation improved the antioxidant capacity and energy metabolism of training Thoroughbred Horses. Baseline After 21 days of supplementation 45.00 40.00 35.00 30.00 25.00 20.00 15.00 10.00 05.00 00.00 44.21a 44.73b 14.11 14.84 9.13 9.46 RBC HGB MCV FIGURE 1. Red blood cell (RBC), hemoglobin (HBG) and mean corpuscular volume (MCV) before and after 21 days of Equi-Boost Plus supplementation. 300.00 250.00 200.00 150.00 100.00 50.00 00.00 288.29 Baseline 201.29 After 21 days FIGURE 2. Creatine Phospokinase levels before and after 21 days of Equi-Boost Plus supplementation. Recovery Immunity Digestion Fertility Anti-Oxidant Endurance Fitnes

WWW.EQUIBOOSTPLUS.COM Feeding for Performance Inflammation Anti-Oxidant Endurance Fitness Performance Calmness