SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION
|
|
- Teresa Jacobs
- 5 years ago
- Views:
Transcription
1 SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information about these cases is presented in the form of images, videos, and data. Visual information will be projected on the screens. Data and text will be given in your exam binder. Information given on the screen is not shown on the question page. OBSERVE ALL INFORMATION PRESENTED ON THE SCREEN PRIOR TO ANSWERING QUESTIONS IN YOUR EXAM BINDER. On the front cover of your binder is a sticker that shows your candidate ID number. Please confirm at this time that the ID number on the cover of the binder is your ID number. If it is not your ID number, let a proctor know immediately. The examination binder consists of XX pages of questions, each related to a corresponding screen image. Each image presented on the screen will correspond with one page of the exam. The screen image will show the corresponding page number in your examination binder. For some images, particularly radiographs and ultrasounds, the lights will be dimmed for approximately one minute after you have had a chance to read the question. You will have approximately 30 seconds to read the question before the lights are dimmed. If a question asks for a specific number of responses, you will be graded on only the requested number of answers. Additional responses beyond the number requested will not be graded. For instance, if we ask you for one diagnosis, and you give us two, we will grade only the first answer. Minimize the use of abbreviations to make sure your answer is clearly understood. Commonly used medical abbreviations may be used; however, if you are concerned that the grader may not understand the abbreviation, you should define it. You will have two minutes, four minutes, six minutes or eight minutes to respond to the questions on each page. The time allotted for each page will be indicated on the top of the page, as well as the top of the corresponding screen image. A one-minute warning will be issued prior to moving to the next page.
2 If we experience technical difficulties while showing an image, the time will be stopped and will resume after the problem has been corrected. You will still receive the full amount of time for that question. When the allotted time is up for each question, you will be instructed to turn the page in your binder to the colored plastic divider that follows. Once you turn to the plastic divider, you may NOT go further in the exam until instructed to do so. Therefore, when instructed to do so at the end of each question, you will turn the page to the plastic divider and wait for instructions before turning the plastic divider to the next test question.! UNDER NO CIRCUMSTANCES ARE YOU ALLOWED TO MOVE FORWARD IN THE EXAMINATION UNTIL INSTRUCTED. FURTHERMORE, YOU MAY NOT RETURN TO A PREVIOUS PAGE OF QUESTIONS AT ANY TIME DURING THE EXAM. FAILURE TO FOLLOW THESE INSTRUCTIONS WILL RESULT IN DISQUALIFICATION FROM THE EXAM. Scrap paper has been supplied for you to take notes during the exam. You are encouraged to use the scrap paper throughout the exam. You can refer to the notes on your scrap paper for the entire duration of the exam. Your scrap paper will not be scored. Raise your hand if you need additional pencils, have a question, or if you need to leave the room for any reason. We highly recommend that you do not leave the examination for any reason since questions cannot be revisited once they have been shown. Are there any questions before we begin the exam?
3 PAGE 1 (4 minutes) A 15 kg, 8 month old, male, Labrador retriever dog is presented with a history of intermittent circling, ataxia, and occasional vomiting. Physical examination reveals a thin dog with no other abnormalities noted. Laboratory work (complete blood count, chemistry profile with electrolytes, and urinalysis) is performed. Results of a complete blood count and reference ranges are listed below. Abnormal values are in bold font. The image is from the blood smear. Complete Blood Count Patient Values Reference Range RBC (x 10 6 /ul) Hemoglobin (g/dl) PCV (%) MCV 9fL) MCHC (g/dl) WBC (x 10 3 /ul) Neutrophils (x 10 3 /ul) Bands (x 10 3 /ul) Lymphocytes (x 10 3 /ul) Monocytes (x 10 3 /ul) Eosinophils (x 10 3 /ul) Platelets (x 10 3 /ul) Cell morphology See projected image 1. List three abnormalities visible on the image of the blood smear. A. B. C. 2. Interpret the results of the complete blood count. Be specific.
4 PAGE 2 (4 minutes) Results of the chemistry profile with electrolytes and reference ranges are listed below. Abnormal values are in bold font. Chemistry profile with electrolytes Patient Values Reference Range Total protein (g/dl) Albumin (g/dl) Globulin (g/dl) Alkaline phosphatase (U/L) ALT (U/L) Bilirubin (mg/dl) CK (U/L) BUN (U/L) Creatinine (mg/dl) Calcium (mg/dl) Phosphorus (mg/dl) Magnesium (mg/dl) Glucose (mg/dl) Cholesterol (mg/dl) Bicarbonate (mmol/l) Sodium (meq/l) Potassium (meq/l) Chloride (meq/l) Interpret the results of the chemistry profile. Be specific.
5 PAGE 3 (2 minutes) Results of the urinalysis are listed below. The image is from the urine sediment. Urinalysis Color Yellow Turbidity Clear Specific Gravity ph 8.5 Protein Negative Glucose Negative Ketones Negative Blood Negative Bilirubin 1+ Urobilinogen Trace Urine sediment exam: See projected image. 1. Identify the material on the image indicated by the arrow. 2. Based on the results of the urinalysis and blood work presented, list two other clinicopathologic tests that would further characterize this dog s problem. A. B.
6 PAGE 4 (2 minutes) Results of serum bile acid analysis and reference ranges are listed below. Abnormal values are in bold font. Serum Bile Acids Patient Values Reference Range Fasting (umol/l) 98 <10 Post-prandial (umol/l) 260 <20 1. What do these results indicate? 2. What is the most likely clinical diagnosis? 3. Other than abdominal radiography, list two noninvasive imaging procedures that would be appropriate to perform in this dog. A. B.
7 PAGE 5 (4 minutes) Lateral and ventrodorsal abdominal radiographs of this dog are shown. 1. List two radiographic abnormalities visible on these radiographs. A. B. 2. What is the radiographic diagnosis? Be specific. 3. List four findings on abdominal ultrasonography that would be supportive of your clinical diagnosis.
8 PAGE 6 (4 minutes) This image is a composite view of transcolonic scintigraphy from this dog. Cranial (Cr) and caudal (Ca) are indicated. The arrow indicates the location of the xiphoid process. 1. Describe and interpret the results. 2. List two diagnostic limitations to transcolonic scintigraphy other than radiation safety issues. A. B. 2. What is the significance of a shunt fraction of 78% in this dog?
9 PAGE 7 (4 minutes) Portography is performed, and the images are projected. 1. Identify the type of portography that has been performed. 2. Describe the abnormality demonstrated by this image. Be specific. 3. List three advantages of this type of portography compared to other methods of contrast portography. A. B. C.
10 PAGE 8 (4 minutes) The diagnosis of a single extrahepatic portosystemic shunt is confirmed. The dog is anesthetized and prepared for abdominal surgery. 1. Other than direct visualization, list three methods for intraoperatively confirming the location of the shunting vessel. A. B. C. 2. List five different procedures for attenuating this single extrahepatic portosystemic shunt at surgery. A. B. C. D. E.
11 PAGE 9 (4 minutes) Gradual attenuation of the shunting vessel is planned by placement of an ameroid band constrictor, a liver biopsy is obtained, and the dog recovers uneventfully. At 6 weeks postoperatively, the dog is normal on physical examination, except for mild abdominal distention. 1. List four complications which have been reported as acute or chronic complications of portosystemic shunt attenuation. 2. What is the most likely mechanism for the abdominal distention in this dog?
12 PAGE 10 (4 minutes) The image is an intraoperative image of a dog with a condition similar to this dog s condition. 1. Is treatment of the abdominal distention in this dog necessary? Circle the correct answer. YES NO 2. If yes, list the treatment. 3. According to Szatmári et al. (J Am Vet Med Assoc, 2004), define hepatopetal and hepatofugal blood flow and explain how ideal attenuation of a shunting vessel is achieved. 4. Make short-term postoperative dietary recommendations for this dog. 5. Make short-term postoperative treatment recommendations for this dog.
13 PAGE 11 (2 minutes) 1. According to Fryer, et al (JVIM 2011), what percent of dogs treated with leviteracetam postoperatively following surgery for PSS developed seizures? 2. In the same study, what was the recommended dosage of leviteracetam in dogs? This Concludes the Small Animal Soft Tissue Case-Based Examination
SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
More information1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
More informationCOMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationHYPERCALCEMIC GOLDEN RETRIEVER
Presenter: Laura Martínez 1, 2 HYPERCALCEMIC GOLDEN RETRIEVER Contributors: Laia Solano-Gallego 2, Josep Pastor 2, Alberto J. Marco 3, María Cuvertoret-Sanz 3, Rosa Novellas 1,2, Anna Vila 1, 2, Xavier
More informationMEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)
8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)
More informationENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
More informationInspector's Accreditation Unit Activity Menu
01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More information10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
More informationSupplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
More informationTest Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2018 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationWhat is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of
Oral effects of What is? PO is a dry food supplement. Sprinkle it onto your pet s food daily. PO is an algae that has been harvested in the Atlantic ocean in northern Norway and contains nothing else such
More informationHematology TOONYA TURNER. IDEXX Services: Senior Profile with Heartworm -Standard CBC. RBC M/µL. Hematocrit
TOONYA TURNER PET OWNER: TURNER SPECIES: Cnine BREED: GENDER: Femle AGE: 1 Yers PATIENT ID: 17047 Fmily Pet Helth Cre 3623 Indin Hills Rod Dectur, Albm 35603 256-341-0200 ACCOUNT #: 87040 ATTENDING VET:
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationPurdue Veterinary Clinical Pathology Laboratory
Order Comments: 8/1/2017 2:27 PM OSA? rinalysis Final - Approved 8/1/2017 2:27 PM Color Turbidity Specific Gravity p Protein Glucose Ketones Bilirubin Blood robilinogen WBC RBC Epithelial Cells Bacteria
More informationResults Report. Welcome to Your ABT Report!
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be
More informationPresented by: Dr. Giuseppe Molinaro Dr. Davide De Biase
Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Dog Spayed Female LABRADOR RETRIEVER 3 Years old VACCINATIONS ANTIPARASITIC COMMERCIAL DIET VOMITING FOR A MONTH DULLNESS WEIGHT LOSS INAPPETANCE
More informationAustralian and New Zealand College of Veterinary Scientists. Fellowship Examination. Veterinary Clinical Pathology Paper 1
Australian and New Zealand College of Veterinary Scientists Fellowship Examination June 2012 Veterinary Clinical Pathology Paper 1 Perusal time: Twenty (20) minutes Time allowed: Three (3) hours after
More informationThe Blood Chemistry Panel Explained
The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationDate Time By Code Description Qty (Variance) Photo
Adobe Animal Hospital 6331 Haven Ave., Suite 4 Rancho Cucamonga, CA 91737 909-483-3535 Patient Chart Printed: 03-16-17 at 9:44a CLIENT INFORMATION Name Ms. Amanda Barber (1394) Address 10850 Church St.
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationLabDriver Audit Trail Example
LabDriver Audit Trail Example Sample details:= (SampleDId=82051) Lab no: 0902168 Centre: CR Centre (CentreId=1079) (BatchSId=1317) Status: Checked Blood date: 13/05/2009 time: 11:31:00 lab received: 13/05/2009
More informationAge: 14 Houston TX 77007
Patient Medical History HEIGHTS HOSPITAL FOR ANIMALS Bernie Rogers Patient: JACK DOB: 08/26/1999 720 Courtlandt St. Species: FELINE Age: 14 Houston TX 77007 Breed: Domestic Shorthair Sex: MN Color: Black
More informationBC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
More informationWHAT IS YOUR DIAGNOSIS?
WHAT IS YOUR DIAGNOSIS? A 12 year old, female neutered domestic shorthaired cat was presented to the R(D)SVS Feline Clinic with a 6 week history of polydipsia and polyuria, which was not quantified. The
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More information(7) VITAL SIGNS (8) LEVEL OF CONSCIOUSNESS (9) MENTAL STATUS (10) SPEECH (11) VISION (12) FUNDUS (PAPILLEDEMA)
Radiation Therapy Oncology Group Phase II CNS Lymphoma Follow-Up Form RTOG Study No. 1114 Case # Amended Data Yes INSTRUCTIONS: Submit this form as indicated in the protocol. All dates need to be recorded
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
More informationB. PANITUMUMAB DOSE LEVEL 0 No dose reduction 1 Level -1 2 Level Other, specify in comments for this cycle
Radiation Therapy Oncology Group Phase II Study Pre-operative Chemo- Radiation + Panitumumab for Potentially Operable Lung Cancer Concurrent Summary Form AMENDED DATA YES INSTRUCTIONS: Submit all pages
More informationCOMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON
European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED
More informationSydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
More informationRoutine Clinic Lab Studies
Routine Lab Studies Routine Clinic Lab Studies With all lab studies, a Tacrolimus level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not too much anti-rejection
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More informationMultiphasic Blood Analysis
Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary
More informationResults Report. Welcome to Your ABT Report! Introduction to the ABT Report
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Dec 08, 2017 Panel: ABT Gold Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be a
More informationi. Where is the participant seen?
PFU01 method used: Phone/in-person interview 1 Enter PIP # here: Online survey 2 Enter Web # here: Initials of person completing form: Date Form Completed: / / Form Version: 03 / 01 / 18 Is the participant
More informationGastrointestinal Markers
Gastrointestinal Markers Session 2 Gastrointestinal System Reference Ranges Optimal Range Ttl Total Protein ti 69 6.9 74 7.4 Globulin 2.4 2.8 BUN 10 16 Creatinine 0.8 1.1 Phosphorous 3.0 4.0 Eosinophils
More informationGlossary of terms used in College examinations. The Royal College of Emergency Medicine
Glossary of terms used in College examinations The Royal College of Emergency Medicine The CEM uses several terms in examinations that may cause confusion. The following definitions are intended as a guide
More informationMHD I SESSION X. Renal Disease
MHD I, Session X, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD I SESSION X Renal Disease Monday, November 11, 2013 MHD I, Session X, Student Copy Page 2 Case #1 Cc: I have had weeks of diarrhea
More information6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.
LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationDocumentation Dissection
History of Present Illness: Documentation Dissection The patient is a 50-year-old male c/o symptoms for past 4 months 1, severe 2 bloating and stomach cramps, some nausea, vomiting, diarrhea. In last 3
More informationANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE
ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This
More information15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.
Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,
More informationSAFETY ASPECTS OF MIDAZOLAM
Br. J. clin. Pharmac. (1983), 16, 37S-41S Biological Pharmaceutical Research Department, F. Hoffmann-La Roche & Co Ltd, CH-4002 Basle, Switzerland 1 The LD50 in the rat and the mouse is about 1600 mg/kg
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Pathology Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2014 Veterinary Pathology Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationGRADING CRITERIA for CMS Regulated Analytes
CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers
More informationROUTINE LAB STUDIES. Routine Clinic Lab Studies
ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not
More informationElectrolytes by case examples. Graham Bilbrough, European Medical Affairs Manager
Electrolytes by case examples Graham Bilbrough, European Medical Affairs Manager 1 Acid-bases disturbances Generally result from one of the following: 1. damage to an organ such as the kidneys or lungs
More informationColor: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.
5/8/2014 L 29 UA/Microscopy results from IDEXX Reference GLUCOSE NEGATIVE BILIRUBIN NEGATIVE KETONES NEGATIVE BLOOD NEGATIVE PH 6.5 SP GRAVITY 1.031 PROTEIN NEGATIVE UROB NORMAL WBC NONE SEEN HPF 0-5 RBC
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Emergency and Critical Care Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2018 Veterinary Emergency and Critical Care Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Chen CL, Lin GA, Bardach NS, et al. Preoperative medical testing
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationPET CARE VETERINARY CARE CENTER 2009 W SLAUSON AVE ACCOUNT #: ATTENDING VET: ANDERSON, DVM, JOY
Text KISMET EVENTOFF PET OWNER: EVENTOFF SPECIES: Feline BREED: GENDER: Female AGE: 2 Months PATIENT ID: PET CARE VETERINARY CARE CENTER 2009 W SLAUSON AVE 323-294-4030 ACCOUNT #: 93530 ATTENDING VET:
More informationOnline catalog
This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)
More informationINSTRUCTIONS: 1. Use codetable on page 1 for modifications / termination reasons
Radiation Therapy Oncology Group Phase III Head & Neck Cancer Treatment Summary Form AMENDED DATA YES INSTRUCTIONS: 1 Use codetable on page 1 for modifications / termination reasons SUMMARY OF SYSTEMIC
More informationMHD I Session VIII Renal Disease November 6, 2013 STUDENT COPY
MHD I, Session VIII, Student Copy Page 1 MHD I Session VIII Renal Disease November 6, 2013 STUDENT COPY MHD I, Session VIII, Student Copy Page 2 Case #1 Chief Complaint: I have been feeling just lousy
More informationSlide # 23 peripheral blood smear from a dog
Slide # 23 peripheral blood smear from a dog Cinzia Mastrorilli 1, Elizabeth Welles 1, Lauren Reid 2 1 Department of Pathobiology, 2 Department of Clinical Science College of Veterinary Medicine, Auburn
More information2010 Miniboard Exam- Clinical Pathology
2010 Miniboard Exam- Clinical Pathology 1. All of the following findings are noted in cats with hyperthyroidism EXCEPT: A. Anemia B. Increased creatinine C. Hyperglycemia D. Elevated ALP (bone isoenzyme)
More informationASSIGNED TREATMENT ARM
SF Radiation Therapy Oncology Group Phase III Lung High-dose vs Standard-dose Conformal XRT with Chemotherapy Consolidation Treatment Summary Form RTOG Study No. 0617 Case # AMENDED DATA YES INSTRUCTIONS:
More informationMiniboard Exam 2011 Veterinary Pathology - Clinical Pathology
Miniboard Exam 2011 Veterinary Pathology - Clinical Pathology 1. The following information is given for an 8 year old felid: Na+ - 138 mmol/l Cl - 102 mmol/l Mg+- 2.4 mmol/l Phos- 11.2 mg/dl Ca²+- 10.1
More informationChapter 4. M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University.
Chapter 4 M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University. RBC (Erythrocytes): RBC COUNT: NORMAL VALUES: For men: 4.3-5.9 millions/mm 3 of blood. For women: 3.5-5.0
More informationAdams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS
Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Your health is important to us! The test descriptions listed below are for educational purposes only. Laboratory test interpretation
More information5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval
LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationHEALTH SCREEN CARE. VIGNE Healthcare provides a comprehensive Health Screening Package of EXCLUSIVE HEALTH SCREENING EXPERIENCE
HEALTH SCREEN CARE VIGNE Healthcare provides a comprehensive Health Screening Package of Silver Gold Platinum Cancer EXCLUSIVE HEALTH SCREENING EXPERIENCE Meet & Greet Medical Review with Doctor Appointment
More informationColor: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range
5/7/2018 L LD AA-Urinalysis results from IDEXX VetLab In-clinic COLLECTION = free catch COLOR = yellow CLARITY = clear SP GR = 1.020 GLUCOSE = neg BILIRUBIN = neg KETONE = neg BLOOD = neg PH = 6.0 PROTEIN
More informationEXAMPLE REPORT ONLY Contact AMS Biotechnology for current donor specific information
EXAMPLE REPORT ONLY Contact AMS Biotechnology for current donor specific information NAME DIAGNOSIS PROTOCOL OF EVALUATION for Chronic Lymphatic Leukemia (CLL) GENERAL INFORMATION (ALL information required!!)
More informationWELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL
WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL BUN Blood Urea Nitrogen (BUN) is a waste product of protein breakdown and is produced when excess protein in your body is broken down and used
More informationADPedKD: detailed description of data which will be collected in this registry
ADPedKD: detailed description of data which will be collected in this registry I. Basic data 1. Patient ID: will be given automatically 2. Personal information - Date of informed consent: DD/MM/YYYY -
More informationCRRT Fundamentals Pre-Test. AKI & CRRT 2017 Practice Based Learning in CRRT
CRRT Fundamentals Pre-Test AKI & CRRT 2017 Practice Based Learning in CRRT Question 1 A 72-year-old man with HTN presents to the ED with slurred speech, headache and weakness after falling at home. He
More informationFullerton Healthcare Screening Centres
Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday
More informationEfficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled
Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar
More informationBIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L
Lipase U/L 88.9 10-195 Amylase U/L 1181.1 371.3-1192.6 West Delhi :- 7/148, Opp. MCD Office, Major Pankaj Batra Marg, Near Ramesh Nagar, New Delhi-15, Ph. : 011-47562566,9999830187 Liver Function Test
More informationGet to know yourself better. Attend our health screening event.
Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening Program. 1 SIMPLE ACTION
More informationBlood Test Results Report
Blood Test Results Report The Blood Test Results Report lists the results of the patient s Chemistry Screen and CBC and shows you whether or not an individual element is outside of the optimal range and/or
More informationGet to know yourself better. Attend our health screening event.
Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening
More informationM.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017
M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017 If laboratory results are required on a STAT basis, the designated commercial medical laboratory
More informationClinical Laboratory Science: Urinalysis
Clinical Laboratory Science: Urinalysis Urine is produced by the kidney to maintain constant plasma osmotic concentration; to regulate ph, electrolyte and fluid balances and to excrete some 50 grams of
More informationComparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The
More informationPOSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO
POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO Selection Examination for Enrolment to the in-service Training Programme in Postgraduate Certificate in Basic Laboratory Sciences leading to the
More information*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible:
Rick Gold, Certified FDN Practitioner Gold Functional Wellness, Inc. Web: http://goldfunctionalwellness.com/ Phone: (561)270-6364 Email: Rick@goldfunctionalwellness.com Schedule a consultation: https://snapappointments.com/listing/38c
More informationURINANLYSIS. Pre-Lab Guide
URINANLYSIS Pre-Lab Guide NOTE: A very useful Study Guide! This Pre-lab guide takes you through the important concepts that where discussed in the lab videos. There will be some conceptual questions on
More informationWhat s Your Diagnosis? Allison Crow, Class of 2014
What s Your Diagnosis? Allison Crow, Class of 2014 Signalment: 13 year old male castrated mixed breed dog History: The patient presented to the rdvm for pain in the hind end, weakness and neck stretching
More informationMineral Panel, Urine. Mineral/Lytes Panel, Urine. Metabolic Profile Test Panel Urea NEFA AST BHB. Non-Mammalian Chem Panel
CHEMISTRY PANELS Bilirubin Panel Bilirubin, Total Bilirubin, Direct Bilirubin, Indirect Canine Chemistry Panel See Small Animal Chemistry Panel Electrolyte Panel (NA) (K) (CL) Electrolyte Panel, Urine*
More informationKathryn Jones 8/11/2015
1 of 8 8/11/2015 2:25 PM This informa on is copyrighted 2014 by Balancing Body Chemistry with Nutri on Seminars. No part may be copied or reproduced without wri en approval of Balancing Body Chemistry
More informationWhat Does My Blood Test Mean
What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Emergency and Critical Care Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Veterinary Emergency and Critical Care Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours
More informationCASE-BASED SMALL GROUP DISCUSSION MHD II
MHD II, Session 11, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD II Session 11 April 11, 2016 STUDENT COPY MHD II, Session 11, Student Copy Page 2 CASE HISTORY 1 Chief complaint: Our baby
More information