Supplementary Information Lin28 Enhances Tumorigenesis and is Associated With Advanced Human Malignancies Srinivas R. Viswanathan 1, John T. Powers 1, William Einhorn 1, Yujin Hoshida 2,5, Tony Ng 15, Sara Toffanin 8,9, Maureen O'Sullivan 16, Jun Lu 2,3,5, Letha A. Philips 13, Victoria L. Lockhart 12, Samar P. Shah 1, Pradeep S. Tanwar 7, Craig H. Mermel 5, Rameen Beroukhim 5, Mohammad Azam 1, Jose Teixeira 7, Matthew Meyerson, Timothy P. Hughes 14, Josep M Llovet 8,10,11, Jerald Radich 12, Charles G. Mullighan 13, Todd R. Golub 2,5, Poul H. Sorensen 15 and George Q. Daley 1,2,3,4 * * To Whom Correspondence should be Addressed: George Daley Phone: (617) 919-2013 Fax: (617) 730-0222 E-mail: george.daley@childrens.harvard.edu
Figure S1. Lin28 Enhances Transformation of NIH-3T3 Cells. (A) Soft agar colonies for 25,000 NIH/3T3 cells infected with pmscv.neo/pbabe.puro, pmscv.neo.lin28/pbabe.puro, or pmscv.neo.lin28/pbabe.puro.7s21l, selected with Puromycin and G418. Colonies were counted after 4 weeks with five random fields counted per well. In the 7S21L rescue condition, both colony number and size (arrows) are decreased. (B) NIH-3T3 cells were infected with pbabe.puro, pbabe.puro.lin28 or pbabe.purolin28b, selected on Puromycin, and 2 x 10 6 cells were injected subcutaneously into the flank of Balb/c nude mice. (C) H&E staining of tumors formed by NIH-3T3 cells expressing either Lin28 or LIN28B. T, tumor cells; M, host muscle tissue; A, host adipose tissue. (D) Soft agar colonies for 25,000 NIH/3T3 cells infected with pbabe.puro.bcr-abl. Cells were initially infected with either pmscv.neo/pbabe.puro, pmscv.neo.lin28/pbabe.puro or pmscv.neo.lin28/pbabe.puro.7s21l, and selected with Puromycin and G418. Colonies were counted after 3 weeks with five random fields counted per well. In the BCR-ABL + Lin28 condition, both colony number and size (arrows) are increased over BCR-ABL alone.
Figure S2. Lin28 enhances transformation of LKR cells. (A) Western blot analysis performed on LKR cells infected with pbabe.puro or pbabe.puro.lin28, and selected on Puromycin. (B) Levels of mature mir species in representative infection determined by quantitative PCR of LKR cells infected with pbabe.puro or pbabe.puro.lin28, and selected with Puromycin. (C) Proliferation of LKR cells infected with pbabe.puro, pbabe.puro.lin28, or pmscv.neo.let-7g, and selected with Puromycin or G418, plated at 5000 cells per well and assayed over indicated time period. Cell counts are plotted as mean +/- S.E.M., n=3. (D) Representative plate from colony formation assay (n=3) of LKR cells infected with pbabe.puro or pbabe.puro.lin28, selected on Puromycin, and plated at 2000 cells per 10 cm dish. Colonies were stained with crystal violet and counted after 5d of growth.
Figure S3. LIN28 expression in human cancer cell lines. (A) Human cancer cell lines expressing LIN28, as determined by microarray analysis on over 527 cell lines. Signal intensity was normalized to signal in HeLa cells, which do not express LIN28 by qpcr. (B) Microarray data on human cancer cell lines in the NCI-60 panel interrogated for either LIN28 (blue) or LIN28B (red) expression.
Figure S4. Analysis of LIN28 expression in a panel of human tumors. LIN28 expression in human tumors as detected by immunohistochemistry on a tumor tissue microarray. LIN28 expression in selected tumor samples is shown. LIN28 expression for all samples on the tissue microarray is catalogued in Table S1.
Figure S5. HMGA2 Expression in CML. (A) Gene expression data (GSE4170, published microarray dataset) from patients in either chronic phase (green), accelerated phase (yellow), or blast crisis (red) of CML was investigated for levels of LIN28B(white) or HMGA2 (black) expression. LIN28 was not on the array. (B) scatterplot of relative HMGA2 and LIN28B levels in patients in CML-CP (top) or CML-BC (bottom) CML. (C) Samples were classified based on low (< 0.5 log 10 N units relative to CP) or high (> 0.5 log 10 N units relative to BC) HMGA2 or LIN28B expression. p=0.0173, Fisher s exact test.
Figure S6. LIN28B Knockdown Impairs Growth of Lama-84 Cells. (A) Cell proliferation of Lama-84 cells infected with plko.controlshrna or plko.lin28bshrna, selected on Puromycin, and seeded at 15000 cells per well. Results are plotted as average cell number per well +/- S.E.M. N=3.
Figure S7. LIN28B is required for the growth of H1299 lung adenocarcinoma cells. (A) Human cancer cells expressing LIN28B as determined by quantitative PCR. Expression levels were normalized to HeLa cells. (B) LIN28B expression measured by quantitative PCR in H1299 cells infected with plko.controlshrna or plko.lin28bshrna, and selected on Puromycin. (C) Levels of mature mir species in representative infection determined by quantitative PCR of H1299 cells infected with plko.controlshrna or plko.lin28bshrna, and selected with Puromycin (D) Western blot analysis on whole cell extracts from H1299 cells infected with plko.controlshrna or plko.lin28bshrna and selected in Puromycin (E) Proliferation of H1299 cells infected with plko.controlshrna or plko.lin28bshrna and seeded at 2500 cells per well. Cells were counted over time and results are plotted as mean +/- S.E.M., n=3. (F) Colony formation of H1299 cells infected with plko.controlshrna or plko.lin28bshrna, selected on Puromycin, and plated at 2000 cells per 10 cm dish. After 7d of growth, colonies were stained with crystal violet. (G) Quantitation of colony number from colony forming assay. Results are plotted as average number of colonies per plate +/- S.E.M., N=3. (H) H1299 cells were infected with plko.controlshrna or plko.lin28bshrna, stained with Annexin-PE and 7-AAD, and percentage of total Annexin positive cells for each condition was quantitated. Results are plotted as average number of Annexin positive cells +/- S.E.M., N=3.
Figure S8. LIN28/LIN28B are overexpressed in late stage Wilms Tumors. LIN28 and LIN28B expression in human renal tumor samples as determined by microarray analysis. LIN28 and LIN28B signal is log2 transformed and normalized to normal kidney. T, tumor sample; N, normal kidney.
Figure S9. LIN28/LIN28B expression in Ovarian Cancer. (A) LIN28/LIN28B expression in a panel of ovarian tumors as determined by microarray analysis and grouped by histological grade. Log-2 transformed LIN28 and LIN28B signal was row-normalized. (B) Immunohistochemical analysis of LIN28 expression in ovarian tumor tissue. Tissue sections from various ovarian carcinoma subtypes or normal ovary were stained with anti-lin28 antibody. Arrow, ovarian surface epithelium.
Figure S10. Copy number alterations at the LIN28B locus. (A) Samples showing copy number increase at the LIN28B locus (LIN28B genomic position = 105.5 MB) as determined by analysis of SNP array data from 3300 human tumors/cell lines. (B) GISTIC G-score (= frequency of alteration x mean alteration amplitude) plotted as a function of position along chromosome 6 for breast cancer samples. LIN28B is located in proximity to the most significant amplification peak on the chromosome but falls outside the peak region.
Figures S11. A region in the vicinity of a c-myc binding site is demethylated in cell lines that express LIN28B. (A) Position of the CpG island within the LIN28B locus (blue arrows, ~1kb downstream of TSS) analyzed by bisulfite sequencing. *, c-myc binding sites recently identified by Chang et al 64. (B) The three cell lines analyzed by bisulfite sequencing display comparable levels of c-myc as assessed by Western blotting (C) Relative LIN28B levels in HeLa, HepG2, and K562 cells as assessed by qpcr. (D) Methylation status at the LIN28B locus in the region defined in (A). Filled circles represent methylated CpGs, while unfilled circles represent unmethylated CpGs.
Figure S12. The 6q21 breakpoint of a t(6;15) translocation in Wilms tumor maps directly adjacent to the LIN28B transcriptional start site and is associated with increased LIN28B expression. (A) Probe used for Southern blot analysis (red bar) as depicted using the UCSC Genome Browser. This probe spans a possible regulatory CpG island (CpG-29) directly upstream of the LIN28B locus. (B) Schematic depicting predicted bands after Southern blot analysis of PstI-digested genomic normal DNA and DNA from the index Wilms tumor case using the above probe. The probe is expected to hybridize to a single ~15kb wt fragment from the normal 6q21 allele, and 2 rearranged fragments (~20kb and ~3kb) from the derivative t(6;15) chromosomes. (C) Southern blot of the index Wilms tumor case and matching normal kidney (#1) and a second normal kidney control (#2) using PstI-digested genomic DNA and the above probe. (D) Levels of LIN28B expression determined by quantitative PCR in the index Wilms tumor case versus matched normal kidney. (E) Fluorescence in-situ hybridization (FISH) analysis of a second Wilms tumor case with a t(6;15)(q21;q26) translocation showing a breakpoint in 6q21 in the region of the LIN28B locus. Using the BACs RP11-809N15 (labeled red) and RP11-770C15 (labeled green), a fused yellow signal representing the normal allele (arrow) and split red and green signals representing the translocation derivates (arrowheads) are seen. (F) Levels of LIN28B expression determined by quantitative PCR in this second t(6;15) Wilms tumor case versus a series of five normal kidney tissue samples. Signal normalized to average of five normal samples. Matched normal tissue was not available for this tumor sample.
# Tumors / # Injection Sites Puro 0/5 Lin28 3/5 LIN28B 4/5 Supplementary Table 1: NIH/3T3 cells were infected with pbabe.puro, PBabe.Puro.Lin28 or pbabe.puro.lin28b, and 2 x 10 6 cells were injected subcutaneously into the flank of Balb/c nude mice. Numbers represent number of palpable tumors at 6 weeks. Cell Line Type LIN28 Expression LIN28B Expression Human ips Induced Pluripotent Cell + + (low) cells PA-1 Ovarian teratocarcinoma + - G401 Wilms Tumor + - NCCIT Embryonal + - carcinoma/teratocarcinoma H1299 NSCLC - + Caco-2 Colon adenocarcinoma - + A549 Lung adenocarcinoma - + Calu-1 Lung carcinoma, - - epidermoid Calu-6 Lung, anaplastic - + carcinoma H460 Large cell lung carcinoma - - LeSa (LL86) Normal Lung fibroblastlike - - K562 CML, blast crisis + (low) + Lama-84 CML, blast crisis - + AR230 CML, blast crisis - + Hela Cervical cancer - - T47D Breast Cancer + - CCRF-CEM ALL - + K562 CML, blast crisis - + LOXIMVI Melanoma - + SK_MEL_28 Melanoma - + UACC_257 Melanoma - + UACC_62 Melanoma - + HOP_62 Lung Cancer + - IGROV1 Ovarian Cancer + - Supplementary Table 2: List of cell lines tested for LIN28 and LIN28Bexpression by quantitative PCR, and curated from NCI-60 microarray data (grey) shown in (Fig. S3B)
Position Sample Description LIN28 Staining A1 Mucin adenocarcinoma (ascending colon) + B1 Apillary adenocarcinoma (rectal colon) ++ C1 Signet cell adenocarcinoma (rectal colonanus) + D1 Papillary adenocarcinoma (iliac-cecal 0 colon) E1 Adenocaricnoma (sigmoid colon) + F1 Adenocarcinoma (sigmoid colon) +++ G1 Adenocarcinoma (transverse colon) ++ H1 Adenocarcinoma (rectal colon) N/A I1 Adenocarcinoma (rectal colon) ++ J1 Adenocarcinoma (rectal colon) ++ K1 Mucin adenocarcinoma (rectal colon) +++ A2 Mucin adenocarcinoma (ascending colon) 0 B2 Papillary adenocaricnoma (rectal colon) ++ C2 Adenocarcinoma (colon) +++ D2 Mucin adenocarcinoma (rectal colon) + E2 0 F2 Colon mucosa adjacent to cancer 0/+ G2 Colon mucosa adjacent to cancer 0/+ H2 Colon mucosa adjacent to cancer 0/+ I2 Colon mucosa adjacent to cancer 0/+ J2 Colon mucosa adjacent to cancer + K2 Colon mucosa adjacent to cancer + A3 Colon mucosa adjacent to cancer 0/+ B3 Colon mucosa adjacent to cancer 0/+ C3 Colon mucosa adjacent to cancer 0/+ D3 Colon mucosa adjacent to cancer 0 E3 Colon mucosa adjacent to cancer 0 F3 Colon mucosa adjacent to cancer 0 G3 Colon mucosa adjacent to cancer 0 H3 Colon mucosa adjacent to cancer 0 I3 Colon mucosa adjacent to cancer 0 J3 Breast invasive ductal cancer, left ++ K3 Breast adenocarcinoma, left ++ A4 Breast adenocarcinoma, left N/A B4 Breast adenocarcnioma, right +++ C4 Breast invasive ductal cancer, left ++ D4 Breast adenocarcinoma, left + E4 Breast adenocarcinoma, left ++ F4 Breast adenocarcinoma, left ++ G4 Breast adenocarcinoma, right 0/+ H4 Breast adenocarcinoma, right +++ I4 Breast adenocarcinoma, left 0 J4 Breast adenocarcinoma, left +++ K4 Breast invasive ductal cancer, right ++ A5 Breast adjacent to breast cancer 0/+ B5 Breast adjacent to breast cancer ++ C5 Fibroadenosis, right ++
D5 Fibroadenosis, right 0 E5 Fibroadenoma, right 0 F5 Fibroadenoma, right 0/+ G5 Fibroadenoma, left 0 H5 Fibroadenoma, left 0 I5 Fibroadenoma, right 0 J5 Fibroadenosis, left 0 K5 Fibroadenosis, right 0 A6 Breast adjacent to breast cancer 0 B6 Fibroadenosis, left 0 C6 Fibroadenosis, left 0 D6 Fibroadenosis, left 0 E6 Breast adjacent to breast cancer 0 F6 Breast adjacent to breast cancer ++ G6 Lung squamous cancer, grade I, left-up 0/+ lobule H6 Lung adenocarcinoma, grade I, left-down 0/+ lobule I6 Lung small cell cancer, spindle, right-down ++ lobule J6 Lung bronchioalveolar-carcinoma + K6 Lung squamous cancer, grade II-III 0/+ A7 Lung adenocarcinoma, grade I ++ B7 Lung squamous cancer grade II-III ++ C7 Lung squamous cancer grade III +++ D7 Lung muco-adenocarcinoma, grade I, left 0 low E7 Lung adenocarcinoma, right middle 0 F7 Lung adenocarcinoma, left up 0/+ G7 Lung adenocarcinoma, right up 0 H7 Lung adenocarcinoma, left low 0 I7 Lung adenocarcinoma, right up N/A J7 Lung adenocarcinoma, right low ++ A8 Metastatic adenocarcinoma +++ B8 Ovarian muco-cystadenoma 0 C8 Ovarian muco-cystadenoma ++ D8 Ovarian clear cell carcinoma 0/+ E8 Ovarian serous papillary adenoma 0/+ F8 Ovarian small cell carcinoma 0/+ G8 Ovarian serous cystadenoma + H8 Ovarian clear cell carcinoma ++ I8 Ovarian serous papillary cystadenoma ++ J8 Ovarian adenocaricnoma, right 0 K8 Ovarian adenocarcinoma, right 0 A9 Cervical squamous cancer grade II ++ B9 Cervical squamous cancer grade II, deep ++ muscle invaded C9 Cervical squamous cancer grade III ++ D9 Cervical squamous cancer grade III 0 E9 Cervical squamous cancer grade I 0
F9 Cervical squamous cancer grade II, muscle 0/+ invaded G9 Cervical squamous cancer grade I 0 H9 Cervical squamous cancer grade III, muscle N/A invaded I9 Cervical squamous cancer grade III 0 J9 Cervical squamous cancer grade I 0 K9 Cervical squamous cancer grade I, superficial invaded N/A Supplementary Table 3: Female multi-tumor type microarray stained with an anti-lin28 antibody. Specimens contained on the array were: colorectal cancer (15 samples), breast cancer (15 samples), lung cancer (15 samples), cervical cancer (10 samples), ovarian cancer (10 samples). LIN28 staining level. +++: intense staining; ++: moderate staining; +: weak staining; 0/+: diffuse, weak staining, potentially nonspecific; 0: no staining. Pt ID Phase LIN28 LIN28B 1 CP - - 1 BC Myeloid - - 2 CP - - 2 BC - Lymphoid - + 3 CP - - 3 BC - Myeloid - + 4 CP - - 4 BC - Lymphoid - - 5 CP - - 5 BC Myeloid - - 6 CP - - 6 BC - Lymphoid - - 7 AP - - 7 BC Myeloid - + 8 CP - - 8 BC Myeloid - - 9 BC Myeloid - - 9 BC- Remission - - 10 CP - - 10 BC-myeloid - - 11 AP - - 11 BC Myeloid - - 12 CP - - 12 BC Myeloid - - 13 CP - - 13 BC - Myeloid - - Table S4. Paired blast crisis (BC), accelerated phase (AP), or chronic phase (CP) samples from patients were analyzed for LIN28 and LIN28B expression by quantitative PCR as described in methods.
Tumor Type # of Tumors Broad Gain Focal Gain High Level (Broad or Focal) Unamplified All 3300 11.5% 1.70% 3.40% 86.80% Breast 243 20.10% 8.60% 5.30% 71.30% CML 6 66.6% 7.60% 66.60% 33.40% HCC 121 9.9% 1.00% 2.50% 89.10% Lung NSC 734 10.20% 1.50% 1.20% 88.30% Wilms 2 0% 50.0% 0.00% 50.00% Supplementary Table 5: Summary of SNP array data analysis on 3330 primary tumors and cancer cell lines. Broad gain gain of the entire chromosome. Focal gain amplicon size smaller than a chromosomal arm. High level gain inferred copy number gain > 2. +1kb-BS-F: TTAGTAAAGGTGGTGGAGAAGAGTT +1kb-BS-R CTCTTTAAACAAAAAACCCAAAAAA For bisulfite sequencing of LIN28B locus hlin28bf GCCCCTTGGATATTCCAGTC hlin28br: TGACTCAAGGCCTTTGGAAG For quantitative RT-PCR using SYBR Green hgapdhf GCTCTCCAGAACATCATCCCTGCC For quantitative RT-PCR hgapdhr CGTTGTCATACCAGGAAATGAGCTT using SYBR Green LIN28F 5 -TTCGGCTTCCTGTCCATGAC-3 LIN28R 5 -CCACTGCCTCACCCTCCTT-3. For Taqman quantitative RT- LIN28 Probe 5 - FAM -ATGTCTTTGTGCACCAGAGTAAGCTGCACAT - BHQ -3 PCR assay (performed on CML patient samples). LIN28BF 5 -GGATTTGGATTCATCTCCATGATAA-3 For Taqman quantitative RT- LIN28BR 5 -GAATTCCACTGGTTCTCCTTCTTTT-3 PCR assay (performed on LIN28B Probe 5 - FAM - CAGTCGATGTATTTGTACACCAAAGCAAACTATTCATG - BHQ -3 CML patient samples) BCR 5 -CCTTCGACGTCAATAACAAGGAT-3 Forward BCR 5 -CCTGCGATGGCGTTCAC-3 Reverse BCR Probe 5 - FAM - TCCATCTCGCTCATCATCACCGACA - TAM -3 For Taqman quantitative RT- PCR assay (performed on CML patient samples) Supplementary Table 6: List of Primer Sequences