Expanded View Figures

Similar documents
McWilliams et al., http :// /cgi /content /full /jcb /DC1

A. Generation and characterization of Ras-expressing autophagycompetent

SUPPLEMENTARY INFORMATION

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +

Rapid parallel measurements of macroautophagy and mitophagy in

SUPPLEMENTARY FIGURES

6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells

Supplementary information

Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts

SUPPLEMENTARY INFORMATION

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplementary Figures

Supplementary Fig. 1 V-ATPase depletion induces unique and robust phenotype in Drosophila fat body cells.

Loss of RhoA promotes skin tumor formation. Supplementary Figure 1. Loss of RhoA does not impair F-actin organization.

Supplemental Figures:

Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa

T H E J O U R N A L O F C E L L B I O L O G Y

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

Name Animal source Vendor Cat # Dilutions

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells

GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin

Phosphoinositides Regulate Ciliary Protein Trafficking to Modulate Hedgehog Signaling

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

SUPPLEMENTARY INFORMATION

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

Supplementary Figure S1 Supplementary Figure S2

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

SUPPLEMENTARY FIGURES

SUPPLEMENTARY INFORMATION

Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Nature Neuroscience: doi: /nn Supplementary Figure 1

SUPPLEMENTARY INFORMATION

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury

Metabolism and the extracellular flux bioanalyzer. Bioenergetics and Metabolism

Supplemental Figure 1

Supporting Information

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

Supporting Information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

Supplementary Materials

nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Information. Supplementary Figure 1

Mechanical Stress-Dependent Autophagy Components Release via Extracellular

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108

s u p p l e m e n ta ry i n f o r m at i o n

Supplementary Figures

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

SUPPLEMENTARY INFORMATION

Nature Immunology: doi: /ni Supplementary Figure 1. IC261 inhibits a virus-induced type I interferon response.

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI

Supplemental Information. Autophagy in Oncogenic K-Ras. Promotes Basal Extrusion. of Epithelial Cells by Degrading S1P. Current Biology, Volume 24

T H E J O U R N A L O F C E L L B I O L O G Y

LPS LPS P6 - + Supplementary Fig. 1.


Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

T H E J O U R N A L O F C E L L B I O L O G Y

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

Expanded View Figures

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

Supplementary Figure 1

Dynamic Interaction of Stress Granule, DDX3X and IKK-α Mediates Multiple Functions in

Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis

Supplementary Information

F-actin VWF Vinculin. F-actin. Vinculin VWF

Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Supplementary material Legends to Supplementary Figures Figure S1. Figure S2. Figure S3.

Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified

Supplemental information contains 7 movies and 4 supplemental Figures

Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream signals in in vitro Symbol Gene ID RefSeqID Clone ID

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Hepatitis C Virus Induces the Mitochondrial Translocation of Parkin and Subsequent Mitophagy

The Effects of Transposing Mitochondria From Drug Resistant to Drug Sensitive Breast Cancer Cells

Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids

Supplementary Information

Supplementary Figure S1

Nature Immunology: doi: /ni Supplementary Figure 1

Transcription:

PEX13 functions in selective autophagy Ming Y Lee et al Expanded View Figures Figure EV1. PEX13 is required for Sindbis virophagy. A, B Quantification of mcherry-capsid puncta per cell (A) and GFP-LC3 puncta per cell (B) for experiment shown in Fig 1B and C in HeLa/GFP-LC3 cells treated with the indicated sirna and infected with SIN/mCherry-capsid (AO30). Results represent mean SEM of triplicate samples (~100 cells analyzed per sample). *P < 0.05, **P < 0.01, ***P < 0.001, NS = not significant; one-way ANOVA with adjustment for multiple comparisons. C Representative images of endogenous LC3 colocalization with mcherry-capsid at 10 h after Sindbis virus (strain AO30) infection of HeLa cells treated with the indicated sirna. Arrowheads indicate colocalization between mcherry-capsid and LC3 puncta at 10 h after Sindbis virus (strain AO30) infection of HeLa cells treated with the indicated sirna. Scale bars, 10 lm. D F Quantification of colocalized LC3 and mcherry-capsid puncta normalized to the number of mcherry-capsid puncta per cell (% colocalization) (D), mcherry-capsid puncta per cell (E), and LC3 puncta per cell (F) in the experiment shown in (C). Bars are mean SEM of triplicate samples (~70 cells analyzed per sample). *P < 0.05, NS = not significant; two-tailed unpaired t-test. G, H Quantification of mcherry-capsid puncta per cell (G) and GFP-LC3 puncta per cell (H) for experiment shown in Fig 1E in MEFs infected with SIN/mCherry-capsid/ GFP-LC3. Results represent mean SEM of triplicate samples (~100 cells analyzed per sample). NS = not significant; two-tailed unpaired t-test. EV1

Ming Y Lee et al PEX13 functions in selective autophagy A B C D E F G H Figure EV1. EV2

PEX13 functions in selective autophagy Ming Y Lee et al Figure EV2. PEX13 colocalization with Parkin during mitophagy and analysis of mitochondrial morphology and metabolism in Pex13 / MEFs. A Western blot detection of PEX13 and ATG7 in HeLa/Parkin cells transfected with the indicated sirna. Asterisk denotes nonspecific band. B Representative images of Parkin colocalization with TOMM20 in HeLa/Parkin cells treated with indicated sirna after treatment with DMSO or 10 lm CCCP for 4 h. Scale bars, 20 lm. C Transmission electron microscopic analysis of MEFs in control conditions or following CCCP-induced mitochondrial damage. Shown are representative images of mitochondrial morphology in MEFs of the indicated genotype 24 h after treatment with 30 lm CCCP or DMSO vehicle control. Black arrowhead denotes autolysosome containing damaged mitochondria; white arrowheads denote mitochondria with abnormal cristae morphology. Scale bars, 500 nm. D Representative images of TOMM20 staining in MEFs of the indicated genotype with DMSO or 30 lm CCCP for 24 h. Insets show reticular mitochondrial morphology during basal state and fragmented damaged mitochondria after CCCP treatment. White lines indicate cell borders. Scale bars, 20 lm. E, F Mitochondrial metabolism assay in primary MEFs of the indicated genotype. Mitochondrial oxygen consumption rate normalized to total protein level (E) and extracellular acidification rate (ECAR) adjusted to total protein level (F) are shown. Plot shows the average and SEM of 5 samples. Source data are available online for this figure. EV3

Ming Y Lee et al PEX13 functions in selective autophagy A D B C E F Figure EV2. EV4

PEX13 functions in selective autophagy Ming Y Lee et al Figure EV3. Disease-associated PEX13 mutant protein colocalization with peroxisomes and effects on mitochondrial morphology, and structured illumination microscopic analyses of mitochondria in PEX13 patient mutant fibroblasts. A Representative images of wild-type and mutant PEX13 colocalization with PMP70 in HeLa/Parkin cells transduced with lentivirus containing the indicated PEX13- MYC-DDK cdna. Scale bars, 20 lm. B Representative images of TOMM20 morphology 16 h after DMSO vehicle treatment in HeLa/Parkin cells transfected with PEX13 sirna and indicated PEX13 sirnaresistant plasmids. Scale bars, 20 lm. C Representative structured illumination microscopy (SIM) 3D projections of wild-type and PEX13 W313G mutant primary human fibroblasts treated with MitoTracker CMX rosamine (CMXROS, 50 nm, 30 min). White arrowheads indicate mitochondrial fragments. Scale bar, 5 lm. EV5

Ming Y Lee et al PEX13 functions in selective autophagy A B C Figure EV3. EV6

PEX13 functions in selective autophagy Ming Y Lee et al Figure EV4. PEX3 is required for mitophagy. A Quantitative real-time PCR of PEX3 mrna detection in HeLa/Parkin cells transfected with indicated sirna. Results represent mean SEM of triplicate samples. Similar results were observed in three independent experiments. ***P < 0.001; one-way ANOVA with adjustment for multiple comparisons. B Representative images of Parkin colocalization with TOMM20 in HeLa/Parkin cells treated with indicated sirna after treatment with DMSO or 10 lm CCCP for 4 h. Scale bars 20 lm. C Representative images of Parkin-mediated clearance of TOMM20 in HeLa/Parkin cells transfected with indicated sirna and after treatment with DMSO or 10 lm CCCP for 16 h. Scale bars, 20 lm. D Quantification of TOMM20 clearance in the experiment shown in (C). Results represent mean SEM of triplicate samples (~100 cells analyzed per sample). Similar results were observed in more than three independent experiments. *P < 0.05, *** P < 0.001, NS = not significant; one-way ANOVA with adjustment for multiple comparisons. E Representative images of Parkin-mediated clearance of mtdna after 8 h of treatment with 2.5 lm oligomycin and 250 nm antimycin A (OA) or DMSO vehicle control in HeLa/HA-Parkin cells treated with indicated sirna. sipex3 oligo #1 is shown; similar results were observed with three other sipex3 oligos. Nuclear DNA staining was masked using DAPI. Scale bars, 20 lm. F Quantification of mtdna clearance in the experiment shown in (E). Results represent box plots of ~300 cells analyzed per sample. Whiskers represent 5 95% range and the horizontal lines of the boxes indicate the 25 th, 50 th, and 75 th percentiles of the dataset. Each outlier is represented by a dot. Similar results were observed in three independent experiments. ***P < 0.001; Kruskal Wallis H-test. EV7

Ming Y Lee et al PEX13 functions in selective autophagy A B C D E F Figure EV4. EV8

A PEX13 functions in selective autophagy Ming Y Lee et al C B D Figure EV5. EV9

Ming Y Lee et al PEX13 functions in selective autophagy Figure EV5. PEX protein colocalization with peroxisomes and mitochondria in baseline and mitophagy conditions, and roles of different PEX proteins in general autophagy. A, B Representative images of TOMM20 and PMP70 co-staining in HeLa/Parkin cells treated with the indicated sirna 4 h after treatment with DMSO (A) or 10 lm CCCP (B). Scale bars, 20 lm. C Representative images of mitochondrial inner membrane protein ATP5B and peroxisome membrane protein PMP70 co-staining in primary MEFs of the indicated genotype 24 h after treatment with DMSO or 30 lm CCCP. Scale bars, 20 lm. D Quantification of endogenous LC3 puncta in HeLa/GFP-LC3 cells treated with 10 nm Baf A1 or DMSO vehicle and cultured in normal medium or 3 h HBSS starvation media. Results represent mean SEM in triplicate samples (~100 cells analyzed per sample). Similar results were observed in three independent experiments. *P < 0.05, **P < 0.01, ****P < 0.001, NS = not significant; one-way ANOVA with adjustment for multiple comparisons. Statistical analyses refer to the differences between Pex or ATG7 sirnas vs. NC sirna within each treatment group. EV10

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback