Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

Similar documents
ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic b Cell Survival under Endoplasmic Reticulum Stress

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Plasma exposure levels from individual mice 4 hours post IP administration at the

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

SUPPLEMENTARY INFORMATION

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Materials for

SUPPLEMENTARY INFORMATION

T H E J O U R N A L O F C E L L B I O L O G Y

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

SUPPLEMENTARY INFORMATION

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Reduced Insulin Signaling and Endoplasmic Reticulum Stress Act Synergistically to Deteriorate Pancreatic β Cell Function

Supplemental Material:

Benbo Song, Donalyn Scheuner, David Ron, Subramaniam Pennathur, and Randal J. Kaufman

Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase

2.5. AMPK activity

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism

Inhibition of Cdk5 Promotes β-cell Differentiation from Ductal Progenitors

High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Supplementary Figure 1

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Supplementary Materials for

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow

Peter Walter, UCSF IRE1 Signaling Affects Cell Fate during the Unfolded Protein Response

Supplementary Material

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin

Supporting Online Material for

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

SUPPLEMENTARY INFORMATION

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain

SUPPLEMENTARY FIGURES AND TABLE

Supplementary Materials

Lack of Association between Endoplasmic Reticulum Stress Response Genes and Suicidal Victims

Supplementary Figure 1

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535

Supplementary Figure 1 IL-27 IL

supplementary information

Supplementary Materials for

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY INFORMATION

Excessive intake of diets rich in fat results in the. Endoplasmic Reticulum Stress Promotes LIPIN2-Dependent Hepatic Insulin Resistance

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table. File Name: Peer Review File Description:

Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells.

Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535

Supplementary Materials for

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2

Supporting Information. Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

SUPPLEMENTARY INFORMATION

Supplemental Figure 1

Supplementary Figures

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Contents Materials and Methods Figs. S1 and S8 References and Notes

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

A. List of selected proteins with high SILAC (H/L) ratios identified in mass

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

Supplementary Figure 1

Appendix. Table of Contents

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Supplemental Table S1

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

Annals of RSCB Vol. XVI, Issue 1

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

Supplementary Information

Supplementary Information Titles Journal: Nature Medicine

Interleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion

Supplemental Materials, Nishimura et al, Page1 of 22 1

Figure S1. Effect of bafilomycin on EGF-induced Akt and Erk signaling. Effect of chloroquine on EGF-stimulated mtorc1, Akt and Erk

Involvement of FKBP6 in hepatitis C virus replication

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Transcription:

Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara, Takahiro Yamada, Akira Tamura, Masahiro Usui, Ryu Tominaga, Yuichiro Munakata, Chihiro Satake, Hideki Katagiri, Fumi Tashiro, Hiroyuki Aburatani, Kyoko Tsukiyama-Kohara, Jun-ichi Miyazaki, Nahum Sonenberg, and Yoshitomo Oka

Con Tg Ad.v. lacz Flag-DN-ATF6 lacz Flag-DN-ATF6 Flag-DN-ATF6 GRP78 4E-BP1 actin Con Tg Ad.v. lacz DN-XBP1 lacz DN-XBP1 DN-XBP1 HRD1 4E-BP1 actin Figure S1. Effects of DN-ATF or DN-XBP1 Expression on 4E-BP1 Induction Upper panel: no suppression of thapsigargin-triggered 4E-BP1 induction with expression of the Flag-tagged dominant-negative (DN) ATF6 (Flag-DN-ATF6: ATF6(171-373) lacking the activation domain (Yoshida et al., )). MIN6 cells infected with an adenovirus expressing either lacz or the Flag-DN-ATF6 were treated with vehicle (.5% DMSO) control (Con) or thapsigargin (Tg,.5 µm) for 12 hr. Cell lysates were analyzed for expressions of Flag-DN-ATF6, GRP78 (ATF6-target), 4E-BP1 and actin (loading control). Lower panel: no suppression of Tg-triggered 4E-BP1 induction with expression of the DN-XBP1 (XBP1(1-188) lacking the activation domain (Lee et al., 3)). MIN6 cells infected with an adenovirus expressing either lacz or the DN-XBP1 were treated with vehicle control (Con) or Tg for 12 hr. Cell lysates were analyzed for expressions of DN-XBP1, HRD1 (XBP1-target), 4E-BP1 and actin (loading control).

FFLuc pa MluI NcoI P9 P8 P7 P6 P5 P4 P3 P2 P1 Exon1 Exon2 Exon3 Eif4ebp1 locus I1-1 I1-2 I1-3 I1-4 I1-5 I1-6 I1-7 I1-8 E2+I2 E3 + 3 NCDS BamHI SalI SV4p FFLuc pa 2. Luciferase activity (fold induction by Tg) 1.5 1..5. P1 P2 P3 P4 P5 P6 P7 P8 P9 I1-1 I1-2 I1-3 I1-4 I1-5 I1-6 I1-7 I1-8 E2+I2 E3+3 NCDS

Figure S2. Search for Mouse Eif4ebp1 Gene Segments Conferring Tg Responsiveness to Luciferase Reporter Constructs Upper panel: reporter constructs used for luciferase activity measurements are presented. PCR-amplified Eif4ebp1 promoter segments were cloned into the pgl3-basic construct (Promega). P1, -1 to 26 (A in the initial ATG codon is determined as +1); P2, -1 to -1,129; P3, -1 to -2,216; P4, -1 to -3,182; P5, -1 to 4,27; P6, -1 to -4,791; P7, -1 to 6,537; P8, -1 to -7,978; P9, -1 to -9,968. PCR-amplified Eif4ebp1 segments spanning from exon 1 to the 3 non-coding sequence (3 NCDS) were cloned into the pgl3-promoter construct (Promega). I1-1, +1 to 1,821; I1-2, 1,821 to 3,49; I1-3, 3,49 to 5,198; I1-4, 5,198 to 6,957; I1-5, 6,957 to 8,752; I1-6, 8,752 to 9,977; I1-7, 9,977 to 11,84; I1-8, 11,84 to 12,949; E2+I2, 12,921 to 14,73; E3+3 NCDS, 14,74 to 16,26. Lower panel: thapsigargin (Tg)-induced firefly luciferase activity in MIN6 cells transfected with reporter constructs shown in the upper panel. Firefly luciferase activity was normalized to Renilla luciferase activity and ratios of normalized activities in the presence to those in the absence of Tg are presented. Each experiment was performed employing 1 or 2 constructs and all data are presented together in one panel. Values are the means of 1 to 3 experiments, each performed in triplicate. Experiments were always conducted with a negative control construct (pgl3-promoter: a SV4 promoter construct with no insertion between the BamHI and SalI sites) and a positive control construct (pgl3-basic with the Chop promoter). Fold inductions of the negative and positive controls were 1.3 ±.9 and 3.4 ±.11-fold (n = 25), respectively. Data obtained with the negative control are shown as a dashed line.

A MIN6WT MIN6 AdlacZ AdlacZ Ad4E-BP1 Con Tg Con Tg Con Tg B 4E-BP1 actin Cell viability (%) 8 6 4 WT 4ebp1 -/- WT 4ebp1 -/- Con Thapsigargin MIN6WT: AdlacZ MIN6 : AdlacZ MIN6 : Ad4E-BP1 Figure S3. Higher Sensitivity of 4E-BP1-Deficient MIN6 Cells and Islets to ER Stress (A) Reduced viability of MIN6 cells treated with.5 µm thapsigargin (Tg) was restored by re-expression of 4E-BP1. Data from MIN6WT cells treated with vehicle (.5% DMSO) were taken as %. Error bars show SEM. n = 4; p <.5, p <.1. Adenovirus-mediated re-expression of 4E-BP1 is shown in the upper panel. Con, vehicle-treated cells. (B) Increased apoptotic DNA ladder formation in isolated islets from mice. Islets isolated from mice of each genotype at 12 weeks of age were incubated in RPMI medium for 3 days and DNA fragmentation was analyzed by ligation-mediated PCR as described previously (Ishihara et al., 4).

A Blood glucose (mg/dl) 18 16 14 1 8 6 4 8 12 16 24 28 Age (weeks) B Blood glucose (mg/dl) 45 4 35 3 25 15 5 15 3 6 9 1 C D Insulin (ng/ml) 3. 2.5 2. 1.5 1..5. 15 3 45 6 Pancreas Insulin (ng/mg) 4 35 3 25 15 5 E F 45 1 Body weight (g) 4 35 3 25 Blood glucose (% of basal value) 8 6 4 15 4 8 12 16 24 28 Age (weeks) 15 3 45 6

Figure S4. Body Weight and Glucose Homeostasis in Wild-Type and Eif4ebp -/- Mice Fed Standard Chow or a High-Fat Diet (A) Fed blood glucose levels of wild-type and Eif4ebp -/- mice on standard or a high-fat diet (D; Research Diets D12451). (B) Blood glucose levels during intraperitoneal glucose tolerance tests (2 g glucose per kg of body weight) in wild-type and Eif4ebp -/- mice fed or a D at 24 weeks of age. (C) Plasma insulin levels during intraperitoneal glucose tolerance tests (2 g glucose per kg of body weight) in wild-type and Eif4ebp -/- mice fed or a D at 26 weeks of age. (D) Pancreatic insulin contents of wild-type and Eif4ebp -/- mice fed or a D at 28 weeks of age. (E) Growth curves of wild-type and Eif4ebp -/- mice fed or a D. (F) Insulin tolerance tests in wild-type and Eif4ebp -/- mice fed or a D at 25 weeks of age. After a 6 hr fast, mice were given an intraperitoneal injection of insulin (.75 µu/g body weight). Blood glucose levels at time zero were 69 ± 5 (-fed wild-type), 84 ± 11 (-fed ), 79 ± 5 (D-fed wild-type) and 17 ± 6 mg/dl (D-fed ). p <.5 and p <.1, between D-fed Eif4ebp -/- and D-fed wild-type mice. n = 4-6. Error bars show SEM.

A Body weight (g) B Body weight (g) 25 15 1 35 3 25 15 Ins2 WT/C96Y Ins2 WT/C96Y 3 6 9 12 Age (weeks) Wfs1 -/- Wfs1 -/- 4 12 28 Age (weeks) C Blood glucose (% of basal value) D Blood glucose (% of basal value) 1 8 6 4 1 8 6 4 Ins2 WT/C96Y Ins2 WT/C96Y 15 3 45 6 Wfs1 -/- Wfs1 -/- 15 3 45 6 Figure S5. Characterization of 4E-BP1-Deficient Ins2 WT/C96Y and Wfs1 -/- Mice (A) Growth curves of wild-type, Eif4ebp -/-, Ins2 WT/C96Y and Ins2 WT/C96Y mice. n = 5-11. (B) Growth curves of wild-type,, Wfs1 -/- and Wfs1 -/- mice. n = 8-15. (C) Intraperitoneal insulin tolerance tests in wild-type,, Ins2 WT/C96Y and Ins2 WT/C96Y mice at 5 weeks of age. After a 6 hr fast, mice were given an intraperitoneal injection of insulin (.75 µu/g body weight). Blood glucose levels at time zero were 77 ± 6 (wild-type), 72 ± 5 ( ), 216 ± 19 (Ins2 WT/C96Y ) and 271 ± 23 mg/dl ( Ins2 WT/C96Y ). n = 5-8. Insulin sensitivities did not differ among the four groups. (D) Insulin tolerance tests in wild-type,, Wfs1 -/- and Wfs1 -/- mice at 24 weeks of age. After a 6 hr fast (time zero), blood glucose was reduced to similar levels in all four groups; blood glucose levels at time zero were 79 ± 6 (wild-type), 73 ± 5 ( ), 8 ± 7 (Wfs1 -/- ) and 77 ± 9 mg/dl ( Wfs1 -/- ), n = 7-9. Insulin sensitivities did not differ among the four groups (p >.94). Error bars show SEM.

CHX (hr) 2 8 4E-BP1 CHOP actin Figure S6. 4E-BP1 Protein Is Stable within Cells MIN6 cells were incubated with thapsigargin (.5 µm) for 24 hr, washed with PBS and treated with cycloheximide (CHX, 5 µm) for the indicated period. Cell lysates were subjected to immunoblotting with an anti-4e-bp1 antibody. Immunoblotting results for CHOP are also presented for comparison. The data are representative of three independent experiments. Supplemental References Lee, A.-H., Iwakoshi, N.N., and Glimcher, L.H. (3). XBP-1 regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. Mol. Cell. Biol. 3. 23, 7448-7459. Yoshida, H., Okada, T., Haze, K., Yanagi, H., Yura, T., Negishi, M., and Mori, K. (). ATF6 activated by proteolysis binds in the presence of NF-Y (CBF) directly to the cis-acting element responsible for the mammalian unfolded protein response. Mol. Cell. Biol., 6755-6767.

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback