Supplementary Figure 1 b

Supplementary Figure 1 b 7 c BT-474 MDA-MB-231 migrated cells/field m G oc F k BR P-s i BRL-s L- i1 si BR N 2 M C S1 L 7 BR M S1 N C FP -s i BR Lsi 1 BR Lsi 2 G m oc k L a 3 ****** 2 ### 1 BT-474 MDA-MB-231 mrna expression e d 1.5 vimentin fibronectin 1. ** **.5 Supplementary Figure 1. inhibits migration and EMT of breast cancer cells. (ab) Western blotting of in BT-474 cells that were transfected () or transfected with RNA () or either of the two -sirnas (BRL-si) (a) and in MDA-MB-231 cells that were transfected with pcdna3 vector overexpressing () or an empty vector as negative control () (b). was used as a loading control. (c) Boyden chamber assays for migration of BT-474 cells that were transfected as in (a) and MDA-MB-231 cells transfected as in (b). Bars correspond to mean ± SD. ***, P <.1 as compared with RNA. ###, P <.1, as compared with. Scale bars correspond to 5 µm.(d) Phase-contrast microscopy for MDA-MB-231 cells that were treated as in (b). Scale bar corresponds to 5 µm.(e) qrt-pcr for vimentin and fibronectin mrna expression in MDA-MB-231 cells that were treated as in (b). Bars correspond to mean ± SD. **, P <.1 as compared with.these data are representative of three independent experiments. Student s t-test was used for the comparison of two independent groups. BRL,.

Supplementary Figure 2 a c e mrna expression/gapdh.6.4.2 FZD1 + cells(%) normalized mrna 8 6 4 2 1 8 6 UT FZD1 FZD2 FZD3 FZD4 FZD1 FZD5 FZD6 FZD7 FZD8 FZD9 FZD1 *** *** r=-.762 P<.1 2 2 6 8 1 *** b d f mrna expression/gapdh normalized mrna.3.2.1 1 8 6 4 2 FZD1 FZD1 FZD2 FZD3 FZD1 *** FZD4 FZD5 FZD6 FZD7 FZD8 ### *** FZD9 FZD1 MCF-1A T47D MCF-7 BT-474 MDA-MB-436 MDA-MB-231 7 + cells(%) Supplementary Figure 2. FZD1 expression is negatively associated with. (ab) qrt-pcr for 1 FZD family members in MDA-MB-231 cells transfected with pcdna3 vector overexpressing () or negative control () (a) and in T47D cells that were transfected (), or transfected with RNA or either of the two sirnas (b). Bars correspond to mean ± SD. ***, P <.1 as compared with or GFPsiRNA. (c-d) qrt-pcr for and FZD1 expression in T47D cells that were untreated (UT) or transfected as in b (c) and in MDA-MB-231 cells that were transfected or transfected as in a (d). Bars correspond to mean ± SD. ***, P <.1 as compared with GFPsiRNA or. ###, P <.1 as compared with. (e) Correlation between the percentages of + and FZD1 + breast cancer cells. Linear regression was used to analyze the correlation.(f) FZD1 protein expression measured by western blotting in various breast cell lines. All the data are representative of three independent experiments. Student s t-test was used for the comparison of two independent groups. BRL,.

Supplementary Figure 3. enhances HDAC1/2 binding to FZD1 promoter and inhibits H3K9 acetylation. (a) MDA-MB-231 cells with stable transfection of pgl3-fzd1- promoter were transfected with pcdna3 vector carrying () or negative control () and assayed for luciferase activity. ***, P <.1 as compared with. (b) Schematic diagram shows primer pairs of the FZD1 proximal and distal promoter regions for ChIP assay.(c) ChIP analysis for binding to FZD1 promoter in MBA-MD-231 cells transfected with Myc- or. (d-e) ChIP analysis for HDAC1 binding to FZD1 promoter in T47D cells transfected with -sirnas or RNA (d) and in MDA-MB-231 cells transfected with pcdna3 vector overexpressing () or negative control () (e) using primer pairs of FZD1 distal promoter as a control. (f-g) ChIP analysis for H3K9Ac binding to FZD1 promoter in T47D cells transfected with -sirnas or GFPsiRNA (f) and in MDA-MB-231 cells transfected with pcdna3 vector overexpressing () or negative control () (g) using primer pairs of FZD1 distal promoter as a control. These data are representative of three independent experiments. Student s t-test was used for the comparison of two independent groups.brl,. Supplementary Figure 3 a luciferase activity 12 1 8 6 4 2 *** b -15292-14 -561-3 pgl3-basic pgl3-fzd1 c Distal d e Distal Distal ChIP-IgG ChIP-IgG ChIP-IgG 1. ChIP-anti-Myc 4 ChIP-anti-HDAC1 3 ChIP-anti-HDAC1.8 3 2.6.4 2 1.2 1 f Bound / input Bound / input Distal Myc- Bound / input 1. ChIP-IgG.8.6.4.2 Distal g Distal Bound / input 1..8.6.4.2 Bound / input Proximal ChIP-IgG ChIP-anti-H3K9Ac FZD1

Supplementary Figure 4 a SP1 b d GAGGAGAGGCGGGCGGGACTGCCGGGGAGGG -31-294 -28-271 normalized SP1 1.2 1..8.6.4 ** **.2 SP1-si1 SP1-si2 Distal SP1-15292 -14-31 -9 c SP1 FZD1 SP1 1 7 e Bound / input Distal ChIP-IgG.7.6 ChIP-anti-SP1.5.4.3.2.1 f Bound / input Distal.25 ChIP-IgG.2 ChIP-anti-SP1.15.1.5 Supplementary Figure 4. suppresses SP1-mediated FZD1 transcription. (a) Sequence of predicted SP1-binding site located between -4 to -25 bp of FZD1 promoter. Point mutation sites for FZD1-2-SP1-Mut-Luc recombinant plasmid were indicated as bold.(b) SP1 was efficiently silenced by sirnas. Bars correspond to mean ± SD.**, P <.1 as compared with GFPsiRNA. (c) Ectopic SP1 expression in T47D cells evaluated by western blotting. (d) Schematic diagram shows primer pairs spanning the SP1-binding site and a distal promoter region for ChIP assay. (e-f) ChIP analysis for SP1 binding to FZD1 promoter in MDA-MB-231 cells transfected with or (e) and in T47D cells transfected with -sirnas or RNA (f) using distal primer pairs as control. These data are representative of three independent experiments. Student s t-test was used for the comparison of two independent groups. BRL,.

Supplementary Figure 5. inhibits activation of canonical Wnt pathway via FZD1. (a-b) qrt-pcr for AXIN2 and TCF-1 expression in MDA-MB-231 cells transfected with pcdna3 vector overexpressing () or negative control () (a) or in T47D cells that were transfected (), or transfected with RNA or two -sirnas (b). Bars correspond to mean ± SD. **, P <.1, ***, P <.1 as compared with -vector or RNA. ##, P <.1, as compared with or RNA. (c-d) Western blotting for total JNK (t-jnk), p-jnk (Thr183/Tyr185) and expression in MDA-MB-231 cells that were transfected as in a (c) and in T47D cells that were treated as in b (d). (e-f) qrt-pcr for AXIN2 and TCF-1 expression in MDA-MB-231 cells (e) and in T47D cells (f) treated as indicated. Bars correspond to mean ± SD. **, P <.1 as compared with p- or -sirna. ##, P <.1 as compared with or -sirna. (g) Immunofluorescent saining for β-catenin in MDA-MB-231 cells treated as in e. Scale bar corresponds to 15 µm. These data are representative of three independent experiments. Student s t-test was used for the comparison of two independent groups. BRL,. Supplementary Figure 5 a normalized mrna 1.5 Axin2 TCF-1 p-jnk (Thr183/Tyr185) g t-jnk ** ## b normalized mrna 4 3 2 1 e Axin2 TCF-1 2 1.5 1.5 normalized mrna2.5 p-jnk (Thr183/Tyr185) ## ## t-jnk *** *** Axin2 TCF-1 FZD1 c ** ## FZD1 +FZD1 f normalized mrna +FZD1 4 3 2 1 Axin2 TCF-1 ** ## **## **##** ## FZD-si1 FZD-si2 FZD-si1 FZD-si2 Merge DAPI β-catenin

Supplementary Figure 6 a b mrna expression/gapdh mrna expression/gapdh.3.2.1.12.9.6.3 WNT1 WNT2 WNT1 ** WNT2B WNT3 ** * WNT2 WNT2B WNT3 WNT3A WNT4 WNT5A ** ** WNT3A WNT4 WNT5A WNT5B WNT6 WNT7A WNT7B WNT8A WNT8B WNT9A WNT9B ** WNT5B WNT6 WNT7A WNT7B WNT8A WNT8B WNT9A WNT9B WNT1A * * WNT1A WNT1B WNT11 WNT16 ** WNT1B WNT11 WNT16 Supplementary Figure 6. Screening Wnt ligands responsible for the activation of Wnt pathway via -FZD1. (a-b) qrt-pcr for 19 Wnt family members in MDA-MB-231 cells transfected with pcdna3 vector overexpressing () or negative control () (a) and in T47D cells that were transfected (), or transfected with GFPsiRNA or either of the two -sirnas (b). Bars correspond to mean ± SD. *, P <.5 and **, P <.1 as compared with or RNA. These data are representative of three independent experiments. Student s t-test was used for the comparison of two independent groups. BRL,.

Supplementary Figure 7 a normalized mrna 1.5 1.5 AXIN2 TCF-1 **## **## WNT3-si1 WNT3-si2 b normalized mrna WNT3-si1 WNT3-si2 WNT3-si1 WNT3-si2 d e f AXIN2 AXIN2 5 1.5 4 TCF-1 4 3 3 1 2 2.5 1 1 normalized mrna g normalized mrna 2 1.5 1.5 WNT3-si1 AXIN2 WNT3-si2 WNT3-si1 WNT3-si2 WNT1B-si1 WNT1B-si2 3 2 1 normalized mrna h normalized mrna AXIN2 TCF-1 2.5 2 1.5 1.5 AXIN2 TCF-1 ** ** ** ## ## ## **## WNT3-si1 WNT3-si2 normalized mrna WNT1B-si1 WNT1B-si2 c normalized mrna WNT1B-si1 WNT1B-si2 1.5 1.5 AXIN2 AXIN2 TCF-1 WNT3-si1 WNT3-si2 WNT3-si1 WNT3-si2 WNT3-si1 WNT3-si2 Supplementary Figure 7. WNT3 affects the activation of canonical Wnt pathway following silencing. (a-b) qrt-pcr for AXIN2 and TCF-1 expression in MDA-MB-231 cells that were transfected, or transfected with RNA or two WNT3-siRNAs (a) and in T47D cells that were transfected (), transfected with RNA or either of the two -sirnas, or co-transfected with WNT3-siRNAs and -sirnas (b). Bars correspond to mean ± SD. **, P <.1 and ##, P <.1 as compared with RNA or -sirnas. (c-h) qrt-pcr for AXIN2 and TCF-1 expression in MDA-MB-231cells (c, e and g) or in T47D cells (d, f and h) treated as indicated.these data are representative of three independent experiments. Student s t-test was used for the comparison of two independent groups.brl,.

Supplementary Figure 8 a b c Relative Lucerfase Activity 1.2.8.4 MCF-1A T47D BT-474 MCF-7 MDA-MB-436 MDA-MB-231 normalized mrna 1.2.8.4 lin4 T47D 16b lin4 16b ASO MDA-MB-231 T47D lin4 16b MDA-MB-231 lin4 16b ASO Supplementary Figure 8. mir-16b post-transcriptionally inhibits expression. (a) Luciferase activity was measured in different breast cell lines that were transfected with PGL3 plasmid containing a 25bp DNA fragment upstream of TSS. (b-c) qrt- PCR (b) and western blotting (c) for in T47D cells that were transfected (), or transfected with lin4 mimics (lin4) or mir-16b mimics (16b) and in MDA-MB-231 cells that were transfected (), or transfected with lin4 mimics (lin4) or mir-16b ASO (16b ASO). Bars correspond to mean ± SD. ***, P <.1, ###, P <.1 as compared with lin4.these data are representative of three independent experiments. Student s t- test was used for the comparison of two independent groups.

Supplementary Figure 9 a tumor volum (mm 3 ) c positive cells (%) d FZD1(%) 2 16 12 8 1 8 6 2 8 6 2 BT-474 GFP-sh BRL-sh1 BRL-sh2 9 15 21 27 33 39 45 51 57 6 days after implanation BT-474 FZD1 GFP-sh *** *** *** BRL-sh1 BRL-sh2 BT-474 *** R= -.96 P <.1 b tumor volum (mm 3 ) 2 16 12 8 FZD1(%) 8 6 2 positive cells (%)1 8 6 2 MDA-MB-231 9 15 21 27 33 39 45 51 57 6 days after implanation FZD1 MDA-MB-231 *** MDA-MB-231 *** R= -.97 P <.1 2 6 8 1 (%) 2 6 8 1 (%) Supplementary Figure 9. did not affect the primary tumor growth rate in tumor xenografts. (a-b)tumor volume of breast cancer xenografts in the nude mice inoculated with BT-474 that were enforced to stably express two shrnas targeting (-shrnas) or GFP (GFP-shRNA) as negative control (a) or MDA-MB-231 cells stably overxpressing or negative control () (b). BRL,.(c) The positive cells of and FZD1 in BT-474 cells treated as in (a) and MDA-MB-231 cells treated as in (b). ***,P <.1 as compared with GFP-sh or (Student t-test).(d) Correlation between the percentages of + and FZD1 + breast cancer cells.linear regression was used to analyze the correlation.

Supplementary Figure 1a Figure 1a MCF-1A T47D BT-474 ZR75-1 MCF-7 MDA-MB-453 BT-549 MDA-MB-436 MDA-MB-231 Figure 2e E-cadherin Vimentin 17 13 7 Figure 3c UT FZD1 7 Supplementary Figure 1a. Original blot images of western blotting analysis. Red boxes highlight lanes used in figures.brl,.

Supplementary Figure 1b Figure 3d FZD1 7 Figure 3e E-cadherin UT FZD1-si1 FZD1-si2 17 13 Vimentin 7 Figure 5d β-cat(c) β-cat(n) laminb FZD1 +FZD1 1 7 1 7 7 Figure 5e β-cat(c) β-cat(n) laminb FZD1-si1 FZD1-si2 FZD1-si1 FZD1-si2 FZD1-si1 FZD1-si2 FZD1-si1 FZD1-si2 1 7 1 7 7 Supplementary Figure 1b. Original blot images of western blotting analysis. Red boxes highlight lanes used in figures. β-cat, β-catenin. BRL,.

Supplementary Figure 1c Figure 5g β-catenin(c) WNT3-si1 WNT3-si2 1 7 β-catenin(n) 1 7 laminb Figure 5h β-catenin(c) WNT3-si1 WNT3-si2 WNT3-si1 WNT3-si2 7 1 7 β-catenin(n) 1 7 laminb 7 Supplementary Figure 1c. Original blot images of western blotting analysis. Red boxes highlight lanes used in figures.brl,.

Supplementary Figure 1d Figure 6d β-catenin(c) β-catenin(n) laminb lin4 16b 16b +BRL-MUT Figure 6f 1 7 E-cadherin Vimentin 1 7 7 lin4 16b 16b +BRL-MUT 17 13 7 Figure 6g E-cadherin PBS _ TGF-β 17 13 Vimentin 7 Supplementary Figure 1d. Original blot images of western blotting analysis. Red boxes highlight lanes used in figures.

Supplementary Figure 1e Figure s1a Figure s1b Figure s2f FZD1 Figure s5c MCF-1A p-jnk (Thr183/Tyr185) t-jnk T47D MCF-7 BT-474 MDA-MB-436 MDA-MB-231 7 Figure s4c SP1 Figure s5d p-jnk (Thr183/Tyr185) t-jnk SP1 1 7 Figure s8c T47D lin4 16b 16b ASO MDA-MB-231 lin4 Supplementary Figure 1e. Original blot images of western blotting analysis. Red boxes highlight lanes used in figures.brl,.

Supplementary Table 1. Correlation of Expression with Clinicopathological Status in 428 Cases of Patients with Invasive Breast Cancer IRS>4 IRS 4 P value Age(years).18 45 96 16 >45 125 11 Size(cm).5 2 115 8 >2 16 127 Histological grade.19 I 79 56 II 95 94 III 47 57 Stage.21 I II 79 18 49 116 III-IV 34 42 Positive Lymph node <.1 3 185 126 >3 36 81 ER.287 positive 166 146 negative 61 HER2.238 negative 179 158 positive 42 49 Metastasis <.1 no 197 153 yes 24 54 IRS, immunoreactive score.

Supplementary Table 2. Multivariate Cox proportional hazard analysis of prognostic variables in 428 patients with breast cancer. Variable Wald(x 2 ) P value Hazard ratio 95.% CI LNM 62.3 <.1 52.233 19.568-139.428 Size 21.936 <.1 11.23 4.76-3.793 stage 18.359 <.1.38.18-.528 HER2 1.478.1 3.218 1.586-6.531 HR 5.72.17 2.383 1.17-4.854 9.386.2 3.173 1.516-6.643 Age 2.237.135.548.249-1.26 Grade.811.368 1.282.746-2.24 LNM, lymph node metastasis; HER2, human epidermalgrowth factor receptor-2.

Supplementary Table 3. Expression of, FZD1, downstream targets of Wnt signal pathway and EMT-markers in normal breast tissue and breast cancer in Oncomine online database. Downregulation of in invasive breast cancer Fold Change P-value Data base (case Invasive ductal breast carcinoma vs normal -1.6 <.1 TCGA breast(593) Invasive ductal breast carcinoma vs normal -1.254.37 Zhao breast(64) Invasive ductal breast carcinoma vs normal -1.189 <.1 Curtis breast(2136) Correlation of and good prognosis in breast cancer Fold Change P-value Data base (case Metastasis at 5 years vs no metastasis at 5-1.13.9 Loi breast(87) years recurrence at 5 years vs no recurrence at 5-1.13.9 Loi breast(87) years Metastasis at 3 years vs no metastasis at 3-1.8.36 Loi breast(87) years Recurrence at 3 years vs no recurrence at 3-1.8.36 Loi breast(87) years Recurrence at 5 years vs no recurrence at 5-1.21.9 Loi breast 3(77) years Metastasis at 5 years vs no metastasis at 5-1.21.44 Loi breast 3(77) years Upregulation of FZD1 in triple negative breast cancer Fold Change P-value Data base (case Triple negative vs other 1.169.23 Bonnefoi breast(16) Triple negative vs other 1.127.2 Tabchy breast(178) Upregulation of CTNNB1 in invasive breast cancer Fold Change P-value Data base (case Invasive breast carcinoma vs normal 2.33 <.1 Gluck breast(158) Ductal breast carcinoma insitu vs normal 1.323.18 Curtis breast(2136) Invasive breast carcinoma vs normal 1.375.11 Curtis breast(2136) Invasive ductal and lobular carcinoma vs 1.387.36 TCGA(593) normal Upregulation of CTNNB1 in triple negative breast cancer Fold Change P-value Data base (case Triple negative vs other 1.112 <.1 Curtis breast (2136) Triple negative vs other 1.259.4 TCGA(593) Triple negative vs other 1.726.47 Zhao breast(64) Triple negative vs other 1.11.28 Bonnefoi breast(16) Downregulation of CDH1 in invasive breast cancer Fold Change P-value Data base (case Iinvasive ductal breast carcinoma vs normal -1.493.18 Zhao breast(64) Ductal breast carcinoma vs normal -1.72 <.1 Richardson breast 2 (47) Downregulation of CDH1 in triple negative breast cancer Fold Change P-value Data base (case Triple negative vs other -1.744.7 Bittner breast(336) Triple negative vs other -1.596 <.1 TCGA breast(593) Triple negative vs other -1.322 <.1 Curtis breast(2136) Triple negative vs other -1.36.11 Kao breast(327)

Upregulation of VIM in triple negative breast cancer Fold Change P-value Data base (case Triple negative vs other 2.98.37 Curtis breast(2136) Triple negative vs other 1.562 <.1 Tabchy breast(178) Triple negative vs other 1.317 <.1 Bittner breast(336) Triple negative vs other 3.77.14 Esserman breast(13) Upregulation of VIM in breast cancer with positive lymph nodes Fold Change P-value Data base (case N1+ vs N 1.499.4 Zhao breast(64) N1+ vs N 2.45.31 Weigelt breast(16) N1+ vs No 1.141.5 Yu breast 3(96) N1+ vs N 1.334.12 Loi breast(87) Upregulation of AXIN2 in breast cancer with positive lymph nodes Fold Change P-value Data base (case N1+ vs N 1.249.6 Lu breast(129) N1+ vs N 1.81.39 Korde breast(61) N1+ vs N 1.954.25 TCGA(593) Upregulation of TCF-1 in triple negative breast cancer Fold Change P-value Data base (case Triple negative vs other 1.928.6 Bild breast(158) Triple negative vs other 1.8 <.1 TCGA(593) Triple negative vs other 1.146.48 Chin breast(118) Triple negative vs other 1.25.4 Curtis breast(2136) Upregulation of FZD1 in high stage breast cancer Fold Change P-value Data base (case Stage IV vs stage I, II and III.15 Chin Breast (118) Grade 3 vs grade 2 1.192.29 Bonnefoi breast (16) Stage III vs stage,1 and 2.11 Curtis breast (2136) Correlation of CTNNB1 and poor Fold P-value Data base (case prognosis in breast cancer Change Dead at 5 years vs no 1.81.5 Curtis breast (2136) Dead at 3 years vs no 1.76.3 Curtis breast (2136) M1+ vs M 1.364.37 Sorlie breast 2 (167) Recurrence at 5 years vs no 1.294.4 Sorlie breast 2 (167) Dead at 5 years vs no 1.259.33 Sorlie breast 2 (167) Recurrence at 5 years vs no 2.75.23 Sorlie breast (85) Dead at 3 years vs no 3.426.5 Sorlie breast (85) Metastatic event at 1 year vs no 1.168.16 Bos breast(24) Correlation of AXIN2 and poor prognosis Fold P-value Data base (case in breast cancer Change Dead at 5 years vs no 1.27.47 Esserman breast (13) Metastatic event at 5 years vs no 1.117.2 Loi breast (87) Recurrence at 5 years vs no 1.117.2 Loi breast (87) Metastatic event at 5 years vs no 1.11.39 Loi breast 3 (77) Recurrence at 5 years vs no 1.78.3 Loi breast 3 (77) Correlation of TCF-1 and poor prognosis Fold P-value Data base (case in breast cancer Change Dead at 1 year vs no 1.41.42 Curtis breast (2136) Dead at 5 years vs no 1.12.23 Curtis breast (2136)

Metastatic event at 3 years vs no 1.95.14 Curtis breast (2136) Metastasis vs primary site 1.993.2 Sorlie breast2 (167) Metastatic event at 3 years vs no 1.86 <.1 Hatzis breast (58) Metastatic event at 5 years vs no 1.116 <.1 Hatzis breast (58) Correlation of CDH1 and good prognosis Fold P-value Data base (case in breast cancer Change Metastatic event at 5 years vs no -1.574 <.1 Hatzis breast (58) Metastatic event at 3 years vs no -1.334 <.1 Hatzis breast (58) Metastatic event at 1 year vs no -1.254.27 Hatzis breast (58) Metastatic event at 1 year vs no -1.296.43 Desmedt breast (198) Dead at 5 years vs no -3.615.39 Curtis breast (2136) Correlation of VIM and poor prognosis Fold P-value Data base (case in breast cancer Change Recurrence at 1 year vs no 1.375 <.1 Wang breast (286) Metastatic event at 5 years vs no 1.444 <.1 Wang breast (286) Metastatic event at 3 years vs no 1.29 <.1 Wang breast (286) Dead at 1 years vs no 1.18.41 Curtis breast (2136) Dead at 5 years vs no 1.11 <.1 Curtis breast (2136) Dead at 3 years vs no 1.9 <.1 Curtis breast (2136) Metastatic event at 3 years vs no 1.428.12 Minn breast 2 (121) Metastatic event at 5 years vs no 1.354.1 Minn breast 2 (121) Recurrence at 3 years vs no 1.251.45 Sorlie breast 2 (167) Metastatic event at 1 year vs no 1.313.18 Desmedt breast (198) Recurrence at 5 years vs no 1.724.36 Desmedt breast (198) Recurrence at 5years vs no 1.666.45 Ma breast 2 () Metastatic event at 1 year vs no 1.7.47 vandevijver breast (295) Dead at 3 years vs no 1.61.3 vandevijver breast (295) Dead at 5 years vs no 1.46.38 vandevijver breast (295) Metastatic event at 5 years vs no 1.37.4 Kao breast (327) Metastatic event at 3 years vs no 1.272.25 Kao breast (327) Metastatic event at 3 years vs no 1.439 <.1 Bos breast (24) Correlation of and FZD1 in breast cancer Correlation P value Data base (case Correlation of and FZD1 in breast cancer -.435.1 Ginestier breast() Correlation of and FZD1 in breast cancer -.28.37 Stickeler breast(57) Correlation of and FZD1 in breast cancer -.195.44 Esserman breast(13) Correlation of and FZD1 in breast cancer -.328.44 Ma breast 4(66) Correlation of and CTNNB1 in breast cancer Correlation P value Data base (case Correlation of and CTNNB1 in breast cancer -.225.16 Esserman breast(13) Correlation of and CTNNB1 in breast cancer -.282 <.1 Nikolsky breast(191)

Correlation of and CTNNB1 in breast cancer -.137.3 TCGA breast(593) Correlation of and AXIN2 in breast cancer Correlation P value Data base (case Correlation of and AXIN2 in breast cancer -.282 <.1 Pawitan breast(159) Correlation of and AXIN2 in breast cancer -.52 <.1 Gluck breast(158) Correlation of and AXIN2 in breast cancer -.331 <.1 Miyake breast(115) Correlation of and TCF-1 in breast cancer Correlation P value Data base (case Correlation of and TCF-1 in breast cancer -.284 <.1 Gluck breast (158) Correlation of and TCF-1 in breast cancer -.238.37 Loi breast 3 (77) Correlation of and CDH1 in breast cancer Correlation P value Data base (case Correlation of and CDH1 in breast cancer.6.7 Curtis breast 2(1992) Correlation of and CDH1 in breast cancer.66.3 Curtis breast (2136) Correlation of and CDH1 in breast cancer.471.3 Ma breast 4 (66) Correlation of and VIM in breast cancer Correlation P value Data base (case Correlation of and VIM in breast cancer -.26 <.1 Zhang breast (313) Correlation of and VIM in breast cancer -.48.2 Ma breast 4 (66)

Supplementary Table 4. Top 5 up- and downregulated genes after ectopic expression of in MDA-MB-231cells Upregulated genes Downregulated genes Fold change Gene Fold change Gene 67.94274 3.327768 OR51Q1 4.791265 ZFP2 2.7383125 LOC646638 3.25864 PKD2L2 2.733975 CNTNAP3 2.649612 FOXE3 2.727494 RSPO1 2.475766 PDCD4 2.6956 IGLC1 2.465658 ALS2CR14 2.6723163 BICC1 2.413588 ZNF 2.57623 LOC646799 2.384113 RP3-473B4.1 2.15428 DPF3 2.3439 LOC642376 2.51335 ZIC5 2.27261 ZNF43 2.513637 GALR2 2.238376 GRIP1 2.5894 C1QL2 2.214126 PPP1R9A 2.4874651 SLC6A18 2.212 LOC284293 2.464384 NPFFR1 2.18584 LILRB3 2.46114 LOC643594 2.181653 RAD51L1 2.46913 MAGEA4 2.181334 YLPM1 2.44873 OR51D1 2.18535 LONRF1 2.376547 LRRC32 2.1753 SYT4 2.3752985 FZD1 2.149967 GRHL1 2.368635 LOC64523 2.142172 KIAA1727 2.3429294 TREML2 2.14464 LOC644113 2.31625 LOC644241 2.1391 KIF1B 2.2631712 FAM57B 2.98451 FAM26A 2.256144 KLK8 2.68977 SUHW4 2.248963 LOC644361 2.58667 USP46 2.2441123 SCUBE2 2.51671 SUB1 2.2246284 LOC4829 2.32336 LINS1 2.22632 ITGAX 2.25214 FALZ 2.2216 SCUBE2 2.23479 TOPORS 2.219653 WDR52 2.844 PLVAP 2.2181828 KIR2DL1 2.69 MGC579 2.2392 N/A 1.997165 CREM 2.23358 LOC642644 1.995 CHIC1 2.1976454 RP11-41N8.4 1.993992 C9orf77 2.1932619 ELA3A 1.984521 LOC9693 2.19283 RAMP3 1.984382 KIAA118 2.1882396 WNT7A 1.981 KIAA1411 2.188184 NRAP 1.97397 EXOC4 2.1847758 EPX 1.968113 GABPB2 2.1819196 LOC647244 1.965691 TULP4 2.1694317 MGC12965 1.953777 NPM3 2.1618323 N/A 1.95733 SLC25A14 2.16166 LOC642452 1.943924 FLJ23356 2.1511958 FGF8 1.9813 SASS6 2.1325 LOC4944 1.9673 NPM3 2.1486425 FLJ42133 1.9331 ANAPC4 2.137186 FMN1 1.921444 SMAD2 2.1346886 FFAR2 1.915837 SETD5 2.1279626 KCNT2 1.914825 SLC7A2 2.117734 LOC644529 1.9999 C5orf5 2.144796 LOC645764

Supplementary Table 5. Target scan predicts the mirnas targeting - 3 UTR Preferential conservation mirnas Higher probability* mir-93 mir-2a mir-16a mir-16b mir-17 mir-2b mir-519d (position 1128-1135 of 3 UTR) (position 576-582 of 3 UTR) Lower probability* mir-52a/b/c/d/e mir-32a/b/c/d/e mir-372 (position 575-581 of 3 UTR) mir-182 (position 1276-1283 of 3 UTR) mir-183 (position 52-58 of 3 UTR) mir-223 (position 774-781 of 3 UTR) *, sites with higher or lower probability of preferential conservation is defined according to TargetScanHuman 6.2.

Supplementary Table 6. Incidence of tumors and liver metastasis from BT-474 and MDA-MB-231 in nude mice. BT-474 (5 1 6 ) MDA-MB-231 (2 1 6 ) Groups Tumors Liver metastasis Groups Tumors Liver metastasis GFP-sh 7/8 1/8 8/8 6/8 sh1 sh2 6/8 4/8 7/8 2/8 7/8 5/8

Supplementary Table 7. Primers used for genes and cloning vectors as indicated. Primers for genes FART1-F FART1-R VANGL2-F VANGL2-R BMP8A-F BMP8A-R CAMK2B-F CAMK2B-R WNT1-F WNT1-R WNT2-F WNT2-R WNT2b-F WNT2b-R WNT3-F WNT3-R WNT3A-F WNT3A-R WNT4-F WNT4-R WNT5A-F WNT5A-R WNT5B-F Sequence CTCAGGCCGACCTTGATGG CCTGTGCGGGTTTCTGGTT ACCGCTCTAAGAGTCGAGATG GTTACTACTGTCGTCGTTTCCC ACTCTCGGTGCCTACTTCCT GCAGAGTGACAGCCACAAAC GCACACCAGGCTACCTGTC GGACGGGAAGTCATAGGCA CGATGGTGGGGTATTGTGAAC CCGGATTTTGGCGTATCAGAC CCGAGGTCAACTCTTCATGGT CCTGGCACATTATCGCACAT TGGCGTGCACTCTCAGATTT GACAAGATCAGTCCGGGTGG CCATTTGCGGCTGTGACTC TGGACACTAACACGCCGAAG CAAGATTGGCATCCAGGAGT ATGAGCGTGTCACTGCAAAG ATGGAAGTCACACCCTCTGG CCTGGAAGGACCCACAGATA GGGTGGGAACCAAGAAAAAT TGGAACCTACCCATCCCATA GCGAGAAGACTGGAATCAGG

WNT5B-R AACATCTCGGGTCTCTGCAC WNT6-F GTCACGCAGGCCTGTTCTAT WNT6-R CGTCCATAAAGAGCCTCGAC WNT7A-F CTGTGGCTGCGACAAAGAGAA WNT7A-R GCCGTGGCACTTACATTCC WNT7B-F GTTACGGCATCGACTTCTCC WNT7B-R CCGGTCCTCTAGAACCTTCC WNT8A-F GAACCTGTTTATGCTCTGGGC WNT8A-R CAGCGTTCCCAAGCAAACTG WNT8B-F CCGACACCTTTCGCTCCATC WNT8B-R CAGCCCTAGCGTTTTGTTCTC WNT9A-F GCAAGCATCTGAAGCACAAG WNT9A-R TGCTCTCGCAGTTCTTCTCA WNT9B-F TGTGCGGTGACAACCTCAAG WNT9B-R ACAGGAGCCTGATACGCCAT WNT1A-F GGTCAGCACCCAATGACATTC WNT1A-R TGGATGGCGATCTGGATGC WNT1B-F TCTGACAAGGGGACAGAACC WNT1B-R TCATTGCTTAGAGCCCGACT WNT11-F CAGGCAGTGCAACAAGACAT WNT11-R TGAGGGTCCTTGAGCAGAGT WNT16-F AAATGCGCAGGAGAGAAAAA WNT16-R ACCCTCTGATGTACGGTTGC AXIN2-F AGTGTGAGGTCCACGGAAAC AXIN2-R CTGGTGCAAAGACATAGCCA

TCF-1-F AGGAGATGAGAGCCAAGGTCA TCF-1-R AGCCTGGGTATAGCTGCATGT GAPDH-F GACTCATGACCACAGTCCATGC GAPDH-R AGAGGCAGGGATGATGTTCTG -F AGTGAAAACGGAACCACCTG -R CCATCAGGCCTCTTAAACCA HPRT-F TTCCTTGGTCAGGCAGTATAATCC HPRT-R AGTCTGGCTTATATCCAACACTTCG 18S rrna-f CGGCTACCACATCCAAGGAA 18S rrna-r GCTGGAATTACCGCGGCT FZD1-F TCAACTACCACTTCCTGGGG FZD1-R CAGCACAGCACTGACCAAAT FZD2-F AGTTCGGTTTTCAGTGGCCC FZD2-R CTCCGTCCTCGGAGTGGTT FZD3-F CAATGGAGCCATTCCACCCT FZD3-R AGGCCAAGGAACACCAAACA FZD4-F GCCAATGTGCACAGAGAAGA FZD4-R GGTTTTGTGAGGTAAGGGCA FZD5-F TTCTGGATAGGCCTGTGGTC FZD5-R AGGTAGCAGGCTGACAGGAA FZD6-F ATGGCCTACAACATGACGTTT FZD6-R GTTTACGACAAGGTGGAACCA FZD7-F CCAACGGCCTGATGTACTTT FZD7-R GAGAACGGTAAAGAGCGTCG FZD8-F ATCGGCTACAACTACACCTACA

FZD8-R FZD9-F FZD9-R FZD1-F FZD1-R SP1-F SP1-R Primers for cloning vectors FZD1-2-Luc-F FZD1-2-Luc-R FZD1-1515-Luc-F FZD1-984-Luc -F FZD1-4-Luc -F FZD1-25-Luc -F FZD1-173-Luc -F FZD1-78-Luc -F FZD1-2-SP1-Mut-Luc-F GTACATGCTGCACAGGAAGAA TGCCCCTCTCTGGCTACCTG GGGCACCGTGTAGAGGATGG GGCGGTGAAGACCATCCTG CAGCTTGTCCGTGTTCTCG ACCAAGCTGAGCTCCATGAT CCTCAGTGCATTGGGTACTTC Sequence ATGGTACCGTTTCTACCTTCTTTTTCACTTTCT ATCAAGCTTGACCAGCCGGCAGCTGTT ATGGTACCCAAACGGGCAGGGGGCAA ATGGTACC GGGCGCTGGCCGGGCACAT ATGGTACC GACCACCCCCAAACCCCT ATGGTACC GCGCGCCAGGCGGGCTGT ATGGTACC TGCAGGCCGGGGGGGATC ATGGTACC AGCAGCGGCGGGGCGGG AGGGCGAGGAGAAGTGAGTGAGATTGCCGG GGAGGG FZD1-2-SP1-Mut-Luc-R CCCTCCCCGGCAATCTCACTCACTTCTCCTCG CCCT pgl3--f pgl3--r pmir-report-- 576-Mut-F pmir-report-- 576-Mut-R pmir-report-- 1128-Mut-F ATGGTACCCCATTGTCATCCTGGCCCGT ATCAAGCTTCGGAACGCCCCAACCCA AAGCTAAAAGGAACGCCTCTGTAGAATAGCA AC GTTGCTATTCTACAGAGGCGTTCCTTTTAGCTT TGGTGGTCTTGTACGCCTCAATTTCTGTTACA AT

pmir-report-- 1128-Mut-R pmir-report-- WT-F pmir-report-- WT-R ATTGTAACAGAAATTGAGGCGTACAAGACCA CCA AATGAGCTCTGCCTCTTAGGTCCGATGAC TCCAAGCTTATTTGGCAACTATGAAGTAGTGA TC

Supplementary methods Preparation of single-cell suspension of primary breast cancer tissue Before digestion with collagenase, primary human tumors with or without lymph node metastases were cut up into small pieces and then minced completely by using sterile blades. To obtain single cell suspensions, the resulting tumor pieces were then mixed with ultra-pure collagenase III in medium 199 (2 25 units of collagenase per ml) and allowed to incubate at 37 C for 3 4 h. Pipetting with a 1-ml pipette was done every 15 2 min. At the end of the incubation, cells were filtered through a 45- μl nylon mesh and washed with RPMI/2% FBS, then washed twice with HBSS. Cells were counted and then transferred to a 5-ml tube, washed twice with HBSS with 2% heat-inactivated calf serum (HICS; 5 min at 1, rpm), then resuspended in 1 μl (per 1 6 cells) of HBSS with 2% HICS. Antibodies (appropriate dilution per antibody) were then added and incubated for 2 min on ice, and then washed twice with HBSS/2% HICS. When needed, a secondary antibody addition was conducted by resuspending in 1 μl (per 1 6 cells) of HBSS/2% HICS, and then adding 1 4 μl of secondary antibody (depending on the secondary antibody and its concentration), followed by a 2-min incubation. The antibodies used were anti-cd44 [allophycocyanin (APC), phycoerythrin (PE), or biotin], anti-cd24 (PE or FITC), anti-b38.1 (APC), anti-epithelial-specific antigen (ESA) FITC (Biomeda, Foster City, CA), and anti-h2kd, (PharMingen). Lineage marker antibodies were anti-cd2, -CD3 -CD1, -CD16, -CD18, -CD31, -CD64, and - CD1b. Unless noted, antibodies were purchased from PharMingen. Antibodies were directly conjugated to various fluorochromes, depending on the experiment. Cell

sorting was performed on single-cell suspensions using an Epics Altra flow cytometer (Beckman Coulter). Plasmid construction and establishment of stable cell lines FZD1, SP1 and Myc-tagged were cloned into pcdna3 vector. was also cloned into retrovirus vector pbabe-puro to generate pbabe-. A DNA fragment between -2 to +5 relative to FZD1 transcription start site and a series of sequential deletions of the 5 -flanking region of FZD1 promoter were cloned into pgl3-bsic luciferase reporter vector to generate pgl- FZD1 (FZD1-2-Luc), FZD1-1515-Luc, FZD1-984-Luc, FZD1-4-Luc, FZD1-25-Luc, FZD1-173-Luc and FZD1-78-Luc recombinant constructs. To construct the promoter recombinant plasmid, a 215bp DNA fragment between -1959 to +56 relative to TSS was cloned into pgl3-basic plasmid to generate pgl3- plasmid. FZD1-2-SP1-Mut-Luc Mutant was obtained using the QuikChange site-directed mutagenesis kit (Stratagene), The primers used to generate the recombinant plasmids were listed in Supplementary Table 7. The Oligonucleotides encoding shrna targeting or GFP were synthesized and cloned into psuper-retro-puro plasmid (OligoEngine, Inc, USA). Retrovirus vectors were generated as described(1) by co-transfecting psuper-retro-

Puro carrying the shrna expression cassette or pbabe- with helper plasmid pik into 293T cells for 48 hrs. The viral supernatants were collected, filtered, mixed with fresh complete medium (1:1) and 4 µg/ml of polybrene (Sigma, St Louis, Missouri, USA), and then added to breast cancer cells. The stably infected cells were selected with 1µg/mL of puromycin (Sigma, St Louis, Missouri, USA) for two weeks. To generate T47D and MDA-MB-231 cell lines stably expressing pgl3-fzd1, T47D and MDA-MB-231 cell were co-transfected with pgl3-fzd1 and ppru (Clontech, USA) for 24 hrs and the pgl3-fzd1 positive cells were selected with 1 µg/ml of puromycin for two weeks. qrt-pcr Quantitative real-time reverse transcription PCR (qrt-pcr) was performed with a LightCycler 48 instrument (Roche Diagnostics, Switzerland), using the SYBR Premix Ex Taq TM (TaKaRa, Japan) according to the manufacturer s instruction. All reactions were done in a 25ul reaction volume in triplicate. Primers for, FRAT1, VANGL2, BMP8A, CAMK2B, SP1, Vimentin, Fibonectin, GAPDH and 19 Wnt ligands as well as 1 FZD family members were obtained from Invitrogen. Following an initial denaturation at 95 o C for 3 seconds, cycles of PCR amplification were performed at 95 o C for 5 seconds and 6 o C for 2 seconds. Standard curves were generated and the relative amount of target gene mrna was

normalized to GAPDH. The specificity was verified by melting curve analysis and agarose gel electrophoresis. To quantify cancer metastasis in mouse livers, qrt-pcr for human hypoxanthine-guanine-phosphoribosyltransferase (hhprt) was performed on Trizol (Invitrogen, Carlsbad, California) -isolated total RNAs using described primers for hhprt and 18S rrna. Following reverse transcription for 45 mins at 42 o C and Taq activation for 3 mins at 95 o C, cycles of PCR at 95 o C for 12 seconds and 6 o C for 15 seconds was performed. All the primers are illustrated in Supplementary Table 7. Dual-luciferase reporter assay The activity of Wnt signal transduction pathways was measured by dual-luciferase reporter assay using Cignal TCF/LEF Reporter (luc) Kit (CCS-18L, QIAGEN) according to the manufacturer s instructions. For FZD1 promoter activity analysis, a series of FZD1 luciferase reporters were co-transfected with prl-tk (Promega, USA) coding for Renilla luciferase into MDA-MB-231 cells for 24 hrs and the luciferase activity was measured using the Dual Luciferase Assay kit (Promega, USA) according to the manufacturer s protocol. For -mediated FZD1 transcriptional repression, T47D or MDA-MB-231 cells stably expressing pgl3-fzd1 were transfected with sirnas or -expressing vector for 48 hrs and the luciferase activity was measured. For

promoter activity analysis, pgl3- was transfected into MCF-1A, T47D, BT474, MCF-7, MDA-MB-436 and MDA-MB-231 cells for 24 hrs and the luciferase activity was measured. The prl-tk plasmid was used as a transfection control for all luciferase reporter assays. The firefly luciferase values were normalized to Renilla, and the ratio of firefly/renilla values is presented. The experiments were performed independently in triplicate. For pmir-reporter luciferase assays, 3 UTR target sequences containing potential target sites for micrornas were cloned into the pmir- REPORTER luciferase open reading frame following the manufacture s instruction to construct the pmir--3 UTR-WT vectors. The pmir--3 UTR- MUT vectors containing mutated target sequences were used as negative control. After transfection of 293T cells with pmir--3 UTR-WT/MUT vectors as well as microrna mimics, the luciferase activity was measured. sirna sequences sirnas sequences are as follows: -sirna1: 5 -GAAGACUGGACAACAAUUATT-3, 5 -UAAUUGUUGUCCAGUCUUCTT-3 ; -sirna2: 5 -GUGCUGUAAUUACAACAAUTT-3, 5 - AUUGUUGUAAUUACAGCACTT-3.

FZD1-siRNA1: 5 -GCUACAACAUGACUCGUAUTT-3 5 -AUACGAGUCAUGUUGUAGCTT-3 FZD1-siRNA2: 5 -CGCCUCAACAUGGAUUACUTT-3 5 -AGUAAUCCAUGUUGAGGCGTT-3 SP1-siRNA1: 5 -CCAACAGAUUAUCACAAAUTT-3 5 -AUUUGUGAUAAUCUGUUGGTT-3 SP1-siRNA2: 5 -CCUGGAGUGAUGCCUAAUATT-3 5 - UAUUAGGCAUCACUCCAGGTT-3 Supplementary reference 1. Lee SK, Dykxhoorn DM, Kumar P, Ranjbar S, Song E, Maliszewski LE, et al. Lentiviral delivery of short hairpin RNAs protects CD4 T cells from multiple clades and primary isolates of HIV. Blood. 25;16:818-26.