Supplementry Informtion A new lss of plnt lipid is essentil for protetion ginst phosphorus depletion Yozo Okzki 1, Hitomi Otsuki 1, Tomoko Nrisw 1, Mkoto Koyshi 1, Storu Swi 2, Yukiko Kmide 1, Miyko Kusno 1, Toshio Aoki 3, Msmi Yokot Hiri 1,4, nd Kzuki Sito 1,2, 1 RIKEN Plnt Siene Center, Yokohm, Jpn. 2 Grdute Shool of Phrmeutil Sienes, Chi University, Chi, Jpn. 3 Deprtment of Applied Biologil Sienes, Nihon University, Fujisw, Jpn. 4 Jpn Siene nd Tehnology Ageny, Core Reserh for Evolutionl Siene nd Tehnology, Kwguhi, Jpn. Present ddress: RIKEN Plnt Siene Center, Yokohm, Jpn. Corresponding Author. RIKEN Plnt Siene Center, 1-7-22 Suehiro-ho, Tsurumi-ku, Yokohm, Kngw 23-45, Jpn. Tel.: +34 45 53 9488; Fx.: +81 45 53 9489; E- mil: ksito@ps.riken.jp. This SI inludes: Supplementry Figure S1 to S19 Supplementry Tle S1 Supplementry Referenes
2 3 SD Pred.Comp. 1 1-1 2 SD 2 SD P-suffiient P-depleted -2 3 SD 1 2 3 4 5 6 7 8 Num Supplementry Fig. S1. OPLS-DA of lipidome dt of A. thlin grown under P-ontrolled onditions. The sore stter plot of OPLS-DA (R2Y =.99, Q2 =.984, R2X =.693). The onfidene intervls orrespond to the 2 or 3 sigm limits, i.e., 2 or 3 vetor stndrd devitions re displyed. Eh ross represents individul plnt. S2
Reltive Intensity (%) Reltive Intensity (%) 1 5 1 74 76 77 78 79 8 81 5 765.517, 34:3 UK1 ([M H] ) 249.64 55.298, [M H+H 2 O 18:3 FA] 5.231, [16: FA H] 527.31, 277.216, [18:3 FA H] 767.531, 34:2 UK1 ([M H] ) 787.51, 36:6 UK1 ([M H] ) 487.286, [M H 18:3 FA] 789.515, 36:5 UK1 ([M H] ) 791.532, 36:4 UK1 ([M H] ) [M H+H 2 O 16: FA] 2 3 4 5 6 7 Re eltive Intensity (%) d 1 5 784.557, 34:3 UK1 ([M+NH 4 ] + ) 86.535, 36:6 UK1 786.573, ([M+NH 4 ] + ) 34:2 UK1 ([M+NH 4 ] + ) 88.553, 36:5 UK1 ([M+NH 4 ] + ) 77 78 79 8 81 82 Reltive Intensity (%) 1 5 313.2, [16: FA+glyerol+H] + 573.489, [34:3 DAG+H H 2 O] + 335.7, 591.489, [18:3 FA+glyerol+H] + [34:3 DAG+H] + 2 3 4 5 6 7 Supplementry Fig. S2. Mss spetrometry nlysis of UK1 (GlADG) from A. thlin. () Mss spetrum of UK1 speies oserved in the leves of wild-type plnts reorded in the negtive ion mode. The speies lels, totl yl rons nd totl yl doule onds re delimited with olons. The regions where the [M H] ions of the induile lipid speies re found, re shown long with the mss-to-hrge rtio of eh [M H] moleule. () MS/MS of the mjor UK1 moleule ( 765.517, [M H] ). FA, ftty id. The sterisk indites the frgment reorded from ll UK1 speies, whih is ttriutle to gluuronosylglyerol. () Mss spetrum of UK1 reorded in the positive ion mode. The regions where the [M+NH 4 ] + ions of the UK1 speies re found re shown long with the mssto-hrge rtio of eh [M+NH 4 ] + moleules. The signls nd re ttriutle to the [M+N] + nd [M+K] + ions of UK1 moleules, respetively. (d) MS/MS of 784.557 ([M+NH 4 ] + ) oserved from the leves of wild-type plnts. DAG, diylglyerol. S3
34:3 GlADG (18:3/16:) 34:3 SQDG (18:3/16:) Reltive Intensity (%) 1 5 249.64 487.286, [M H 18:3 FA] 55.298, [M H+H 2 O 18:3 FA] 527.31, 277.216, [18:3 FA H] [M H+H 2 O 16: FA] 2 3 4 5 6 7 Reltive Intensity (%) 1 5 5.223, [16: FA H] 277.224, [18:3 FA H] 537.267, 559.2, [M H 18:3 FA] [M H 16: FA] 2 3 4 5 6 7 34:2 GlADG (18:2/16:) 34:2 SQDG (18:2/16:) Reltive Intensity (%) 1 5 249.65 487.286, [M H 18:2 FA] 55.298, [M H+H 2 O 18:2 FA] 5.233, [16: FA H] 529.299, [M H+H 2 O 16: FA] 279.231, [18:2 FA H] 2 3 4 5 6 7 Reltive Intensity (%) 1 5 537.268, 561.26, [M H 18:2 FA] [M H 16: FA] 2 3 4 5 6 7 36:6 GlADG (18:3/18:3) 36:6 SQDG (18:3/18:3) Reltive Intensity (%) Reltive Intensity (%) 1 5 249.58 277.215, [18:3 FA H] 59.273, [M H 18:3 FA] 527.281, [M H+H 2 O 18:3 FA] 2 3 4 5 6 7 1 5 279.232, [18:2 FA H] 277.219, [18:3 FA H] 249.65 511.294, [M H 18:3 FA] 527.283, [M H+H 2 O 18:2 FA] 529.31, [M H+H 2 O 18:3 FA] 59.273, [M H 18:2 FA] 2 3 4 5 6 7 Reltive Intensity (%) 1 5 277.28, [18:3 FA H] 36:5 GlADG (18:2/18:3) 36:5 SQDG (18:2/18:3) 36:4 GlADG (18:2/18:2, 18:1/18:3) Reltive Intensity (%) 1 5 279.232, [18:2 FA H] 529.298, [M H+H 2 O 18:2 FA] 281.246, [18:1 FA H] 531.311, 513.3, 249.65 [M H 18:3 FA] [M H+H 2 O 18:3 FA] 511.286, [M H 18:3 FA] 2 3 4 5 6 7 Reltive Intensity (%) 559.1, [M H 18:3 FA] 2 3 4 5 6 7 1 5 559.4, [M H 18:2 FA] 561.264, [M H 18:3 FA] 2 3 4 5 6 7 36:4 SQDG (18:2/18:2, 18:1/18:3) Reltive Intensity (%) 1 5 559.2, [M H 18:1 FA] 561.266, [M H 18:2 FA] 563.277, [M H 18:3 FA] 2 3 4 5 6 7 Supplementry Fig. S3. Ftty id ompositions of UK1 (GlADG) nd SQDG speies in A. thlin. MS/MS of the [M H] of UK1 nd SQDG in P-strved Aridopsis re displyed. The ftty id omposition of eh UK1 (GlADG) speies ws determined sed on the ions derived from ftty id (FA), while tht of SQDG ws sed on the neutrl loss of FA. The vlues of preursors ttriutle to the [M H] re 765.5 (UK1_34:3), 767.5 (UK1_34:2), 787.5 (UK1_36:6), 789.5 (UK1_36:5), 791.5 (UK1_36:4), 815.5 (SQDG_34:3), 817.5 (SQDG_34:2), 837.5 (SQDG_36:6), 839.5 (SQDG_36:5) nd 841.5 (SQDG_36:4). S4
Reltive Intensity (%) 1 5 5.533, 33:1 GlADG 769.55, 34:1 GlADG 783.565, 35:1 GlADG 795.564,36:2 GlADG 76 77 78 79 8 81 89.577, 37:2 GlADG Reltive Intensity (%) 1 5 487.291, 249.62 [M H 18:1 FA] 55.296, [M H+H 2 O 18:1 FA] 5.234, 513.31, [M H 16: FA] [16: FA H] 531.316, [M H+H 2 O 16: FA] 281.248, [18:1 FA H] 2 3 4 5 6 7 Rel tive Intensity (%) d 1 5 788.59, 34:1 GlADG 82.66, 814.63, 36:2 GlADG 35:1 GlADG 828.618,37:2 GlADG 774.574, 33:1 GlADG,,, 78 79 8 81 82 83, Reltive Intensity (%) 1 5 313.271, [16: FA+glyerol+H] + 577.521, [34:1 DAG+H H 2 O] + 595.51, 339.287, [34:1 DAG+H] + [18:1 FA+glyerol+H] + 2 3 4 5 6 7 Supplementry Fig. S4. Mss spetrometry nlysis of GlADG in B. diminut. () Mss spetrum of GlADG purified from B. diminut reorded in the negtive ion mode. The regions where the [M H] of GlADG re found re shown long with the mss-to-hrge rtio of eh [M H] moleule. () MS/MS of 769.55 ([M H] ) showing the dignosti signl of gluuronosylglyerol moiety t 249.62. () Mss spetrum of GlADG reorded in the positive ion mode. The regions where the [M+NH 4 ] + of GlADG speies re found re shown long with the mss-to-hrge rtio of eh [M+NH 4 ] + moleule. The signls nd re ttriutle to the [M+N] + nd [M+K] + of GlADG. (d) MS/MS of 788.59 ([M+NH 4 ] + ). S5
Aritrry Unit (AU) Retention index (RI) Gluuroni id (RI t 1917.4) Hydrolyste of GlADG (RI t 1917.4) AU Glturoni id (RI t 1923.8) RI Supplementry Fig. S5. Confirmtion of sugr moiety of GlADG purified from B. diminut y GC-MS () Sum of the intensities of speifi ions t 16, 333 nd 423 in the hydrophili frtion fter hydrolysis (lue line) nd in the two stndrds, gluuroni id (green line) nd glturoni id (pink line). Hydrolyste of GlADG y hydrohlori id ws derivtized nd then nlyzed y using GC-TOF-MS 61. () Expnsion of the intensities of speifi ions t 16, 333 nd 423 for eh nlyte from RI t 191 to 195. There re two peks derived from glturoni id nd gluuroni id fter derivtiztion, respetively. The pek in the hydrophili frtion nd the mjor pek of the gluuroni id derivtives hve sme RI t 1917.4, while the mjor pek of the glturoni id derivtives shows different RI (RI t 1923.8). S6
Supplementry Fig. S6. Mss frgments of hydrolyste of GlADG from B. diminut. () EI-MS of the hydrolyste of GlADG, retention index (RI) t 1917.4. () EI-MS of gluuroni id, RI t 1917.4. S7
Wild type, Col- ession Wild type, Ws- ession GlADG 765.5 (34:3) 767.5 (34:2) 787.5 (36:6) 789.5 (36:5) ugp3-1 Reltive Intensity sqd1 sqd2-1 sqd2-2 sqd2-3 n.d. n.d. n.d. 1 11 12 13 14 Retention time (min) Supplementry Fig. S7. LC-MS nlyses of GlADG in SQDG-defiient mutnts of A. thlin. Extrted ion hromtogrms of the [M H] demonstrted the reltive levels of the moleulr speies of GlADG indued y P limittion in SQDG-defiient mutnts nd their wild-type kground. All SQDG-defiient mutnts hve Col- kground, exept sqd2-3 whose kground is Ws-. The speies lels, totl yl rons : totl yl doule onds re shown in prentheses. The intensity of the pek representing the [M H] t 765.5 in the wild-type ws set s 1%. The seline ws shifted for onveniene in the pnel. The signls oserved round t R 1.4 min in the 3 sqd2 mutnts re ttriutle to the [M H] of 36:6 nd 36:5 PG whose levels re higher in these mutnts thn in the wild-type. n.d. denotes not deteted. S8
8 6 4 2 SQDG WT ugp3-1 ugp3-2 sqd1 sqd2-1 sqd2-2 8 6 4 2 8 6 4 2 MGDG DGDG 8 6 4 2 5 4 3 2 1 8 6 4 2 PI PE PG 3 2 1 PC 32: 32:1 34: 34:1 34:2 34:3 34:4 34:5 34:6 36: 36:1 36:2 36:3 36:4 36:5 36:6 Lipid moleulr speies (totl yl rons: totl doule onds) Supplementry Fig. S8. Profiles of polr glyerolipids in the SQDG-defiient mutnts grown under P suffiieny. The levels of individul lipid moleules in the leves of wild-type nd mutnt lines of A. thlin re expressed s reltive intensity (Rel. Int.) ginst the sum of lipid moleules with the sme polr hedgroup in the wild-type grown under P-suffiient onditions. For exmple, the r height of 34:6 MGDG in ugp3-1 is equivlent to the pek re of 34:6 MGDG of ugp3-1/the totl re of ll the MGDG speies in the wild-type under the P-suffiient ondition 1. Eh dt point represents the men vlue of 4 experiments ± SD. Different letters indite sttistilly signifint differenes (P <.5, Tukey s test). Letters re not displyed in the sene of sttistilly signifint differenes ross ll tested genotypes for metolite. S9
8 6 4 2 3 2 1 8 6 4 2 1 5 GlADG SQDG MGDG DGDG WT ugp3-1 ugp3-2 sqd1 sqd2-1 sqd2-2 8 6 4 2 2 15 1 5 5 4 3 2 1 3 2 1 PI PE PG PC 32: 32:1 34: 34:1 34:2 34:3 34:4 34:5 34:6 36: 36:1 36:2 36:3 36:4 36:5 36:6 Lipid moleulr speies (totl yl rons: totl doule onds) Supplementry Fig. S9. Profiles of polr glyerolipids in the SQDG-defiient mutnts grown under P defiieny. The levels of individul lipid moleules in the leves of wild-type nd mutnt lines of A. thlin re expressed s reltive intensity (Rel. Int.) ginst the sum of the lipid moleules with the sme polr hedgroup in the wild-type grown under P-repleted onditions, exept for GlADG for whih the P-depleted ondition for GlADG ws used. For exmple, the height of the r representing 34:6 MGDG in ugp3-1 is equivlent to the pek re of 34:6 MGDG in P-strved ugp3-1/the totl re of ll the MGDG speies in the wild-type under P-suffiient onditions 1. Eh dt point represents the men vlue of 4 experiments ± SD. Brs with the sme letter do not differ signifintly (P <.5, Tukey s test). Letters re not displyed when there re no signifint differenes mong ll the tested genotypes for metolite. S1
Rel. Int. (%) 4 3 2 1 WT ugp3-1 ugp3-2 sqd1 sqd2-1 sqd2-2 Rel. Int. (%) 2 15 1 5 StGl Rel. Int. (%) 4 3 2 1 GlCer (+/ P) + GlCer + StGl (+/ P) + Sitosteryl gluoside + + Cmpesteryl gluoside Stigmsteryl gluoside + + + + + + + + + + + (+/ P) d18:1/h16: d18:1/h16: t18:1/h16: t18:1/h16: t18:1/h22: t18:1/h22: t18:1/h24:1 t18:1/h24:1 t18:1/h24: t18:1/h24: t18:1/h26: Supplementry Fig. S1. Profiles of GlCer nd StGl in the SQDG-defiient mutnts grown under P-ontrolled onditions. () GlCer nd StGl ws nlyzed y HILIC-MS s previously reported 26. The levels of individul lipid lsses in leves of the wild-type nd mutnt lines re expressed s reltive res ginst the sum of lipid lss with the sme polr hedgroups in the wild-type grown under P-suffiient onditions. () Profile of StGl speies is expressed s reltive vlues ginst the totl StGl level in wild-type plnts grown under P-suffiient ondition. () Profile of GlCer speies is expressed s reltive vlues ginst the totl GlCer level in wild-type plnts grown under P-suffiient ondition. Eh dt point represents the men vlue of 4 experiments ± SD. S11
Wild type sqd1 ugp3-1 sqd2-1 sqd2-2 Wild type sqd1 ugp3-1 sqd2-1 sqd2-2 Supplementry Fig. S11. Growth of SQDG-defiient mutnts under P-ontrolled onditions. Wild-type (Col- ession) nd series of SQDG-defiient mutnts of A. thlin grown under P-suffiient onditions were trnsferred to either P-suffiient () or P-depleted medium (). After 4-weeks-inution, the growth of eh genotype ws ompred (N = 2). Br, 2 m. S12
Totl hlorophyll ontents (µg mg 1 DW) 1 8 6 4 2 WT ugp3-1 sqd1 sqd2-1 sqd2-2 +P P Supplementry Fig. S12. Chlorophyll ontents of SQDG-defiient mutnts grown under P-ontrolled onditions. Wild-type (Col- ession) nd series of SQDG-defiient mutnts of A. thlin grown under P-suffiient onditions were trnsferred to either P-suffiient or P-depleted medium. After 1-month-inution, the levels of totl hlorophylls (hlorophylls nd ) of eh genotype ws olorimetrilly determined (N = 6). S13
Pi ontent in shoot (µmol g 1 FW) 1 8 6 4 2 WT ugp3-1 sqd1 sqd2-1 sqd2-2 +P P Supplementry Fig. S13. Pi levels in the SQDG-defiient mutnts grown under P-ontrolled onditions. Wild-type (Col- ession) nd series of SQDG-defiient mutnts of A. thlin grown under P-suffiient onditions for 2 weeks were trnsferred to either P-suffiient (+P) or P-depleted ( P) medium. After 2-weeks-inution, the Pi levels in the shoots were ssyed. Eh dt point represents the men vlue of 4 experiments ± SD. S14
Reltive Intensity (%) Reltive Intensity (%) 1 5 1 74 76 77 78 79 8 81 5 249.58 765.512, 34:3 GlADG ([M H] ) 5.234, [16: FA H] 277.216, [18:3 FA H] 767.527, 34:2 GlADG ([M H] ) 487.286, [M H 18:3 FA] 55.288, [M H+H 2 O 18:3 FA] 2 3 4 5 6 7 Supplementry Fig. S14. GlADG in rie leves. () Mss spetrum of GlADG found in rie leves reorded in the negtive ion mode. The region where the [M H] of GlADG re found re shown long with the mss-to-hrge rtio of eh [M H] moleule. () MS/MS of the [M H] of the mjor GlADG speies ( 765.512) found in rie leves. The sterisk indites the frgment typilly oserved from GlADG. S15
1 5 1 8 6 4 2 1 8 6 4 2 GlADG SQDG MGDG +P P 4 2 6 4 2 DGDG PI 4 2 4 2 4 2 PE PG PC 32: 32:1 34: 34:1 34:2 34:3 34:4 34:5 34:6 36: 36:1 36:2 36:3 36:4 36:5 36:6 Lipid moleulr speies (totl yl rons: totl doule onds) Supplementry Fig. S15. Profiles of polr glyerolipids in rie grown under P-ontrolled onditions. The levels of individul lipid moleules in rie leves re expressed s reltive intensity (Rel. Int.) ginst the sum of the lipid moleules with the sme polr hedgroup in the plnts grown under P-repleted onditions. Eh dt point represents the men vlue of 3 experiments ± SD. Asterisks indite sttistilly signifint differene from the P-suffiient growth ondition (P <.5, Welh s t-test). S16
sqd2-2 sqd2-1 UTR CDS 5' 3'.5 k SQD2 UBQ9 Supplementry Fig. S16. Genotypes of of Aridopsis sqd2 mutnts used in this study. () Shemti representtion of SQD2 of Aridopsis showing T-DNA insertion sites. Coding sequenes (CDSs) nd untrnslted regions (UTRs) re shown s lk nd rown oxes, respetively. T-DNA insertions re loted within intron 8 (SALK_95; llele sqd2-1) nd exon 1 (SALK_139798; llele sqd2-2). Arrows indite mrna regions mplified y RT-PCR for the primer pirs designted for T-DNA insertions (see Supplementry Tle S1). () RT-PCR nlysis of trnsripts from the wild-type (WT, Col- ession) nd the 2 homozygote T-DNA insertion lines. Uiquitin-onjugting enzyme 9 (UBQ9)-speifi primers were used s ontrols. All the primers for genotyping the mutnt lleles of SQD2 re listed in Supplementry Tle S1. S17
3.7 3.6 2. 1. 2.6534 2.323 2.315 2.376 2.178 2.52 1.9921 1.7745 3.7848 3.766 3.7368 3.7179 3.6995 3.6841 3.6726 3.6623 3.6566 3.659 3.5839 3.59 3.565 3.557 1.656 1.4315 1.28 1.1377 1.55.8829.35.5789.579.1827.171..1363.122 1 t 5 MHz in CDCl 3. d y drop of D 2 O. 4.4 4.3 4.2 4.1 4. 3.9 3.8 5. 4. 3. 5.3578 5.3463 5.3394 5.3354 4.946 4.417 4.415 4.3935 4.1736 4.1542 3.981 3.8347 3.7848 3.7179 3.4167 3.2861 2.678 4.46 4.417 4.415 4.39 4.3935 4.1736 4.1633 4.1542 4.1393 4.1278 3.981 3.9143 3.951 3.89 3.8833 3.869 3.8347 3.826 3.7937 Supplementry Fig. S17. 1 H NMR spetrum of the methyl ester of GlADG of B. diminut The exhngele protons of the hydroxy groups in the gluuroni id moiety were diminished S18
8. 7. 6. 5. 4. 3. 2. 1. 77.27 77.22 76.7644 73.6263 71.5184 7.5645 61.8847 52.8519 29.7787 29.745 29.7119 29.6737 29.2922 29.1396 27.2224 15.7669 14.1263 1.9118. Supplementry Fig. S18. 13 C NMR spetrum of the methyl ester of GlADG of B. diminut t 1 MHz in CDCl 3. 17. 16. 15. 14. 13. 12. 11. 1. 9. 173.537 173.1969 17.4689 129.951 129.8261 99.746 S19
Olefini protons in y groups H-2 H-1' H-1 H-5' H-1 CH 3 O- H-3 H-3' H-3 H-4' H-2' 11. 1. 9. 8. 7. 6. 5. H-1'/ C-3 H-1'/ C-5' H-5'/ C-1' H-3/ C-1' H-3/ C-1' C-1 C-3 -OCH 3 C- 2', -4' C-3' Solvent C-1' C-2 C-5' 1' 3 1 2 18. 17. 16. 15. 14. 13. 12. H-2/ C = 4' 6' 5' 2' 3' H-1/ C = H-1/ C = CH 3 O-/ 6'-C= Olefini rons in y groups 6'-C=O C =O C =O 5.3 5.2 5.1 5. 4.9 4.8 4.7 4.6 4.5 4.4 4.3 4.2 4.1 4. 3.9 3.8 3.7 3.6 3.5 3.4 Supplementry Fig. S19. Key HMBCs of the methyl ester of GlADG of B. diminut. HMBC spetrum ws reorded in solute CDCl 3. In this ondition, H-2' is highly split y oupling with hydroxy group of the gluuroni id moiety. This oupling n e neled y the ddition of drop of D 2 O s oserved in Supplementry Fig. S5. Arrows from protons to rons indite key HMBCs showing the onnetivity of gluuroni id, glyerol, nd ftty ids. R 1 nd R 2 re long hin lkyls. S2
Supplementry Tle S1. Primers used in the urrent study Primer nme Sequene (5 3 ) Genotyping of T-DNA insertion lines 1. SALK_95_Fw TAAACAACTTCTCAAGATCCTC 2. SALK_95_Rv TATAGCAGCTGGTGCAACTG 3. SALK_139798_up CATAAACCATTATAACAACAACG 4. LB1 TGGTTCACGTAGTGGGCCATCG 5. RB1 TTGGATTGAGAGTGAATATGAGACTCT 6. R1+315 CCCAATAGCAGCCAGTCC RT-PCR SALK_95_Fw TAAACAACTTCTCAAGATCCTC SALK_95_Rv TATAGCAGCTGGTGCAACTG SALK_139798_Fw GAGGTATCTAATGAAATTCTGG SALK_139798_Rv GGTTGTTAAAAATCCGATTATAACG UBQ9-RT_Fw CCATGGGCTGACACAAATACT UBQ9-RT_Rv CCAAAATAATATGAGCCTTGATAAAC Primers used to mplify the UBQ9 trnsript were synthesized s previously desried 62. S21
Supplementry Referenes 61. Kusno, M. et l. Unised hrteriztion of genotype-dependent metoli regultions y metolomi pproh in Aridopsis thlin. BMC Sys. Biol. 1, 53 (27). 62. Pereir, L.G., Coimr, S., Oliveir, H., Monteiro, L. & Sottomyor, M. Expression of rinogltn protein genes in pollen tues of Aridopsis thlin. Plnt 223, 374-38 (26). S22