Cos7 (3TP) (K): TGFβ1(h): (K)
|
|
- Baldric Owen
- 6 years ago
- Views:
Transcription
1 IP#2: IP#1: Totl Lystes luiferse tivity (K): (K): luiferse tivity luiferse tivity (K): 2 1 RL-: Sm4-3F: MYC-Sm3: TβRI-HA(T204D): α-ha Luiferse Ativity 4 - TGFβ1: (K) Cos7 (3TP) si TGFβ1(h): (K): 45 Luiferse Ativity (K) NIH3T3 (3TP) α- α-atin si α- Figure S1 ins to Sm heteromeri omplexes to regulte TGFβepenent signlling. () interts with Sm3-Sm4 heteromeri omplexes. Lystes from HEK293T ells expressing RL-tgge, Sm4-3F, MYC-Sm3 n onstitutively tive TβRI-HA[T204D] were immunopreipitte with nti-flag ntioy n Sm4 oun protein omplexes were then elute uner ntive onitions with 3xFLAG peptie. Sm3-Sm4 omplexes were susequently purifie y seon IP using n nti-myc ntioy. Totl protein expression ws onfirme y IB with the inite ntioies. Luiferse tivity in the IP n in n liquot of the totl ell lystes ws mesure to etermine the mount of oun to the omplex. Results re shown s men ± s.. (n=3). () is require for TGFβ-meite trnsription in COS7 n NIH3T3 ells. Reltive luiferse tivity from the 3TP-lux reporter ws mesure in COS7 or NIH3T3 ells tht were trnsfete with or si n trete with or without TGFβ1. Results re shown s men ± s.. (n=3). () protein levels re stilize in response to TGFβ. HepG2 ells were trete with TGFβ for the inite time n totl ell extrts were exmine y immunoloting for protein levels. 1
2 TGFβ1: Frtion: (K): si C N C N C N C N α-sm2 α-sm4 α- α-eea1 α-ar105 COS7 NIH3T3 No tretment + TGFβ1 No tretment si + TGFβ1 No tretment + BMP2 α-sm4 DAPI α-sm4 DAPI si Vrels et l. FIG. S2 Figure S2 is require for the TGFβ-inue nuler umultion of Sms. () Nuleo-ytoplsmi frtiontion nlysis following knokown. Nuler n ytoplsmi extrts were prepre from HepG2 ells trnsfete with or si n trete with or without TGFβ1. The reltive levels of ytoplsmi [C] n nuler [N] proteins were nlyze y immunolotting. EEA1 ws use s ytoplsmi loing ontrol, n Ar105 ws use s nuler loing ontrol. () TGFβ-epenent nuler umultion of Sm2 is reue following knokown in COS7 n NIH3T3 ells. COS7 or NIH3T3 ells were trnsfete with or si n the loliztion of Sm2 ws etermine y immunofluoresene nlysis following tretment with or without TGFβ1. The sle r represents 10 µm. () is not require for BMP-epenent Sm nuler umultion. HepG2 ells were trnsfete with or si n the loliztion of Sm4 ws etermine y immunofluoresene nlysis following tretment with or without BMP2. The sle r represents 10 µm. 2
3 si TGFβ1: α-phospho-sm2 (K): α-phospho-sm3 α-sm2/3 α-/yap 3F-: TGFβ1(min): (K): α-phospho-sm2 α-sm2 α-flg 3F-Sm2: Sm4-HA: : TβRI(T204D): (K): IP: Totl Lystes α-ha α- α-ha IP: Totl Lystes (K): 30 luiferse tivity luiferse tivity RL-: TBR1(T204D): 3F-Sm2 mutnts: MH1 linker MH CTL MH1 MH2 MH1 MH2 linker MH1 MH2 MH1 MH2 linker Figure S3 oes not regulte Sm phosphoryltion or heteromeri omplex formtion. () Sm2/3 phosphoryltion is not ffete following knokown. Lystes from HepG2 ells trete with TGFβ1 for the inite mount of time were immunolotte for the phosphoryltion of enogenous Sm2 n Sm3 using the ntioies shown. () Phospho-Sm2 levels re not ffete y expression. COS7 ells were trnsfete with either empty ontrol plsmi or plsmi expressing 3F- n were then trete with TGFβ1 for the inite mount of time. Lystes from these ells were immunolotte [IB] with nti-phospho- Sm2 ntioy, nti-sm2 ntioy n nti-flag M2 ntioy s inite. () Sm2-Sm4 omplex formtion is not ffete y expression. Lystes from HEK293T ells expressing 3F-Sm2, Sm4-HA n together with onstitutively tive TβRI[T204D] were sujete to immunopreipittion with nti-flag M2 ntioy n then immunolotte with nti-ha ntioy to etet Sm4 oun to Sm2. () The MH1 omin of Sm2 ins. Lystes from HEK293T ells expressing RLtgge together with 3F-tgge Sm2 or Sm2 mutnts were sjete to IP using n nti-flag ntioy n ssoite ws etermine y mesuring the reltive luiferse tivity. Results re shown s men ± s.. (n=3). A shemti representtion of the Sm2 mutnts use is shown. 3
4 Cell line: (K): HepG2 Cos7 293T Mv1LU α- HepG2 DAPI 3F-Sm2 DAPI Cos7 no tretment HEK293T +TGFβ1 Mv1LU Expression Vetor nuler loliztion nuler Sm2 loliztion e - 6 3TP GFP (Control) Wil-type [S89A] [106 ] [ WW] [ 393] [ ] n/ 1% 27% % 0% 1% 0% 85% 22% % 66% % 31% 33% Luiferse Ativity vetor: CTL S89A 106 WW Figure S4 Anlysis of n Sm nuler umultion. () levels in ifferent ell lines. 10 µg of totl ell extrts from the inite ell lines ws exmine for protein levels y immunolotting. () loliztion in ifferent ell lines. The inite ell lines were exmine for the enogenous loliztion of y immunofluoresene. () Sm2 expression oes not ffet loliztion. HepG2 ells trnsiently expressing 3F-Sm2 were trete with or without TGFβ1 n the loliztion of enogenous ws exmine. The sle r represents 10 µm. () Quntittion of Sm loliztion in the presene of mutnt expression. The perentge of ells tht isply preomintely nuler lolize n the TGFβ-epenent nuler umultion of enogenous Sm2 ws quntitte. The perentge shown is the verge of three experiments ± s.. with minimum of 50 ells ounte for eh. (e) Reltive luiferse tivity from the 3TP-lux reporter ws mesure from HepG2 ells expressing high levels of the inite mutnts from the CMV promoter. The empty vetor ws trnsfete s ontrol [CTL]. Results re shown s men ± s.. (n=3). 4
5 TGFβ1: - + L - + L - + (K): IgH α-arc105 IgG Totls α-/yap α-arc TGFβ1: 3F- mutnts: Luiferse Ativity CTL 3TP CC 222 ARC105 Overlp oeffiient (R) = / ARC105 Trnsfetion (+TGFβ1) + ARC105 e Trnsfetion (+TGFβ1) + ARC105 Me6 TriMeth (K4)H3 Sm2/3 IF IF Me6 TriMeth (K4)H3 Sm2/3 Ar105 Ar105 Ar105 f (K): siarc105 α-arc105 α-atin siarc105 g ARC105 DAPI Sm2 DAPI siarc105 Figure S5 Assoition of n Ar105. () n Ar105 intert enogenously. Lystes from Mv1Lu ells trete with or without TGFβ1 were sujete to immunopreipittion n susequent immunolotting with the inite ntioies. As ontrol the ntioies were inute in lysis uffer [L] lone. The hevy hin of the ntioies is inite [IgH]. () mutnts tht in ARC105, ut not Sms, ffet Sm signlling. Reltive luiferse tivity from the 3TP-lux reporter ws mesure from HepG2 ells expressing high levels of, [ CC] or [ 222] from the CMV promoter. The empty vetor ws trnsfete s ontrol [CTL]. Results re shown s men ± s.. (n=3). () Cololiztion of enogenous n ARC105. HepG2 ells were o-stine for n ARC105 s inite n imge y spinning isk onfol mirosopy. A representtive nuleus is shown with re n green stining reveling the sunuler istriution of n ARC105, respetively. The overlp oeffiient (R) ws etermine to quntitte the ololiztion etween n ARC105 (see mteril n methos). Results re shown s the men ± s.. from ell nulei otine from 15 rnomly otine fiels from two ifferent experiments. A higher mgnifition imge from eh onition is shown. The sle r represents 5 µm. () Expresse n ARC105 ololize with trnsriptionl mhinery. COS7 ells were Vrels et l. FIG. S5 trnsfete with 3F-tgge n 3HA-ARC105 n the loliztion of, ARC105 n enogenous Me6 or trimethylte-k4 histone H3 ws etermine y IF following TGFβ tretment. A higher mgnifition imge from eh onition is shown with rrows initing sunuler toroil strutures tht isply o-loliztion. The sle r represents 10 µm. (e) Sunuler ololiztion of, ARC105 n Sm2 in HepG2 ells. HepG2 ells were trnsfete with 3F-tgge n 3HA-ARC105 n the loliztion of, ARC105 n enogenous Sm2 ws etermine y IF following TGFβ tretment. A higher mgnifition imge from eh onition is shown with rrows pointing to sunuler toroil strutures tht isply o-loliztion. The sle r represents 10 µm. (f) siarc105 potently knoks own enogenous ARC105. HepG2 ells were trnsfete with either ontrol or ARC105 sirna ( or siarc105, respetively) n ells either lyse for western lot nlysis of ARC105 levels or tin (left pnels) or trete for nlysis y IF (right pnels). (g) Anlysis of Sm2 n loliztion following ARC105 knokown. HepG2 ells were trnsfete s inite, trete with TGFβ1, n the loliztion of enogenous Sm2 (green) n (re) ws nlyze y IF. The ells were ounterstine with DAPI to visulize the nuleus. The sle r represents 10 µm. 5
6 Figure 1 α-sm2/3 IgG TGFβ1: + - L + - L α-/yap IgH Totls α-sm4 IgG TGFβ1: L - + L (K): 130 Figure 1 α-/yap relot Sm4 α-sm4 Sm4 α-sm4 (light exposure) Sm2 α-sm2/3 Sm4 130 α-sm4 (rk exposure) Figure 4 Figure 7 IgH Totls Vrels et l. FIG. S6 Figure S6 Full-size immunolots of key enogenous intertions shown in the regulr figures. (,) Immunolots from Figure 1. () Immunolots from Figure 3. () Immunolots from Figure
7 Supplementry Tle 1. Primers use in this stuy Gene Forwr Primer Reverse Primer For qpcr: Gph AATCCCATCACCATCTTCCA TGGACTCCACGACGTACTCA Hprt AAACAATGCAGACTTTGCTTTCC GGTCCTTTTCACCAGCAAGCT Tz GTATCCCAGCCAAATCTCGTGATG CAGCGCATTGGGCATACTCATG I2 CCTCAACACGGATATCAGCATCCT ACACCGCTTATTCAGCCACACA Sm7 CCCCATCACCTTAGCCGACTCTGC CCCAGGGGCCAGATAATTCGTTCC PAI-1 ATTCAAGCAGCTATGGGATTCAA CTGGACGAAGATCGCGTCTG For ChIP-qPCR: Sm7 TAGAAACCCGATCTGTTGTTTGCG CCTCTGCTCGGCTGGTTCCACTGC PAI-1 GCAGGACATCCGGGAGAGA CCAATAGCCTTGGCCTGAGA
SUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
More informationsupplementary information
DOI:.38/n83 k Mouse Ch8 lous 8 9 Stop CHD8L 75 CHD8L Chromoomins Helise/ATPse omin DNA ining omin 5 kd NIH 3T3 MEF 93T HeL HCT UOS SOS.. CHD8L IB: CHD8 8 5 L S Reltive mrna mount 3... Reltive mrna mount.8.
More informationSUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
More informationSupplementary Figure S1_Cottini
Supplementry Figure S1_Cottini γ-h2a.x Krp OCIMy5 KMS11 Krps62 RPMI8226 INA6-1 µm Cleve C3 γ-h2a.x DAPI Merge OCIMy5 H929 JJN3 UTMC2 KMS11 KMS12PE KMS18 KMS2 RPMI8226 INA6 U266 KMS34 Krps62 1 2 3 4 5 6
More informationSUPPLEMENTARY INFORMATION
doi:.8/nture98 : hr NEMO :5 hr IKK IKK NF-κB p65 p5 p65/-rel NF-κB p65 p5 p65/-rel Cytoplsm Cytoplsm p65/p5 Nuleus Nuleus NEMO IKK IKK d : hr > : hr p65/-rel NF- p65 p5 Cytoplsm Cytoplsm p65/p5 p65/-rel
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationTitle of Experiment: Author, Institute and address:
Title of Experiment: Trsfetion of murine mrophge RAW264.7 ells with METAFECTENE PRO. Author, Institute n ress: Ptrizi Pellegtti n Frneso Di Virgilio. Deprtment of Experimentl n Dignosti Meiine, Setion
More informationSUPPLEMENTARY INFORMATION
DOI:./n BJ RAS:ER Herrnz et l Supplementry Figure HFFF RAS:ER.. mrna Expression..... ILα ILβ IL IL CCL INH VEGF mrna Expression..... ILα ILβ IL IL CCL INH VEGF + OHT Torin NVP-BEZ + OHT shmtor. shmtor.
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
More informationSupplementary Figure S1
Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk
More informationTargeting BIG3 PHB2 interaction to overcome tamoxifen resistance in breast cancer cells
Reeive Fe 13 Aepte 15 Aug 13 Pulishe Sep 13 DOI: 1.13/nomms33 OPEN Trgeting intertion to overome tmoxifen resistne in rest ner ells Tetsuro Yoshimru 1, Msto Komtsu 1, Tisuke Mtsuo 1, Yi-An Chen, Yoihi
More informationAlimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
More informationSUPPLEMENTARY INFORMATION
oi:1.138/nture1134 CS+ CS- MCH 3 OCT OCT 3 MCH CS- CS+ OCT MCH 3 MCH OCT 3 OCT vs MCH OCT vs MCH ppetitive memory (PI) A 1-1 Unpire onitioning DDC-GAL4/UAS-Trp UAS-Trp/+ -2 MCH OCT OCT MCH sugr OCT MCH
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n2977 Numer of ells per field 6 4 2 P =.1 Orthotopi eum Normlized ventrl photon flux 1E7 1E6 1E5 1E4 1E3 1E2 n=8 n=9 1 2 3 4 5 6 Dys Dy54 1.5E5 2.4E7 d Mie with lymph node metstsis (%) 1 8 6
More informationSupplementary Information
Supplementry Informtion Non-nonil prevents skeletl ging n inflmmtion y inhiiting NF-κB Bo Yu, Ji Chng, Yunsong Liu, Jiong Li, Kreen Kevork, Khli Al Hezimi, Dn T. Grves, No-Hee Prk, Cun-Yu Wng Supplementry
More informationa3 Chains of type V collagen regulate breast tumour growth via glypican-1
Reeive 5 Aug 16 Aepte De 16 Pulishe 19 Jn 17 3 Chins of type V ollgen regulte rest tumour growth vi glypin-1 Guorui Hung 1, Goxing Ge 1,w, Vlerio Izzi & Dniel S. Greenspn 1 DOI: 1.138/nomms1351 OPEN Periellulr
More informationSUPPLEMENTARY INFORMATION
DOI:.3/n95 Thymus Kiney (kd) TA T7 T TA T7 T Hert TA T7 T: +Dox Cylin B (kd) Thymus Kiney Hert TA T5 T TA T5 T TA T5 T: +Dox Cylin B Poneu S Poneu S CnB T7 CnB T Thymus (kd) + Liver Colon + + (kd) Thymus
More informationRoquin binds inducible costimulator mrna and effectors of mrna decay to induce micrornaindependent post-transcriptional repression
ins inuile ostimultor mrna n effetors of mrna ey to inue mirornainepenent post-trnsriptionl repression Elke Glsmher 1, Ki P Hoefig 1,3, Kthrin U Vogel 1,3, Niol Rth 1, Lirui Du 1, Christine Wolf 1, Eliseth
More informationSUPPLEMENTARY INFORMATION
oi:1.138/nture1138 Supplementl Figure 1 Inflmmtory Monoytes Host ells CCR2 CCL2 Disseminting Tumor Cells Metstsis Assoite Mrophges VEGF Extrvstion & Metstti Seeing Supplementl Figure 1 The t from this
More informationLHb VTA. VTA-projecting RMTg-projecting overlay. Supplemental Figure 2. Retrograde labeling of LHb neurons. a. VTA-projecting LHb
SUPPLEMENTARY INFORMATION Supplementl Figure 1 doi:10.1038/nture09742 Lterl 1.0 mm from midline mpfc BNST mpfc BNST Lterl 2.1 mm from midline LHA LHA Lterl 2.7 mm from midline SUPPLEMENTAL INFORMATION
More informationSUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
More informationChow KD CR HFD. Fed Fast Refed
Supplementry Figure 1 Control d/d Chow KD CR Fed Fst Refed Supplementry Figure 1: Liver expression in diet nd disese models. () expression in the livers of ontrol nd d/d mie. () expression in the livers
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationCoatomer LPAAT-γ Merge
DI: 1.138/n2273 Cotomr LPAAT-γ Mrg Tuuls (%) 1 5 < 5 nm 5~1nm 1~2nm 2~5nm >5nm 5~1nm < 5 nm 1~2nm 2~5nm >5nm 2 min 5 min 1 min 3 min < 5 nm 5~1nm 1~2nm 2~5nm >5nm < 5 nm 5~1nm 1~2nm 2~5nm >5nm Figur S1
More informationSUPPLEMENTARY INFORMATION
2 weeks high holesterol diet 2 weeks high holesterol diet 2 weeks high holesterol diet 2 μm Mrophges Crystls Hoehst μm Mrophges Crystls Hoehst Hoehst Crystls Mrophges 2 μm 2 μm Supplementry Fig. 1: Erly
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION CD169 + MACROPHAGES PRESENT LIPID ANTIGENS TO MEDIATE EARLY ACTIVATION OF INVARIANT NKT CELLS IN LYMPH NODES Ptrii Brrl, Polo Polzell, Andres Brukuer, Nio vn Rooijen, Gurdyl S.
More informationSUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
More informationSupplemental Figures and Legends
Supplementl Figures n Legens Epigeneti trgeting of Hegehog trnsriptionl output through BET romoomin inhiition Yujie Tng 1,2, Shrreh Gholmin 2, Simone Shuert 1,2, Mine I. Willrson 3, Alex Lee 4, Prtiti
More informationPellino3 targets the IRF7 pathway and facilitates autoregulation of TLR3- and viral-induced expression of type I interferons
Pellino3 trgets the pthwy n filittes utoregultion of TLR3- n virl-inue expression of type I interferons Jku Sienienko 1,, Ruihri Jkson 1,, Mrk Mellett 1,, Nezir Delgi 1, Shuo Yng 1, Bingwei Wng 1, Lis
More informationThe GCN5-CITED2-PKA signalling module controls hepatic glucose metabolism through a camp-induced substrate switch
Reeived 6 Apr 216 Aepted 8 Sep 216 Pulished 22 Nov 216 DOI: 1.138/nomms13147 OPEN The GCN5-CITED2-PKA signlling module ontrols hepti gluose metolism through AMP-indued sustrte swith Mshito Ski 1, Tomoko
More informationYAP transcriptionally regulates COX-2 expression and GCCSysm-4 (G-4), a dual YAP/COX-2 inhibitor, overcomes drug resistance in colorectal cancer
Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 DOI.86/s346-7-6-3 RESEARCH Open Aess trnsriptionlly regultes expression nd GCCSysm-4 (G-4), dul / inhiitor, overomes drug resistne in oloretl
More informationN6-methyladenosine (m6a) is the most prevalent messenger
https://oi.org/8/s556-8-7- m 6 A mrna methyltion regultes tivity to promote the prolifertion n tumorigeniity of enometril ner Jun Liu,,, Mrk A. Ekert,, Bryn T. Hr,,, Song-Mei Liu,, Zhike Lu,, Kngkng Yu,,5,
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationThe Hippo/YAP pathway interacts with EGFR signaling and HPV oncoproteins to regulate cervical cancer progression
Reserh Artile The Hippo/ pthwy interts with EGFR signling nd HPV onoproteins to regulte ervil ner progression Chuno He 1,, Dgn Mo 1,3, Guohu Hu 1,, Xingmin Lv 1, Xingheng Chen, Peter C Angeletti 5, Jixin
More informationTbp. Per Relative mrna levels Circadian Time. Liver weight/ body weight (%) n.s. Pernull
Liver weight/ ody weight (%) Dy Body weight (g) Reltive mrna levels Reltive mrna levels Reltive mrna levels Reltive mrna levels Dy Per1 Per2 Per3 Tp 8 2 8 2. 6 2 8 12162 Cirdin Time 3 2 1 2 1 1 8 12162
More informationFolding of Toll-like receptors by the HSP90 paralogue gp96 requires a substrate-specific cochaperone
Reeive 15 Fe 21 Aepte 1 Aug 21 Pulishe 21 Sep 21 DOI: 1.138/nomms17 Foling of Toll-like reeptors y the HSP9 prlogue requires sustrte-speifi ohperone Bei Liu 1,, Yi Yng 2,, Zhijun Qiu 2, Mtthew Stron 2,
More information... Identi cation of a host protein essential for assembly of immature HIV-1 capsids
... Ienti tion of host protein essentil for ssemly of immture HIV-1 psis Conepion Zimmermn*, Kevin C. Klein², Ptti K. Kiser², Alok R. Singh*, Bonnie L. Firestein³, Shnnyn C. Ri² & Jisri R. Lingpp² * Deprtment
More informationInhibition of Dexamethasone-induced Fatty Liver Development by Reducing mir-17-5p Levels
originl rtile Inhiition of Dexmethsone-inue Ftty Liver Development y Reuing -5p Levels Willim W Du,, Fengqiong Liu 3, Sze Wn Shn,, Xini Ciny M,, Shn Gupt,, Tinru Jin 4, Dvi Spner, Sergey N Krylov 5, You
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationnestin ironetin p75 s1 CNS SKPs Dermo-1 +ve SKPs CNS H2O SCGs Skin Di. SKPs TH SHOX2 GAPDH NCAM D H Figure S1, Immunoytohemil nlysis o SKP spheres ulture rom neontl mouse (nestin, ironetin, S-1) or rt
More informationAbortion frequency (%) Ovary position on ear Ovary volume (mm 3 )
ortion frequeny (%) 5 1 Ovry position on er 3 1 WW WD pex Bse Ovry volume (mm 3 ) Figure S1. Ovry volume (thik lines) n ortion frequeny (thin lines) s funtion of position long the er, 15 ys fter silk emergene
More informationA liver HIF-2α/IRS2 pathway sensitizes hepatic insulin signaling and is modulated by VEGF inhibition
A liver HIF-2α/IRS2 pthwy sensitizes hepti insulin signling n is moulte y VEGF inhiition Kevin Wei1,1, Stephnie M. Pieewiz1,1, Lis M. MGinnis1,1, Cullen M. Tniguhi2, Stnley J. Wiegn3, Keith Anerson3, Crol
More informationEffects of Enzyme Inducers in Therapeutic Efficacy of Rosiglitazone: An Antidiabetic Drug in Albino Rats
Asin J. Exp. Si., Vol. 21, No. 2, 2007, 00-00 Effets of Enzyme Inuers in Therpeuti Effiy of Rosiglitzone: An Antiieti Drug in Alino Rts Ann Chursi,#* P.K. Krr** A. S. Mnn* & M.D. Khry* * Deprtment of Phrmeutil
More information(% of adherent cells) *** PBL firm adhesion. Frequency (% ) 4 1 L 2 CXCR3 DP-2
Chemotxis (% of dded ells) PBL totl dhesion (N ells/mm 2 /1.1 6 PBL) Frequeny (% ) PBL firm dhesion Supplementry Figure 1 4 4 3 3 2 2 1.1-4 1-3 1.1.2. 1 1 8 6 4 2 Adiponetin ( g/ml) - + Adiponetin ( g/ml)
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationmch log height Counts GFP log height mch log height Counts GFP log height mch log height Counts high flux % Hist: 8.34 EBSS shctrl Counts
DOI:.8/n2886 mchrry-gfp-lc3 Autophgy Rportr: Autophgosom Autolysosom mchrry GFP LC3 mchrry GFP LC3 X ph >6. ph
More informationDOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
More informationNeuroligin-1 dependent competition regulates cortical synaptogenesis and synapse number
Neuroligin- epenent ompetition regultes ortil synptogenesis n synpse numer Hyung-Be Kwon,3, Yevgeni Kozorovitskiy, Won-Jong Oh 2, Rui T Peixoto, Nzi Akhtr, Jessi L Sulnier, Chenghu Gu 2 & Bernro L Stini
More information% of Nestin-EGFP (+) cells
8 7 6 3 Nestin CD % of Nestin-EGFP (+) ells 8 6 Nestin-EGFP Marge Nestin-EGFP Marge Expression levels of Expression levels of Tumorigeniity y stemness markers ifferentiation markers limiting ilution assay
More informationLesions of prefrontal cortex reduce attentional modulation of neuronal responses. and synchrony in V4
Lesions of prefrontl ortex reue ttentionl moultion of neuronl responses n synhrony in V4 Georgi G. Gregoriou,, Anrew F. Rossi, 3 Leslie G Ungerleier, 4 Roert Desimone 5 Deprtment of Bsi Sienes, Fulty of
More informationSupplementary Figure S1
Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus
More informationINTRODUCTION. Ji-Hye Lee 1, Seon-Mi Yu 1, Eun-Kyung Yoon, Won-Kil Lee, Jae-Chang Jung*, Song-Ja Kim
J Koren Me Si 27; 22: 89-7 ISSN -8934 Copyright The Koren emy of Meil Sienes 2,4 5-Deoxy- -ProstglninJ2 Regultes Deifferentition through Peroxisome Prolifertor-tivte Reeptor- -Depenent Pthwy ut Not Expression
More informationTranscription factor Ets-1 links glucotoxicity to pancreatic beta cell dysfunction through inhibiting PDX-1 expression in rodent models
Dietologi () 9: DOI.7/s ARTICLE Trnsription ftor Ets links gluotoxiity to pnreti et ell ysfuntion through inhiiting PDX expression in roent moels Fng Chen & Min Sh & Ynyng Wng & Tijun Wu & Wei Shn & Ji
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
More informationMolecular Analysis of BRCA1 in Human Breast Cancer. Cells Under Oxidative Stress
Moleculr Anlysis of BRCA1 in Humn Brest Cncer Cells Under Oxidtive Stress Brin L. Gilmore 1, Ynping Ling 1, Crly E. Winton 1,2, Ky Ptel 1, Vsile Krgeorge 1, A. Cmeron Vrno 1,3, Willim Dernley 1, Zhi Sheng
More informationSupplementary Figure 1. Scheme of unilateral pyramidotomy used for detecting compensatory sprouting of intact CST axons.
() BDA 2 weeks fter Py () AAVs Cre or GFP t P1 BDA 2 weeks fter Py CSMN CST () Py t P7 or 2 months () Py t 2 months Supplementry Figure 1. Sheme of unilterl pyrmidotomy used for deteting ompenstory sprouting
More informationRegulation of NKT cell-mediated immune responses to tumours and liver inflammation by mitochondrial PGAM5-Drp1 signalling
Reeive Mr Aepte Aug Publishe 8 Sep DOI:.8/nomms97 Regultion of NKT ell-meite immune responses to tumours n liver inflmmtion by mitohonril PGAM-Drp signlling Young Jun Kng, Bo-Rm Bng, Kyung Ho Hn, Lixin
More informationEFFECT OF SOYBEAN CYST NEMATODE ON GROWTH OF DRY BEAN. Research Report to Northarvest Bean Growers, January 19, 2009
EFFECT OF SOYBEAN CYST NEMATODE ON GROWTH OF DRY BEAN Reserh Report to Northrvest Ben Growers, Jnury 19, 29 Berlin D. Nelson, Susilo Poromrto, n Ruell Goswmi, Dept. Plnt Pthology, NDSU Ojetive: Determine
More informationAMPK maintains energy homeostasis and survival in cancer cells via. regulating p38/pgc-1α-mediated mitochondrial biogenesis
SUPPLEMENTARY INFORMATION AMPK mintins energy homeostsis nd survivl in cncer cells vi regulting p38/pgc-1α-medited mitochondril iogenesis Blkrishn Chue 1, Prmnnd Mlvi 1, Shivendr Vikrm Singh 1, Noshd Mohmmd
More informationRole of the EGF receptor in PPARγ-mediated sodium and water transport in human proximal tubule cells
Dietologi (213) 56:1174 1182 DOI 1.17/s125-13-2835-y ARTICLE Role of the EGF reeptor in PPARγ-meite soium n wter trnsport in humn proximl tuule ells S. S & J. Zhng & R. Yong & D. Yghoin & M. G. Wong &
More informationFates-shifted is an F box protein that targets Bicoid for degradation and regulates developmental fate determination in Drosophila embryos
ARTICLES Ftes-shifted is n F ox protein tht trgets Bioid for degrdtion nd regultes developmentl fte determintion in Drosophil emryos Juno Liu 1 nd Jun M 1,2,3 Bioid (Bd) is morphogeneti protein tht instruts
More informationSUPPLEMENTARY INFORMATION
DOI:.38/nc393 Nnog DAPI Nnog/DAPI c-jun DAPI c-jun/dapi c e Reltive expression to Gpdh mescs ( Feeder free) mescs ( Feeder) MEFs.5 MEFs ipscs ESCs..5 p=.24 p=.483 p=.22. JunB JunD Fos Fr Fr2 ATF2 ATF3
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationWesternBright Quantum
WesternBright Quntum Quntify hemiluminesent Western lots over wie ynmi rnge WesternBright Quntum is new hemiluminesent regent speilly formulte for CCD imging. This novel Horserish peroxise (HRP) sustrte
More informationOsteoblasts secrete Cxcl9 to regulate angiogenesis in bone
Reeived 2 De 215 Aepted 9 Nov 216 Pulished 14 De 216 DOI: 1.138/nomms13885 OPEN Osteolsts serete to regulte ngiogenesis in one Bin Hung 1,, Wenho Wng 1,, Qinghu Li 1,, Zhenyu Wng 1,BoYn 1, Zhongmin Zhng
More informationSUPPLEMENTARY INFORMATION
SUPPEMENTARY INFORMATION DOI: 1.138/ncb956 Norml CIS Invsive crcinom 4 months months b Bldder #1 Bldder # Bldder #3 6 months (Invsive crcinom) Supplementry Figure 1 Mouse model of bldder cncer. () Schemtic
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationFAK integrates growth-factor and integrin signals to promote cell migration
integrtes growth-ftor nd integrin signls to promote ell migrtion rtiles Dvid J. Sieg*, Christof R. Huk*, Dusko Ili, Cndie K. Klingeil*, Erik Shefer, Croline H. Dmsky nd Dvid D. Shlepfer* *Deprtment of
More informationInterplay of LRRK2 with chaperone-mediated autophagy
Interply of with hperone-medited utophgy Smnth J Orenstein,, Sheng-Hn Kuo,, Inmuld Tsset,,, Espernz Aris,, Hiroshi Kog,, Irene Fernndez-Crs, Etty Cortes,5, Lwrene S Honig,5, Willim Duer 6, Antonell Consiglio,7,
More informationMutations associated with neutropenia in dogs and humans disrupt intracellular transport of neutrophil elastase
Muttions ssoited with neutropeni in dogs nd humns disrupt intrellulr trnsport of neutrophil elstse Kthleen F Benson 1, Feng-Qin Li 1, Rihrd E Person 2, Dlil Alni 1,5, Zhijun Dun 1, Jeremy Wehsler 1,5,
More informationInhibition of mtor induces autophagy and reduces toxicity of polyglutamine expansions in fly and mouse models of Huntington disease
Inhiition of mtor indues utophgy nd redues toxiity of polyglutmine expnsions in fly nd mouse models of Huntington disese Brind Rvikumr 1,6, Corlie Vher 1,6, Zdenek Berger 1,2, Jnet E Dvies 1, Shouqing
More informationBDNF release from single cells elicits local dendritic growth in nearby neurons
BDNF relese from single ells eliits lol enriti growth in nery neurons Hley Wilson Horh 1,2 n Lwrene C. Ktz 1 1 Howr Hughes Meil Institute, Deprtment of Neuroiology, Duke University Meil Center, Box 3209,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationInhibitory effect of p38 mitogen-activated protein kinase inhibitors on cytokine release from human macrophages
British Journl of Phrmology (26) 149, 393 44 & 26 Nture Pulishing Group All rights reserved 7 1188/6 $3. www.rjphrmol.org RESEARCH PAPER Inhiitory effet of p38 mitogen-tivted protein kinse inhiitors on
More informationA mouse Mecp2-null mutation causes neurological symptoms that mimic Rett syndrome. 1kb. pa 1 pa 2 wildtype allele 11kb. S/pA. loxp.
1 Nture Pulishing Group http://genetis.nture.om A mouse Mep2-null muttion uses neurologil symptoms tht mimi Rett synrome Jky Guy 1, rin Henrih 1, Megn Holmes 2, Jonne E. Mrtin 3 & Arin ir 1 1 Nture Pulishing
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture078 RNse VifHA VifHA βctin 6 Cell lyste IP: ntiha MG VifHA VifHA β ctin 6 7 Cell lyste IP: ntiha Supplementry Figure. Effect of RNse nd MG tretment on the Vif interction., RNse tretment does
More informationResearch Article TNF-α and IFN-s-Dependent Muscle Decay Is Linked to NF-κB- and STAT-1α-Stimulated Atrogin1 and MuRF1 Genes in C2C12 Myotubes
Hindwi Pulishing Corportion Meditors of Inflmmtion Volume 213, Artile ID 171437, 18 pges http://dx.doi.org/1.1155/213/171437 Reserh Artile nd IFN-s-Dependent Musle Dey Is Linked to NF-κB- nd STAT-1α-Stimulted
More informationARTICLE. Keywords AMPK. Cholesterol. Insulin resistance. Intestine. Isoflavones. Liver. LXRα. LXRβ. Mice. Soy protein
Dietologi () 55:469 478 DOI.7/s5--599-9 ARTICLE Soy protein isoflvones ifferentilly regulte liver X reeptor isoforms to moulte lipi metolism n holesterol trnsport in the liver n intestine in mie M. González-Grnillo
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nture1188 1mM CCl 2 (min) 3 4 6 CCl 2 (mm) for 4min.1. 1 (mm) Pro- d WT GdCl 3 R-68 -/- P2x7r -/- -/- Csp1 -/- WT -/- P2x7r -/- -/- Csp1 -/- Csp1 (p2) (p17) Pro-Csp1
More informationVol 457 26 Ferury 29 oi:1.138/nture7617 Deficiency of -rrestin-2 signl complex contriutes to insulin resistnce Bing Lun 1, Jin Zho 1, Hiy Wu 3, Boyu Dun 1, Gungwen Shu 1, Xioying Wng 4, Dngsheng Li 2,
More informationPlzf regulates limb and axial skeletal patterning
rtile Plzf regultes lim n xil skeletl ptterning Mri Brn 1, Niol Hwe 1, Lee Niswner 2 & Pier Polo Pnolfi 1 The promyeloyti leukemi zin finger (Plzf) protein (enoe y the gene Zfp145) elongs to the POZ/zin-finger
More informationER-α36 mediates cisplatin resistance in breast cancer cells through EGFR/HER-2/ ERK signaling pathway
Zhu et l. Journl of Experimentl & Clinil Cner Reserh (218) 37:123 https://oi.org/1.1186/s134618798z RESEARCH Open Aess ERα36 meites ispltin resistne in rest ner ells through /HER2/ signling pthwy Linlin
More informationFarnesoid X receptor inhibits glucagon-like peptide-1 production by enteroendocrine L cells
Reeive 27 Mr 215 Aepte 25 My 215 Pulishe 2 Jul 215 DOI: 1.138/nomms8629 Frnesoi X reeptor inhiits glugon-like peptie-1 proution y enteroenorine L ells Mohme-Smi Trelsi 1,2,3,4, Mehi Doui 1,2,3,4, Jnne
More informationPlant Physiology Preview. Published on February 21, 2017, as DOI: /pp
Plnt Physiology Preview. Pulished on Ferury 21, 217, s DOI:1.114/pp.16.1928 1 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 Running title: Spliing regultor STA1 in het stress dpttion Corresponding Author:
More informationHyun-Suk Ko, 1 Hyo-Jeong Lee, 1 Hyo-Jung Lee, 1,2 Eun Jung Sohn, 1 Miyong Yun, 1 Min-Ho Lee, 3 and Sung-Hoon Kim 1. 1.
Eviene-Bse Complementry n Alterntive Meiine Volume 13, Artile ID 94737, 1 pges http://x.oi.org/1.1155/13/94737 Reserh Artile Essentil Oil of Pinus koriensis Exerts Antioesi n Hypolipiemi Ativity vi Inhiition
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture17 Men tumour dimeter (mm) 2 Rg2-/- 2 1 2 2 1 Control IgG!-CD8!-CD4 1 2 3 1 2 3 c Men tumour dimeter (mm) 2 2 1 d Ifnr1-/- Rg2-/- 2 2 1 Ifngr1-/- d42m1!ic 1 2 3 Dys post trnsplnt 1 2 3 Supplementry
More informationTankyrase inhibition stabilizes axin and antagonizes Wnt signalling
Vol 461 1 Otoer 29 doi:1.138/nture8356 Tnkyrse inhiition stilizes xin nd ntgonizes Wnt signlling Shih-Min A. Hung 1, Yuji M. Mishin 1, Shnming Liu 1, Atwood Cheung 1, rnk Stegmeier 1, Gregory A. Mihud
More informationregulates stem cells through Wnt/β-catenin signalling
LETTERS O regultes stem ells through Wnt/β-tenin signlling Jolly Mzumdr,,7, W. Timothy O Brien, Rndll S. Johnson, Joseph C. LMnn, Jun C. Chvez 5, Peter S. Klein nd M. Celeste Simon,, Stem ells reside in
More informationSUPPLEMENTARY INFORMATION
doi:.3/nture93 d 5 Rttlesnke DRG (reds) Rttlesnke TG (reds) c 3 TRPV1 other TRPs 1 1 3 Non-pit snke TG (reds) SFig. 1 5 5 3 other TRPs TRPV1 1 1 3 Non-pit snke DRG (reds) 5 Antomy of the pit orgn nd comprison
More informationPTP1B controls non-mitochondrial oxygen consumption by regulating RNF213 to promote tumour survival during hypoxia
A RT I C L E S PTP1B ontrols non-mitohonril oxygen onsumption y regulting to promote tumour survivl uring hypoxi Roert S. Bnh 1,2,3, Cterin Iorio 2,11, Rihr Mrotte 2,11, Yng Xu 1,2,3,11, Dn Cojori 1,2,
More informationb-sitosterol activates Fas signaling in human breast cancer cells
ARTICLE IN PRESS Phytomeiine 14 (2007) 747 754 www.elsevier.e/phyme -Sitosterol tivtes Fs signling in humn rest ner ells A.B. Aw,, M. Chinnm, C.S. Fink, P.G. Brfor Deprtment of Exerise n Nutrition Sienes
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationSupplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2
Supplementry Mterils Virl delivery of mir-96 meliortes the SBMA phenotype vi the silencing of CELF2 Yu Miyzki, Hiroki Adchi, Mshis Ktsuno, Mkoto Minmiym, Yue-Mei Jing, Zhe Hung, Hideki Doi, Shinjiro Mtsumoto,
More informationParathyroid hormone related peptide is a naturally occurring, protein kinase A dependent angiogenesis inhibitor
Prthyroi hormone relte peptie is nturlly ourring, protein kinse A epenent ngiogenesis inhiitor MANJIRI M. BAKRE 1, YUHONG ZHU 1, HONG YIN 1, DOUG W. BURTON 2, ROBERT TERKELTAUB 2, LEONARD J. DEFTOS 2 &
More informationMacrophage mtorc1 disruption reduces inflammation and insulin resistance in obese mice
Dietologi (1) 7:393 DOI 1.17/s-1-33- ARTICLE Mrophge mtorc1 isruption reues inflmmtion n insulin resistne in oese mie Hongfeng Jing & Mrit Westerterp & Chunjiong Wng & Yi Zhu & Ding Ai Reeive: 1 April
More informationInhibitors of topoisomerases I and II arrest DNA replication, but do not prevent nucleosome assembly in vivo
Inhiitors of topoisomerses I n II rrest DNA replition, ut o not prevent nuleosome ssemly in vivo ANTHONY T. ANNUNZIATO Deprtment of Biology, Boston College, Chestnut Hill, MA 02167, USA Summry Speifi inhiitors
More information