SALSA MLPA probemix P225-D2 PTEN Lot D2-0315. As compared to the previous version (lot D1-0613), one probe has a small change in length but no change in the sequence detected. PTEN is a tumour suppressor gene that is mutated in a large number of cancers at high frequency. The protein encoded by PTEN is able to modify other proteins and lipids by removing phosphate groups. The main mechanism by which PTEN functions as a tumour suppressor is negative regulation of the AKT-PKB signalling pathway. Defects in the PTEN gene are the main cause of Cowden syndrome, which is a dominantly inherited cancer predisposition syndrome. Cowden syndrome is characterised by hamartomatous polyps of the gastrointestinal tract, mucocutaneous lesions, and by increased risk of developing neoplasms in the breast, thyroid, kidney, colon and skin. Promoter hypermethylation represents an alternative mechanism of PTEN inactivation. Moreover, KLLN, a gene which shares a bidirectional promoter region with PTEN, has been shown to be epigenetically regulated in renal cell carcinoma (Bennett KL et al., 2011, Genes Chromosomes Cancer. 50:654-61) and in the germline of Cowden syndrome or Cowden-like syndrome patients (Nizialek EA et al., 2015, Eur J Hum Genet. 23:1538-43; Bennett KL et al., 2010, JAMA. 304:2724-31); the latter differential germline methylation region is not covered by the P225-D2 probemix. Also, a potential oncosuppressive role has been demonstrated for PTEN pseudogene PTENP1, which is affected by genomic deletions in various human malignancies (Poliseno L et al., 2010, Nature. 465:1033-8). The PTEN gene comprises nine exons, spanning about 105 kb of genomic DNA and is located on chromosome 10q23.31, ~90 Mb from the p-telomere. This P225-D2 PTEN probemix contains at least two probes for each of these nine exons. The total number of PTEN probes included in this probemix is 21. In addition, it contains 14 probes located elsewhere on chromosome 10 that can help to distinguish focal PTEN deletions in tumour-derived DNA samples from loss of the complete 10q arm or a chromosome 10 aneuploidy. This probemix contains also two probes for copy number detection of the pseudogene PTENP1 (at 9p13.3). Moreover, five MS-MLPA probes are included in this probemix to determine the methylation status of the shared promoter region of the PTEN and KLLN genes that are unmethylated in most bloodderived DNA samples. Upon HhaI digestion, the peak signal obtained in unmethylated samples will be very low or absent for these five probes. In contrast, when tested on methylated human DNA in vitro, these probes do generate a signal. We have no data showing that methylation detected by a particular probe directly influences the corresponding mrna levels. Finally, 14 reference probes are included in this probemix, detecting several different autosomal chromosomal locations, which are relatively stable in human cancers, and are not affected by HhaI digestion. This SALSA probemix is designed to detect deletions/duplications of one or more sequences in the PTEN gene and other chromosome 10 sequences and the PTENP1 pseudogene in a DNA sample. Heterozygous deletions of recognition sequences should give a 35-50% reduced relative peak height of the amplification product of that probe. Note that a mutation or polymorphism in the sequence detected by a probe can also cause a reduction in relative peak height, even when not located exactly on the ligation site! In addition, some probe signals are more sensitive to sample purity and small changes in experimental conditions. Therefore, deletions and duplications detected by MLPA should always be confirmed by other methods. Not all deletions and duplications detected by MLPA will be pathogenic; users should always verify the latest scientific literature when interpreting their findings. We have no information on what percentage of defects in these genes is caused by deletions/duplications of complete exons. Finally, note that most defects in this gene are expected to be small (point) mutations which will not be detected by this SALSA test. This probemix can also be used to detect aberrant methylation of one or more sequences of the PTEN and/or KLLN genes. Methylation levels can be different for different tissues. If possible, use identically treated test and reference samples (same tissue type and extraction method). SALSA probemixes and reagents are sold by for research purposes and to demonstrate the possibilities of the MLPA technique. They are not CE/FDA certified for use in diagnostic procedures. Purchase of the SALSA MLPA test probemixes and reagents includes a limited license to use these products for research purposes. The use of this SALSA probemix and reagents requires a thermocycler with heated lid and sequence type electrophoresis equipment. Different fluorescent PCR primers are available. The MLPA technique has been first described in Nucleic Acids Research 30, e57 (2002). SALSA probemix P225 PTEN Page 1 of 13
More information Website : www.mlpa.com E-mail : info@mlpa.com (information & technical questions); order@mlpa.com (for orders) Mail : bv; Willem Schoutenstraat 1, 1057 DL Amsterdam, the Netherlands Related SALSA probemixes P158 JPS: Contains probes for SMAD4, BMPR1A and PTEN. References Pistorius S et al., 2016. An unusual case of Cowden syndrome associated with ganglioneuromatous polyposis. Hered Cancer Clin Pract. 14:11. Jacot W et al., 2015. High EGFR protein expression and exon 9 PIK3CA mutations are independent prognostic factors in triple negative breast cancers. BMC Cancer. 18;15:986. Nizialek EA et al., 2015. KLLN epigenotype-phenotype associations in Cowden syndrome. Eur J Hum Genet. 23:1538-43. Maiques O et al., 2014. FISH analysis of PTEN in endometrial carcinoma. Comparison with SNP arrays and MLPA. Histopathology. 65:371-88. Li J et al., 2013. The AKT inhibitor AZD5363 is selectively active in PIK3CA mutant gastric cancer, and sensitizes a patient-derived gastric cancer xenograft model with PTEN loss to Taxotere. J Transl Med. 11:241. Nathanson KL et al., 2013. Tumor genetic analyses of patients with metastatic melanoma treated with the BRAF inhibitor dabrafenib (GSK2118436). Clin Cancer Res. 19:4868-78. Sandell S et al., 2013. An intronic polymorphic deletion in the PTEN gene: implications for molecular diagnostic testing. Br J Cancer. 108:438-41. Aradhya S et al., 2012. Exon-level array CGH in a large clinical cohort demonstrates increased sensitivity of diagnostic testing for Mendelian disorders. Genet Med. 14:594-603. Pradella LM et al., 2011. Two distinct thyroid tumours in a patient with Cowden syndrome carrying both a 10q23 and a mitochondrial DNA germline deletion. J Med Genet. 48:779-82. Wooderchak-Donahue W et al., 2011. Verification of multiplex ligation-dependent probe amplification probes in the absence of positive samples. Genet Test Mol Biomarkers. 15:793-9. Guerra F et al., 2011. Placing mitochondrial DNA mutations within the progression model of type I endometrial carcinoma. Hum Mol Genet. 20:2394-405. Berg M et al., 2010. DNA sequence profiles of the colorectal cancer critical gene set KRAS-BRAF-PIK3CA-PTEN-TP53 related to age at disease onset. PLoS One. 5:e13978. Regina S et al., 2009. Increased tissue factor expression is associated with reduced survival in non-small cell lung cancer and with mutations of TP53 and PTEN. Clin Chem. 55:1834-42. Data analysis of MLPA for copy number detection only The P225-D2 PTEN probemix contains 53 MLPA probes with amplification products between 126 and 500 nt. In addition, it contains 9 control fragments generating an amplification product smaller than 120 nt: four DNA Quantity fragments (Q-fragments) at 64-70-76-82 nt, three DNA Denaturation control fragments (Dfragments) at 88-92-96 nt, one X-fragment at 100 nt and one Y-fragment at 105 nt. More information on how to interpret observations on these control fragments can be found in the MLPA protocol. Data generated by this probemix should be normalised with a more robust method, as the target sites of the reference probes maybe gained or lost. (1) Intra-sample normalisation should be performed by dividing the signal of each target-specific probe by the signal of every single reference probe in that sample, thus creating as many ratios per target-specific probe as there are reference probes. Subsequently, the median of all these produced ratios per probe should be taken; this is the probe s Normalisation Constant. (2) Secondly, inter-sample comparison should be performed by dividing the Normalisation Constant of each probe in a given sample by the average Normalisation Constant of that probe in all the reference samples. Data normalisation should be performed within one experiment. Always use sample and reference DNA extracted with the same method and derived from the same source of tissue. Confirmation of deletions, duplications and amplifications can be done by e.g. Southern blotting, long range PCR, qpcr, FISH. Methylation-specific MLPA Please note that each MS-MLPA reaction generates two samples that need analysis by capillary electrophoresis: one undigested sample for copy number detection and one digested sample for methylation detection. SALSA probemix P225 PTEN Page 2 of 13
A modification of the MLPA technique, MS-MLPA allows the detection of both copy number changes and unusual methylation levels of 10-50 different sequences in one simple reaction. MLPA probes for methylation quantification are similar to normal MLPA probes, except that the sequence detected by the MS-MLPA probe contains the sequence recognised by the methylation-sensitive restriction enzyme HhaI. Similar to ordinary MLPA reactions, the MS-MLPA protocol starts with sample DNA denaturation and overnight hybridization. The reaction then is split into two tubes. One tube is processed as a standard MLPA reaction. This reaction provides information on copy number changes. The other tube of the MLPA hybridization reaction is incubated with the methylation-sensitive HhaI endonuclease while simultaneously, the hybridised probes are ligated. Hybrids of (unmethylated) probe oligonucleotides and unmethylated sample DNA are digested by the HhaI enzyme. Digested probes will not be exponentially amplified by PCR and hence will not generate a signal when analysed by capillary electrophoresis. In contrast, if the sample DNA is methylated, the hemimethylated probe-sample DNA hybrids are prevented from being digested by HhaI and the ligated probes will generate a signal. The MS-MLPA technique should always be internally validated before use in your laboratory. Results of MS- MLPA are highly dependent on the HhaI enzyme used. HhaI enzymes that are resistant to heat inactivation are NOT compatible with the MS-MLPA technique and will give aberrant results. These include, but may not be limited to, Thermo Fisher Scientific enzymes HhaI, ANZA 59 HhaI, and FastDigest HhaI. We recommend using Promega s HhaI enzyme (R6441) as this is the only restriction enzyme that has been validated for use with MS-MLPA by. More information about MS-MLPA can be found in the MS-MLPA protocol. Please note that this product can not be used with an alternative protocol in which the genomic DNA is first digested with HhaI, followed by MLPA reactions on both digested and undigested genomic DNA. Digestion control probes The target sequences of the digestion control probes are unmethylated in most blood-derived DNA samples. The signals of the digestion control probes should be absent upon complete digestion by HhaI. Data analysis of MS-MLPA The analysis of MS-MLPA probemixes consists of two parts: 1) determining copy numbers by comparing different undigested samples, and 2) determining methylation patterns by comparing each undigested sample to its digested counterpart (MS-MLPA probemixes only). The second part is unique for MS-MLPA probemixes and serves to semi-quantify the percentage of methylation within a given sample. 1) Copy number analysis - Selection of reference probes First select suitable reference probes for copy number detection. These are probes detecting relatively quiet regions in the particular type of tumour studied. The reference probes selected will therefore depend on the application. Probes that are suitable to use for reference in many types of tumour are indicated in Table 1 and Table 2. - Intra-sample data normalisation For analysis of MLPA results, not the absolute fluorescence values but intra-normalised data are used (relative peak heights). The data generated in the undigested sample should first be normalised intra-sample by dividing the signal of each probe by the signal of every reference probe in that sample, thus creating as many ratios per probe as there are reference probes. Subsequently, the median of all these produced ratios per probe should be taken; this is the probe s Normalisation Constant. This Normalisation Constant can then be used for sample to reference sample comparison. - Inter-sample normalisation (comparison with reference samples) The final probe ratio, or ploidy status, of each probe in each sample is calculated by dividing a) the Normalisation Constant of each probe obtained on the undigested test sample by b) the average Normalisation Constant of that probe obtained on the undigested reference samples. SALSA probemix P225 PTEN Page 3 of 13
2) Methylation analysis - Selection of reference probes Use the reference probes for methylation as marked in Table 1 and Table 2a. All reference probes used for methylation analysis do not contain a HhaI site. - Intra-sample data normalisation For analysis of MLPA results, not the absolute fluorescence values but intra-normalised data are used (relative peak heights). The data generated in the digested sample should first be normalised intra-sample by dividing the signal of each probe by the signal of every reference probe in that sample, thus creating as many ratios per probe as there are reference probes. Subsequently, the median of all these produced ratios per probe should be taken; this is the probe s Normalisation Constant. This Normalisation Constant can then be used for sample to reference sample comparison. - Methylation analysis (comparison with reference samples) The methylation status of each MS-MLPA probe* in each sample is calculated by dividing a) the Normalisation Constant of each probe obtained on the digested test sample by b) the Normalisation Constant of each MS-MLPA probe obtained on the corresponding undigested sample. Multiplying this value by 100 gives an estimation of the percentage of methylation. Aberrant methylation can then be identified by comparing the methylation status of one or more MS-MLPA probes in the sample in question to that obtained on reference samples. *Note: Each MS-MLPA probe targets a single specific HhaI site in a CpG island; if methylation is absent for this particular CpG-site, this does not necessarily mean that the whole CpG island is unmethylated! Data normalisation should be performed within one experiment. Always use sample and reference DNA extracted with the same method and derived from the same source of tissue. Confirmation of most exon deletions and amplifications can be done by e.g. Southern blotting, long range PCR, qpcr, FISH. Note that Coffalyser, the MLPA analysis tool developed at, can be downloaded free of charge from our website www.mlpa.com. Warning: MLPA analysis on tumour samples provides information on the average situation in the cells from which the DNA sample was purified. Gains or losses of genomic regions or genes may not be detected if the percentage of tumour cells is low. Furthermore, there is always a possibility that one or more reference probes do show a copy number alteration in a sample. Many copy number alterations in healthy individuals are described in the database of genomic variants: http://dgv.tcag.ca/dgv/app/home. For example, a duplication of a complete gene might not be pathogenic, while a partial duplication or a deletion may result in disease. For some genes, certain in-frame deletions may result in a very mild, or no disease. Copy number changes of reference probes are unlikely to be the cause of the condition tested for. Users should always verify the latest scientific literature when interpreting their findings. This probemix was developed at. Info/remarks/suggestions for improvement: info@mlpa.com. SALSA probemix P225 PTEN Page 4 of 13
Table 1. SALSA MLPA P225-D2 PTEN probemix Chromosomal position Length SALSA MLPA probe PTEN / KLLN PTENP1 (nt) reference Chr. 10 HhaI site 10q23.31 9p13.3 64-70-76-82 Q-fragments: DNA quantity; only visible with less than 100 ng sample DNA 88-92-96 D-fragments: Low signal of 88 or 96 nt fragment indicates incomplete denaturation 100 X-fragment: Specific for the X chromosome 105 Y-fragment: Specific for the Y chromosome 126 # SLC9A2 probe S0750-L21493 (2q12.1) + 131 Reference probe 00797-L25925 5q31.1-136 Reference probe 16316-L25926 3q21.3-142 «KLLN probe 10345-L25028 exon 1 + 149 GATA3 probe 07632-L22241 10p14-155 Ω * PTEN probe 13690-L15159 exon 6 + 160 PTEN probe 07685-L23140 exon 8-166 Reference probe 14281-L15951 15q13.1-172 «KLLN probe 17388-L08261 exon 1 + 178 PTEN probe 17314-L20922 exon 3-183 «KLLN probe 13686-L15155 exon 1 + 190 PTEN probe 06729-L06339 exon 2-196 Reference probe 11393-L12119 1q41-202 «PTEN probe 18254-L22971 exon 1 + 208 ± PTEN probe 17391-L21278 exon 4-214* PTEN probe 07686-L15591 exon 9-220 FGFR2 probe 08219-L24929 10q26.13-227 «* PTEN probe 17387-L26030 exon 1-232 Reference probe 10267-L26029 6q14.1-238 PCDH15 probe 08751-L26028 10q21.1-245 Reference probe 10384-L26027 9q34.3-252 CELF2 probe 17393-L22030 10p14-259 BMPR1A probe 19351-L28591 10q23.2-267 Reference probe 08938-L22242 11p15.1-274 LGI1 probe 19294-L25714 10q23.33-280 + * PTENP1 probe 17308-L25183 exon 1-285 PTEN probe 17390-L14811 exon 2-292 RET probe 18081-L23071 10q11.21-299 Reference probe 04570-L25184 16q13-305 ANXA7 probe 18380-L25185 10q22.2-312 # ESCO2 probe 17305-L21055 (8p21.1) + 319 PTEN probe 03639-L21321 exon 6-328 PTEN probe 19293-L25664 exon 3-337 * PTEN probe 17396-L25927 exon 9-344 PTEN probe 18694-L24032 exon 3-352 Reference probe 05273-L25208 2p22.3-359 * PTEN probe 17397-L25715 exon 8-364 «KLLN probe 18110-L25928 exon 1 + 373 HTRA1 probe 08602-L25186 10q26.13-379 * PTEN probe 03638-L24933 exon 5-389 Reference probe 13248-L24934 1p21.1-399 Ж * PTENP1 probe 17825-SP0555-L22726 exon 1-409 PTEN probe 13032-L22244 exon 5-418 Reference probe 09793-L25209 15q21.1-427 Reference probe 08839-L22026 2p13.2-436 PTEN probe 13692-L21061 exon 7-445 PTEN probe 17395-L21062 exon 9-454 ITIH5 probe 17392-L21057 10p14-465 «PTEN probe 17394-L21385 exon 1-475 * PTEN probe 17386-L22174 exon 7-486 Reference probe 13594-L22376 19p13.2-494 PTEN probe 17389-L21835 exon 4-500 Reference probe 15203-L20113 3p12.2 - SALSA probemix P225 PTEN Page 5 of 13
Changed in version D2 (from lot D2-0315 onwards). Small change in length or peak height, no change in sequence detected. # Digestion control: warns for insufficient digestion. Upon digestion, this probe should not give a signal. «This probe is located within, or close to, a very strong CpG island. A low signal of this probe can be due to incomplete sample DNA denaturation, e.g. due to the presence of salt in the sample DNA. Flanking probe. Included to distinguish focal PTEN deletions in tumour derived DNA samples from loss of the complete 10q arm or a chromosome 10 aneuploidy. Ω This probe is not located in a CpG island; it has an HhaI site and in our tests it never showed signal reduction upon HhaI digestion on DNA extracted from normal blood DNA; in tumour DNA we have no evidence if this HhaI site is methylated or not. Ж This probe consists of three parts and has two ligation sites. This digestion control probe is digested by HhaI independent of methylation state of sample DNA. The HhaI site is in the probe stuffer that does not hybridise to target DNA. ± SNP rs587780544 could influence the probe signal. In case of apparent deletions, it is recommended to sequence the region targeted by this probe. + SNP rs12000677 could influence the probe signal. In case of apparent deletions, it is recommended to sequence the region targeted by this probe. * For its specificity, this probe depends on a single nucleotide difference between the PTEN gene and the PTEN pseudogene (PTENP1). An apparent duplication of only this probe can be the result of a clinically nonsignificant one nucleotide sequence change at the ligation site in the related gene. Note: Exon numbering might be different as compared to literature! Identity of the reference probes is available in Table 2a. Please notify us of any mistakes: info@mlpa.com. SALSA probemix P225 PTEN Page 6 of 13
Table 2. P225 probes arranged according to chromosomal location Table 2a. Reference probes. Length SALSA MLPA Partial sequence MV location Gene Location (nt) probe (24 nt adjacent to ligation site) (HG18) 389 13248-L24934 COL11A1 1p21.1 GGCCCTGAAGGA-CCCAAAGGTCGA 01-103.225805 196 11393-L12119 USH2A 1q41 TGCTATTAGGCA-TCAGGCTTTTGG 01-214.328975 352 05273-L25208 SPAST 2p22.3 CGAGCCACAGCA-AAAAGAGCCCTC 02-032.215134 427 08839-L22026 DYSF 2p13.2 TGCCATGAAGCT-GGTGAAGCCCTT 02-071.767082 500 15203-L20113 GBE1 3p12.2 GACCTAGAGGGA-CTCATGATCTTT 03-081.774613 136 16316-L25926 RAB7A 3q21.3 CACAATAGGAGC-TGACTTTCTGAC 03-129.999512 131 00797-L25925 IL4 5q31.1 ATCGACACCTAT-TAATGGGTCTCA 05-132.037613 232 10267-L26029 LCA5 6q14.1 AGGTGTAAAAGA-TGGGTCCTAGGA 06-080.291764 245 10384-L26027 COL5A1 9q34.3 GACGATGGAGAA-AGGGTAGGTATT 09-136.793620 267 08938-L22242 SLC6A5 11p15.1 TTTCTGCAGGGA-TTGAATATCCTG 11-020.595874 166 14281-L15951 OCA2 15q13.1 GCCGCGATGAGA-CAGAGCATGATG 15-025.903847 418 09793-L25209 SPG11 15q21.1 CACAGGGCCTTA-AGCCAGATACTG 15-042.653071 299 04570-L25184 SLC12A3 16q13 CAAGTTCCGACT-GGGATTCCATGA 16-055.490937 486 13594-L22376 CACNA1A 19p13.2 ACTGGAGGAATG-GCAGCCCCTGGT 19-013.206847 Table 2b. Chromosome 2, 8, 9 and 10 probes. Length (nt) SALSA MLPA probe Gene / Exon Ligation site / Location Partial sequence, for copy number probes (24 nt adjacent to ligation site) / Complete sequence, for MS-MLPA probes (HhaI site is highlighted in grey) Distance to next probe Digestion control probe at 2q. This probe has a GCGC sequence for HhaI digestion in the stuffer, not in the hybridizing part of the probe. Therefore, this cleavage is independent of the methylation state of the target DNA. 126 # S0750-L21493 SLC9A2 2q12.1 GGACACTTTGGA-ATTCCATTGGCA - Digestion control probe at 8p. This probe contains HhaI site in the hybridising part of the probe. 312 # 17305-L21055 ESCO2 8p21.1 CCAGCGGCTTCCTCCTAGCCTGGCGCGCGATT- ATTTGAAGACGCTCACGGAGCGGCTGGCTAGGCTGA - PTENP1 at 9p13.3. Ligation sites are indicated according to NR_023917.1. 280 + * 17308-L25183 PTENP1 2383-2384 TGGTTCACATCA-TACCCCTTTGCA 1.9 kb 17825-SP0555- GAGGCCGCTGGA-26nt spanning 399 Ж * PTENP1 494-495 and 520-521 - L22726 oligonucleotide-gtcttctcccca Flanking probes at 10p. 454 17392-L21057 ITIH5 10p14 CGAGCAGAGTCA-TCTTGGATGGTG 488.6 kb 149 07632-L22241 GATA3 10p14 GAGCAACGCAAT-CTGACCGAGCAG 3110.8 kb 252 17393-L22030 CELF2 10p14 TCCCCCGGTCAT-GGTCGGAAAAGG 31668.6 kb Flanking probes at 10q, centromeric to PTEN. 292 18081-L23071 RET 10q11.21 TCCTCTACCTTA-ACCGGAGCCTGG 12892.5 kb 238 08751-L26028 PCDH15 10q21.1 ACAACATGCTGA-TCAAAGGGACTG 19018.3 kb 305 18380-L25185 ANXA7 10q22.2 AGTCCCACCAGG-TGGAGCAGGCTT 13813.0 kb 259 19351-L28591 BMPR1A 10q23.2 TACTTACATGCA-TGTGTTATTAAT 972.2 kb KLLN at 10q23.31. Ligation sites are indicated according to NM_001126049.1 (NG_007466.2), which is a reference standard in the NCBI RefSeqGene project. KLLN and PTEN, both located in 10q23.31, share a promoter region, but are transcribed in opposite directions. MS-MLPA probes for KLLN are located in the regions 1 (2 probes), 2 (1 probe) and 3 (1 probe) that were shown to be hypermethylated in renal cell carcinoma (see figure 1 in Bennett KL et al., 2011, Genes Chromosomes Cancer 50:654-61 for further details). Note that due to the challenging secondary structure formed by the KLLN/PTEN shared region, it was not possible to include a probe in this probemix for the genomic region (-188 bp to -477 bp from the PTEN translation start site) which shows differential germline methylation in Cowden syndrome or Cowden-like syndrome patients as described by Bennett KL et al., 2010, JAMA. 304:2724-31. stop codon 1485-1487 364 «18110-L25928 exon 1 990-991; 37 nt after CCTACCCAGCCAGGCTCCGCGCGCCCCGGCCGGA- 0.2 kb SALSA probemix P225 PTEN Page 7 of 13
Length (nt) SALSA MLPA probe Gene / Exon Ligation site / Location Partial sequence, for copy number probes (24 nt adjacent to ligation site) / Complete sequence, for MS-MLPA probes (HhaI site is highlighted in grey) start codon of KLLN; CCGTGCACGTTTGGGGTTACCGGGTTGAGTGGAAAGTA 2022 nt before start codon of PTEN 172 «17388-L08261 exon 1 806-805 reverse; 145 nt before start codon of CACCGGAGCGGGCGCAGGAGA- KLLN; GGCCTGCGGGGTGCGTCCCACTCACAGGGAT 1837 nt before start codon of PTEN 660-659 reverse; 291 nt 142 «10345-L25028 exon 1 before start codon of GTCTGAGAGCTTTCATTTTTAGGGCAAACGAGCCGAGT KLLN -TACCGGGGAAGCGAGAGGTGGGGCGCTGCAAG 1691 nt before start codon of PTEN 79-78 reverse; 872 nt before start codon of TTCCAGGCAGCTACACTGGGCATGCTCAGTAGA- 183 «13686-L15155 exon 1 KLLN; GCCTGCGGCTTGGGGACTCTGCGCTCGCACCCAGAGC 1110 nt before start codon of TAC PTEN start codon 951-953 Distance to next probe 0.1 kb 0.6 kb 0.3 kb PTEN at 10q23.21. Ligation sites and exons are indicated according to NM_000314.6 (NG_007466.2). start codon 1032-1034 (exon 1) 202 «18254-L22971 exon 1 201-200 reverse; 831 TGCTCTACTCTCAAACTTCCATCATGGCTGCAGCTTCC nt before start codon -GAGAGGAGAGAACTGAGCGCAGTCGCGTCCC 0.8 kb 227 «* 17387-L26030 exon 1 967-968 CCTGCAGAAGAA-GCCCCGCCACCA 0.2 kb 465 «17394-L21385 exon 1 5 nt after exon 1 TTGACCTGTATC-CATTTCTGCGGC 29.5 kb 285 17390-L14811 exon 2 0 nt before exon 2 TAAAGTACTCAG-ATATTTATCCAA 0.3 kb 190 06729-L06339 exon 2 218 nt after exon 2, reverse TATCACATAAGT-ACCTGATTATGT 31.0 kb 344 18694-L24032 exon 3 145 nt before exon 3 GGGGTATTTGTT-GGATTATTTATT 0.2 kb 328 19293-L25664 exon 3 28 nt after exon 3 ATTTGTATGCTT-GCAAATATCTTC 0.2 kb 178 17314-L20922 exon 3 226 nt after exon 3 TTGATCTGCTTT-AAATGACTTGGC 5.2 kb 208 ± 17391-L21278 exon 4 14 nt before exon 4, reverse AAAAGAAAAGTT-TAAAAGTGATAT 0.1 kb 494 17389-L21835 exon 4 61 nt after exon 4, reverse TTATTGTTATGA-CAGTAAGATACA 2.0 kb 379 * 03638-L24933 exon 5 1436-1437 GGTGTAATGATA-TGTGCATATTTA 0.1 kb 409 13032-L22244 exon 5 7 nt after exon 5 AAAAGGTAAGTT-ATTTTTTGATGT 18.9 kb 155 Ω * 13690-L15159 exon 6 1575-1576 ATAGCTACCTGT-TAAAGAATCATC 0.1 kb 319 03639-L21321 exon 6 1659-1658 reverse CTTACTGCAAGT-TCCGCCACTGAA 5.7 kb 475 * 17386-L22174 exon 7 1736-1737 ACACGACGGGAA-GACAAGTTCATG 0.1 kb 436 13692-L21061 exon 7 4 nt after exon 7 TAAAAAAGGTTT-GTACTTTACTTT 3.0 kb 359 * 17397-L25715 exon 8 1973-1974 AATGACAAGGAA-TATCTAGTACTT 0.1 kb 160 07685-L23140 exon 8 45 nt after exon 8 GACTTGTATGTA-TGTGATGTGTGT 4.1 kb 445 17395-L21062 exon 9 6 nt before exon 9 TAAATTTTCTTT-CTCTAGGTGAAG 0.3 kb 337 * 17396-L25927 exon 9 2357-2356 reverse AGAGAATTGTTC-CTATAACTGGTA 0.8 kb 214 * 07686-L15591 exon 9 3189-3188 reverse ACAGCATCTGAA-TTTTAGCACTGG 5826.4 kb stop codon 2241-2243 (exon 9) Flanking probes at 10q, telomeric to PTEN. 274 19294-L25714 LGI1 10q23.33 CTGAAATGGCTA-GTGGAATGGCTT 27685.5 kb 220 08219-L24929 FGFR2 10q26.13 TTGCACGGCTAT-TGCAAAGTGAGT 1010.5 kb 373 08602-L25186 HTRA1 10q26.13 AATTGTTTCGCA-AGTAAAGAGAGC - Flanking probe. Included to distinguish focal PTEN deletions in tumour derived DNA samples from loss of the complete 10q arm or a chromosome 10 aneuploidy. # Digestion control: warns for insufficient digestion. Upon digestion, this probe should not give a signal. «This probe is located within, or close to, a very strong CpG island. A low signal of this probe can be due to incomplete sample DNA denaturation, e.g. due to the presence of salt in the sample DNA. SALSA probemix P225 PTEN Page 8 of 13
Ж This probe consists of three parts and has two ligation sites. Ω This probe is not located in a CpG island; it has a HhaI site and in our tests it has been always 100% methylated on DNA extracted from normal blood DNA; in tumour DNA we have no evidence if this HhaI site is methylated or not. This digestion control probe is digested by HhaI independent of methylation state of sample DNA. The HhaI site is in the probe stuffer that does not hybridise to target DNA. ± SNP rs587780544 could influence the probe signal. In case of apparent deletions, it is recommended to sequence the region targeted by this probe. + SNP rs12000677 could influence the probe signal. In case of apparent deletions, it is recommended to sequence the region targeted by this probe. * For its specificity, this probe depends on a single nucleotide difference between the PTEN gene and the PTEN pseudogene (PTENP1). An apparent duplication of only this probe can be the result of a clinically nonsignificant one nucleotide sequence change at the ligation site in the related gene. The HhaI sites are marked with grey. Ligation sites are marked with -. Notes: Due to the homology with the PTEN pseudogene (PTENP1) at 9p13.3, many PTEN probes have a ligation site just outside the exons. Apparent deletions or duplications of single probes have to be treated with caution as they can be due to non-pathogenic polymorphisms. Exon numbering might be different as compared to literature! Complete probe sequences are available on request: info@mlpa.com. Please notify us of any mistakes: info@mlpa.com. SALSA probemix P225 PTEN Page 9 of 13
SALSA MLPA probemix P225-D2 PTEN sample pictures Figure 1. Capillary electrophoresis pattern from a sample of approximately 50 ng human male control DNA analysed with SALSA MLPA probemix P225-D2 PTEN (lot D2-0315). Figure 2. Capillary electrophoresis pattern of a sample of approximately 50 ng digested human male control DNA analysed with SALSA MLPA probemix P225-D2 PTEN (lot D2-0315) to determine the methylation status. Digested probes are indicated with arrows. SALSA probemix P225 PTEN Page 10 of 13
Figure 3. Capillary electrophoresis pattern of a no DNA reaction analysed with SALSA MLPA probemix P225- D2 PTEN (lot D2-0315). Please note the small non-specific peak at the length 97 nt. SALSA probemix P225 PTEN Page 11 of 13
Implemented Changes compared to the previous product description version(s). Version 23 15 February 2018 (T08) - Warning added in Tables 1 and 2 concerning a single nucleotide difference between the PTEN gene and the PTEN pseudogene (PTENP1) for several probes. - Warning added in Tables 1 and 2 for a frequent SNP (rs12000677) in probe 17308-L25183 Version 22 9 September 2017 (T08) - Warning added in Table 1, 172 nt probe 17388-L08261, 227 nt probe 17387-L26030, 364 nt probe 18110-L25928, and 465 nt probe 17394-L21385. - Small changes of S0750-L21493 probe length in Table 1 and 2 in order to better reflect the true length of the amplification product. Version 21 21 March 2017 (T08) - Various minor textual changes. Version 20 02 December 2016 (T08) - Warning regarding HhaI enzymes that are resistant to heat inactivation added under Methylation-specific MLPA section. - Various minor textual changes. Version 19 17 June 2016 (T08) - New references added on page 2. - Warning added in Table 1 and Table 2, 208 nt probe 17391-L21278. Version 18 23 June 2015 (T07) - Small changes of the probe lengths in Table 1 and 2 in order to better reflect the true lengths of the amplification products. Version 17 29 May 2015 (T07) - Product description adapted to a new product version (version number changed, lot number added, changes in Table 1 and Table 2, new figures included). - Small changes of the probe lengths in Table 1 and 2 in order to better reflect the true lengths of the amplification products. - New references added on page 2. - Various minor textual changes. - New Figure 3 added to pinpoint peak at 97 nt in no DNA reaction. Version 16 (T05) - Product description adapted to a new lot (lot number added, changes in Table 1 and Table 2, new figures included). - References added on page 2. Version 15 (T02) - Warning added in Table 1, 232 nt probe 05508-L20172. Version 14 (T02) - Reference added on page 2. - Sequence of the spanning oligo added for PTENP1 probe in Table 2. Version 13 (T02) - Electropherogram pictures using the new MLPA buffer (introduced in December 2012) added. Version 12 (T02) - Product description adapted to a new product version (version number changed, lot number added, Tables 1 and 2 modified, new pictures included). - Included brief literature review about PTENP1 and KLLN genes on page 1. - Added a paragraph about intended use of the product for methylation detection. - New references included on page 2. - A section describing MS-MLPA and data analysis of MS-MLPA added on pages 3 and 4. - Warning added on page 4 about consequences of low tumour cell percentage for MLPA analysis. - Added 2 columns in Table 1 for PTENP1 probes and HhaI site containing probes. - Table 2 split into Table 2a and Table 2b to provide more detailed information about reference probe locations and to highlight the HhaI site in the probe sequences, respectively. - Figure 2 included to demonstrate the performance of MS-MLPA probes included in this lot. Version 11 (48) - Gene name changed in Table 1 and a corresponding note added on page 3. Version 10 (47) SALSA probemix P225 PTEN Page 12 of 13
- Product description adapted to a new product version (version number changed, lot number added, new picture included). - References added on page 1. Version 09 (46) - Various textual changes on page 2. - Remark on RefSeqGene standard added below Table 2. - Small correction of chromosomal locations in Table 1 and 2. SALSA probemix P225 PTEN Page 13 of 13