T47D T47D + o SU-59 Fig SU-59 + o IHC score (-3) IHC score (-2) CD63 3 2 IHC score (-3) CD63 3 ** 2 CDb CDb * * SA9 SA9 ** * 2 IHC score (-4) αsa αsa 4 ** ** 2 Sirius Red μm IHC score (%) Sirius Red 8 6 4 2 Sirius Red (PL) * o 9 o 7D o 59 o 7D 5 T4 D + - 9 + T4 D + - 9 + 7 SU -5 7 SU -5 4 4 T T SU SU
Supplementary Figure. Immunohistochemistry of xenografts Tumor xenografts consisting of triple negative (TN) SU-59 breast cancer cells co-transplanted with primary human monocytes, express more myeloid-related, immunosuppressive and activated fibroblast markers than luminal A T47D / monocyte xenografts. The xenografts were grown in highly immunodeficient NSG-mice (see aterial and methods), and sections from the tumors were stained with myeloid (CD63, CDb, SA9) and the activated fibroblast marker αsa. The two cell lines chosen are negative for SA9. Immunohistochemistry was performed using the indicated antibodies. All histological sections were counterstained with HE. N=5 mice were analyzed for each group; Grafts were analyzed on day 2. The histograms to the right show the mean value for each IHC score with statistical analysis. IHC scores are shown in Supplementary Table 2. *=p<.5, **=p<. ANOVA non-parametric Kruskal Wallis test. N=5. Error bars indicate SE.
A Fig 2 B DA-B-23 + onocytes DA-B-23 + onocytes CD63 F4/8 CDb CD68 SA9 CD28 Vimentin CD9 CD34 C β2-microglobulin CF-7 CF-7 + onocytes Gr- PDGFRβ DA-B-23 αsa Gr- Sirius Red DA-B-23 + onocytes
Supplementary Figure 2. Immunohistochemistry of xenografts (A) Xenografts consisting of triple-negative (TN) DA-B-23 breast cancer cells cotransplanted with primary human monocytes, into NSG mice. One graft representing a low myeloid cell take is shown for the TN DA-B-23 / monocyte co-transplant group. (B) Xenografts consisting of triple-negative (TN) DA-B-23 breast cancer cells cotransplanted with primary human monocytes, into NSG mice and stained for murine macrophages (F4/8), human macrophages (CD68) human myeloid dendritic cells (mdcs; CD28) and human fibroblasts (CD9). (C) Xenografts consisting of luminal A (CF-7) and triple-negative (TN) DA-B-23 breast cancer cells transplanted with or without primary human monocytes, into NSG mice and stained for the mouse myeloid marker, Gr. All histological sections were counterstained with HE. N=5 for each group. 2
A DA-B-23 CF-7 Red - Vimentin Green - Phalloidin Blue - DAPI onocytes (o) Ctrl edium B CF-7 C DA-B-23 C CF-7 + onocytes 23 CDb Red Vimentin Brown C F-7 D A -B o - C WB: Vimentin WB: Actin Fig 3
Supplementary Figure 3. Vimentin is expressed by myeloid cells (A) Immunofluorescence of primary human monocytes cultured with breast cancer cell conditioned medium or under control conditions (only G-CSF) and stained for Vimentin (red), phalloidin (to stain actin filaments; green) and DAPI (nuclear stain; blue). CF-7 and DA- B-23 breast cancer cells were used as negative and positive controls, respectively. (B) Double staining IHC of CDb and vimentin in xeno-transplants from CF-7 / monocytes tumors as indicated. Black arrows show staining with vimentin but not CDb. (C) Western blot (WB) of vimentin expression in CF-7 and DA-B-23 breast cancer cells or human primary monocytes (o) isolated from samples from two healthy blood donors. Actin is used as a loading control. 3
Fig 4 A B 2 migration * 8 3 * 2 6 4 2 7 rl Ct CF- -23 B DA C F D T 7 A 4-7D D B A- -2 3 B46 8 Percentage of live CD4+ cells (%) In vitro monocyte survival C D CF-7 + onocytes Luminal A CF-7 Activin A Amphiregulin (AR) CXCL6 EG-VEGF Endothelin IGFBP2 TIP Trombospondin VEGF VEGF-C T47D P9 Endothelin- T47D + onocytes CXCL4 DA-B-23 + onocytes DA-B-23 Angiogenin Angiopoietin Coagulation factor III Collagen XVIII Endothelin G-CSF IGFBP3 IL8 P9 Pentraxin 3 / PTX3 PDGF-AA Persephin Serpin E TIP Trombospondin upa VEGF VEGF-C TN DA-B-468 SU-59 DA-B-468 + onocytes G-CSF P9 3 Endothelin- 4 IL-8* 5 CXCL4* 6 CCL2 2 SU-59 + onocytes 2 3 4 5 6 G-CSF.5 P9..8.6.4.2..5 IL-8.5 * saturated values Endothelin-.5..5 CXCL4.5 * saturated values CCL2.5.5.5.5 C C F7 F + 7 T4 T o 47 7 D D + D D A A- - o B B-2 2 D 3 3 D A A- + - o B B-4 46 68 8 + SU SU - o - 5 59 9 + o. C C F7 F + 7 T4 T o 7 47 D D + D D A A- - o B B-2 2 D 3 3 D A A- + - o B B-4 46 68 8 + SU SU - o - 5 59 9 + o. C C F7 F + 7 T4 T o 47 7 D D + D D A A- - o B B-2 2 D 3 3 D A A- + - o B B-4 46 68 8 + SU SU - o - 5 59 9 + o. OD measurement (U) OD measurement (U) E
Supplementary Figure 4. Effect of breast cancer cells on monocytes (A) Survival of isolated human primary monocytes in breast cancer cell conditioned medium, grown for 7 days, was assessed. 7AAD and CD4 + staining was performed to analyze the content of live monocyte/macrophages in each culture. *=p<.5 ***=p<.. ANOVA. N=5. Error bars indicate SE. (B) Boyden chamber migration assay of primary human 2 macrophages migrating towards control medium or breast cancer cell conditioned medium. *=p<.5 ANOVA. N=8. Error bars indicate SE. (C) Human angiogenesis array proteome profiler of supernatants from luminal A (CF-7 and T47D) or triple negative (TN) (DA-B-23, DA-B-468 and SU-59) breast cancer cells before monocyte co-culture. The factors in the blue box are expressed typically in luminal A breast cancer cells, and the factors in the purple box are expressed typically in TN breast cancer cells. (D) Human angiogenesis array proteome profiler of supernatants from co-cultures of human primary monocytes and luminal A (CF-7 and T47D) or TN (DA-B-23, DA- B-468 and SU-59) breast cancer cells. The factors in the green and pink boxes are specifically upregulated upon co-culture with monocytes, with the criteria if upregulated in both cultures of luminal A or TN breast cancer/monocyte co-cultures, respectively. The star (*) indicates saturated values. The numbers (-7) below the boxes indicate corresponding dots with each factor. (E) The histograms represent the OD values for each factor in relation to the reference dots A-2 (upper left corner) for each filter. N=2. 4
* 4 3 2 msa9 5 * 4 3 2 αsa 4 ns 3 2 R 4T μm 67 N C Number # of αsa positive cells per field in borders Ly6C Number # of αsa positive cells per field 67NR 67 N R 4T 5 Number # of SA9 positive cells per field B 67 N R 4T 67 N R 4T Number # of Ly6C positive cells per field CD63 - Red αsa - Brown A DA-B-23 + onocytes Fig 5 5μm 4T Ly6C msa9 αsa Sirius Red μm αsa border 5 * 4 3 2
Supplementary Figure 5. Immunohistochemistry of xenografts and syngeneic tumors (A) Double immunohistochemical staining of CD63 and αsa in the DA-B-23 / monocytes xenografts. Black arrows show staining with only αsa and green arrows show double staining. (B) Syngeneic mouse tumors consisting of luminal A (67NR) or TN (4T.3) breast cancer cells transplanted into BALB/c mice. The TN 4T.3 grafts express more myeloid-related (Ly6C), immunosuppressive (SA9) and activated fibroblast (αsa) markers than the luminal 67NR tumors. Sections from the tumors were stained with myeloid (Ly6C and SA9) and the activated fibroblast marker αsa. Immunohistochemistry was completed using the indicated antibodies. All histological sections were counterstained with HE. (C) The histograms show the mean value for each IHC score with statistical analysis. For scoring five fields were counted per staining. *=p<.5 ann-whitney U-test. Error bars indicate SE. 5
Fig 6 CF-7 CF-7 + onocytes (d2) Bright light A Polarized light μm B Polarized light Bright light DA-B-23 DA-B-23 + onocytes (d2) CF-7 + onocytes (d9)
Supplementary Figure 6. Sirius Red staining of xenografts (A) Sirius Red staining of the stroma (top row; bright light microscope; red) and classical collagen bundles (bottom row; polarized light microscope; red/green/yellowish stain) on; CF-7 or CF-7 / monocytes on day 2 and day 9, as indicated. (B) Sirius Red staining of the stroma (top row; bright light microscope; red) and classical collagen bundles (bottom row; polarized light microscope; red/green yellowish stain) on; DA-B-23 or DA-B-23 / monocytes xenografts. (N=5 for each group) on day 2. 6
Fig 7 A CF-7 B CF-7 + o Collagen VI mrna levels of primary fibroblasts cultured in co-culture supernatants Relative mrna expression Collagen VI 5μm DA-B-23 + o Collagen VI C D mrna levels of primary monocytes cultured in BC supernatants ** 3 2 l -7 7D 23 468 59 Ctr F 4 C T B B 2 - - SU DA DA E..5 *** (%) 5 rl Ct o o o 8 7D -46 + -59 + T4 D + B 8 9 7-46 SU -5 T4 DA B - SU DA 24h h G F 5 *** 5 Primary fibroblast proliferation in co-culture supernatants Relative 3H Thymidine incorporation Amount (%) of Annexin V+ PI- cells Primary fibroblast apoptosis in co-culture supernatants 2. **.5..5 rl D o 8 o 9 o Ct 47 + -46 + -5 + T D B 8 9 7-46 U 5 T4 DA B- S - SU DA rl -7 o o Ct CF + -23 + -7 B 3 CF A -2 D B DA Primary fibroblast migration in co-culture supernatants Relative area (%) of open wound left Relative mrna expression Collagen VI * rl D o 8 o 9 o Ct 47 + -46 + -5 + T D B 8 9 7-46 U 5 T4 DA B- S - SU DA Relative mrna expression DA-B-23.5 mrna levels of primary fibroblasts cultured in co-culture supernatants 2.5 TGFβ 2. ns.5..5-7 o 7D o 3 o 68 o 59 o CF7 + T4 + B-2 + B-4 8 + - 9 + 7D - 3-46 SU -5 CF T4 DA B-2 DA B - - SU DA DA
Supplementary Figure 7. Collagen IV expression in TNBC xenografts and cultures Collagen VI is expressed by myeloid cells in a triple-negative breast tumor context. (A) Xenografts of luminal A CF-7 or TN DA-B-23 breast cancer cells, alone (left) or with primary human monocytes (o; right) in NSG-mice. Immunohistochemistry was performed using antibodies to collagen VI. Black arrow indicate collagen VI expression in TN / monocyte grafts. All histological sections were counterstained with HE. (B) Collagen VI mrna expression levels measured by RT-QPCR in primary mouse fibroblasts grown in breast cancer / monocyte co-culture supernatants. *=p<.5 ANOVA. N=4. (C) Collagen VI mrna expression levels measured by RT-QPCR in human myeloid cells cultured in breast cancer supernatants. Primary human 2 macrophages = positive control*=p<.5 ANOVA. N=4. Error bars indicate SE. (D) Scratch wound assays showing mouse primary fibroblast migration in supernatants derived from co-cultures of human primary monocytes (o) and luminal A (T47D) or TN (DA-B-468 and SU-59) breast cancer cells. ***=p<. ANOVA non-parametric Kruskal Wallis test. N=2. (E) Survival analysis of mouse primary fibroblasts grown in supernatants derived from cocultures of human primary monocytes and luminal A (T47D) or TN (DA-B-468 and SU-59) breast cancer cells. Annexin V staining was performed to analyze the percentage apoptotic cells. ***=p<. ANOVA Dunn s multiple comparison test. N=. (F) Proliferation of mouse primary human fibroblasts grown in supernatants derived from cocultures of human primary monocytes and luminal A (T47D) or TN (DA-B-468 and SU-59) breast cancer cells, measured using a thymidine incorporation proliferation assay. **=p<. ANOVA Dunn s multiple comparison test. N=4. 7
(G) mrna expression levels of TGFβ in mouse primary fibroblasts cultured in supernatants derived from co-cultures of human primary monocytes and luminal A (CF-7 and T47D) or TN (DA-B-23, DA-B-468 and SU-59) breast cancer cells, assessed by RT-QPCR analysis. ns=non-significant ANOVA Dunn s multiple comparison test. N=4-8. 8
Supplementary Table. Histological and immunohistochemistry scores of xenografts consisting of luminal A CF-7 or triple-negative (TN) DA-B-23 (23) breast cancer cells, alone or co-transplanted with primary human monocytes (o), in NSG mice CF- 7 (x 6 cells) CF- 7+o (x 6 + x 6 ) 23 (x 6 ) 23+o (x 6 + x 6 ) Size (mm) 3 X 2 3+2 2 2.5 3+4 2 2.5 4 3 2+ 2 5 2 4 2 3 4 CDb (- 2) X 2 2 CD68 (- 3) 3 X CD63 (- 3) X 3 3 SA9 (- 3) X 2 2 2 2 2 Vimentin (- 2) X 2 2 2 2 2 2 2 2 2 2 αsa (- 4) X 2 3 2 3 3 2 3 2 2 3 2 2 4 β2- microglobulin (%) 25 X 5-75 5-75 25-5 25 >75 25-5 >75 25-5 75 5 25-5 5-75 25 75 PDGFRβ (- ) X Sirius Red (%) 5 X 25-5 75-5 5-75 25 25-5 5 5-75 25 5-75 5 5-75 25-5 - 25 5 75-25 - 25 Sirius Red (%) PL X - 25 25 25 - - 25 5-25 5 - - 25-5 75- - - 9
Collagen VI (- ) 4 X CD34 (- 2) 2 X 2 2 2 2 2-2 - 2 2 2 2 2 2 For statistics see Fig., Fig. 2, Fig. 3 and Supplementary Fig.. 2 Two tumors 3 Statistics for CD68 not shown in Figures: (DA- B- 23 + o) CD68 expression as compared to (CF- 7 + o); *p<.5 (t- test) 4 Statistics for Collagen VI not shown in Figures: (DA- B- 23 + o) Collagen VI expression as compared to (CF- 7 + o); **p<. (t- test) x No tumor PL = polarized light
Supplementary Table 2. Histological and immunohistochemistry scores of xenografts consisting of luminal A T47D or triple-negative (TN) SU-59 breast cancer cells, alone or co-transplanted with primary human monocytes (o), in NSG mice T47D (5x 6 cells) T47D+o (5x 6 + x 6 ) SU- 59 (x 6 ) SU- 59+o (x 6 + x 6 ) Size (mm) 4.5 3 5 3.5 5 7 X 3 6.5 4 2 2 5 4 2 3 5 CDb (- 2) 2 X 2 2 CD63 (- 3) 3 3 X 3 3 SA9 (- 3) 2 3 X 3 3 2 αsa (- 4) 2 4 4 X 2 2 4 2 4 3 4 Sirius Red (%) 67 75 25 5 5 75 75-25- 5 X 75 5 25 5 75-5 75 5 25 25-5 Sirius Red (%) PL 5 5-25 - 25 25-5 75 75 X 75 25 25-5 5 25-25 5 75 - Collagen VI (- ) 2 X For statistics see Supplementary Fig. and Fig. 3. 2 Statistics for Collagen VI not shown in Figures: (T47D + o) Collagen VI expression as compared to (SU- 59 + o); **p<. (t- test) x No tumor PL = polarized light
Supplementary Table 3. Gene expression of ACTA2, Ly6C, SA9 and CXCL6 in mouse TNBC 4T.2 tumors compared to mouse luminal 67NR tumors. Gene Gene Name Whole tumor gene Adjusted P value array data (4T.2 vs 67NR) (Fold change) ACTA2 Alpha smooth muscle 3.5 3.34E- 3 actin Ly6C Lymphocyte antigen 6.89.788 complex SA9 S Calcium binding 7.3.75E- 4 protein A9 CXCL6 Chemokine (C- X- C- otif) Ligand 6 2.74.73E- 2 Already published data 2 2
Supplementary Table 4. Antibodies used for immunohistochemistry (specificity ; clone; dilution; distributor) anti-cxcl6 (specific for human; ab44 dilution :; Abcam) anti-cdb (specific for human; clone #EP345Y dilution :; Abcam) anti-cd63 (specific for human; clone #D6 dilution :25; Novocastra) anti-cd68 (specific for human; dilution :5; DAKO) anti-vimentin (clone #V9 dilution :; Dako) anti-αsa (recognizes both mouse and human origin; clone #A4 dilution :; Dako) anti-human SA9 (specific for human; calgranulin B clone #H9 dilution :2; Santa Cruz) anti-mouse SA9 (specific for mouse; ab5472 dilution :; Abcam) anti-β2microglobulin (specific for mouse; sc-836 dilution :; Santa Cruz) anti-pdgfrβ (clone #369 dilution :; Cell Signaling) anti-collagen VI (recognizes both mouse and human origin; clone #H-2 dilution :25; Santa Cruz) anti-hla-abc (specific for human; Ab7328 dilution :2; Abcam) anti-cd34 (specific for mouse; clone #EC4.7 dilution :8; Santa Cruz) anti-f4/8 (specific for mouse; clone #Cl:A3- dilution :2; Abcam) anti-dc-lap (specific for human; CD28; clone #E. dilution :; Dendritics) anti-cd9 (specific for human; clone #EPR332 dilution :25; Abcam) anti-ly6c (specific for mouse; ab5627 dilution :; Abcam) anti-gr (specific for mouse; clone #RB6-8C5; Nordic Biosite) Specificity (mouse vs human) tested for all antibodies 3
Supplementary Table 5. Primers used in Quantitative real-time PCR GENES FORWARD REVERSE ouse ACTB CTCTGGCTCCTAGCACCATGAAGA CATGATGCTTGATCACATGTCTCG ouse HPRT CAAGCTTGCTGGTGAAAAGGAC GTCAAGGGCATATCCTACAACAAA ouse GAPDH TGCACCACCAACTGCTTAG GATGCAGGGATGATGTTC ouse alpha-sa ACTGGGACGACATGGAAAAG GTTCAGTGGTGCCTCTGTCA ouse TGF-B GGATACCAACTATTGCTTCAGCTCC AGGCTCCAAATATAGGGGCAGGGTC ouse FAP ACTGGGTGTATATGAAGTTGAGGAC TTCTTCATCAATGAAACCCATTT ouse CXCL6 product number: -25636, Bio-Rad ouse COL6A CCACAGGGTGACCAAGGAAG ACCTCGGTATCCTTTAGGTCCAA Human ACTB CTGGAACGGTGAAGGTGACA AAGGGACTTCCTGTAACAATGCA Human GAPDH TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG Human SDHA TGGGAACAAGAGGGCATCTG CCACCACTGCATCAAATTCATG Human YWHAZ ACTTTTGGTACATTGTGGCTTCAA CCGCCAGGACAAACCAGTAT Human UBC ATTTGGGTCGCGGTTCTTG TGCCTTGACATTCTCGATGGT Human COL6A ACCGACTGCGCTATCAAGAA TCGGTCACCACAATCAGGTA 4
Supplementary References Bergenfelz, C. et al. SA9 expressed in ER(- )PgR(- ) breast cancers induces inflammatory cytokines and is associated with an impaired overall survival. Br J Cancer 3, 234-243, doi:.38/bjc.25.346 (25). 2 Johnstone, C. N. et al. Functional and molecular characterisation of EO77.LB tumours, a new C57BL/6- mouse- derived model of spontaneously metastatic mammary cancer. Dis odel ech 8, 237-25, doi:.242/dmm.783 (25). 5