Preclinical evaluation of pain in endometriosis
|
|
- Antony Hubbard
- 5 years ago
- Views:
Transcription
1 receptor antagonism reduces peripheral and central hyperalgesia in a preclinical mouse model of endometriosis Erin Greaves, Andrew W Horne, Helen Jerina, arta ikolajczak, Lisa Hilferty, Rory itchell, Sue Fleetwood-Walker, Philippa TK Saunders
2 Supplementary Information Supplementary Tables Supplementary Table ; Information about Lesions Recovered from the ouse odel Sample size Recovery rate 9% Number of lesions (mean±se).9±. Supplementary Table : Primer sequences. Gene Forward Reverse UPL Probe 5 -cagaggagacggaccacct- 5 -ccatgtaggcaaagattgtgaa- 5 -cctaaccccaccctacaggt- 5 agaaggacgcgttgactcc- 77 COX- 5 -cctctttccaggagctcaca- 5 -tcgatgtcaccgtacagctc- 6 COX- 5 -gatgctcttccgagctgtg- 5 -ggattggaacagcaaggattt- 5 TRPV 5 -caacaagaaggggcttacacc- 5 -tctggagaatgtaggccaagac- SCNA 5 -ttcataatgtgtggcaactgg- 5 -ttattgcacgtggaaccatc- 9 Supplementary Table : Antibodies. Antibody Raised in Application Supplier Dilution Rabbit Immunohistochemistry Cayman; 75 : Immunohistochemistry Cayman;775 :5 COX- Immunohistochemistry Bio-Vision; 6- :5 COX- (H-6) Rabbit Immunohistochemistry Santa Cruz Biotech; :5 sc-795 TRPVI Guinea pig Dual immunofluorescence Abcam; ab95 : Peripherin Chicken Dual immunofluorescence Abcam; ab97 :5 NF- Chicken Dual immunofluorescence illipore; SS9 : 5 Rabbit Dual Immunofluorescence Alomone; APR-6 :
3 COX- Rabbit Western blot Santa-Cruz Biotech; : sc-795 GAPDH ouse Western blot illipore; AB 7 : Supplementary Table. It has been reported that the expression in mouse uterus of standard housekeeping genes such as GAPDH can be altered by E treatment (Schroder et al., 9). However, in the CNS regions assessed here, the OVX + E and endometriosis model groups showed no discernible changes in GAPDH expression compared to naïve mice. For equal gel loading volumes of lysates produced at a fixed ratio of tissue wet weight per ml, we found densitometric measurements of GAPDH expression in the OVX + E group to be.9 ±.9%,. ± 6.% and 7. ± 6.% of naïve for spinal cord, thalamus and anterior cingulate cortex respectively (means ± SE, n = 5-6). Corresponding values for the endometriosis model group were 96.6 ± 6.%, 96.5 ± 5.% and 95. ± 6.5%. Analysis by One-Way ANOVA with Dunnett s post-hoc test indicated no statistically significant differences in any case, validating our use of GAPDH here as a comparator housekeeping gene.
4 Supplementary Figures A 5 Number of lesions vs withdrawal threshold-abdomen B 5 Number of lesions vs withdrawal threshold-hindpaw Number of lesions Number of lesions Withdrawal threshold (g) Paw withdrawal threshold (g) Fig.S Endometriosis mice show no correlation between mechanical hyperalgesia and number of lesions. Correlation between withdrawal threshold (g) and number of lesions when von Frey filaments were applied to a) the abdomen and b) the hindpaw. N= mice.
5 Preclinical evaluation of pain in endometriosis a i 5 ii iii iv GE S S S b i. ii iii iv GE.5. S S S.5. c i 5 COX- ii S iii iv S S GE d i COX- ii.6 iii iv S. S S * GE.. e i * 6 f PGE pg/ml Naive OVX+E Endo g
6 Fig.S The PGE signaling pathway is over-expressed in endometriosis lesions. mrna concentrations and protein expression of (a), (b), (c) COX-, (d) COX- in peritoneum from naïve mice (; ii), peritoneum from mice with endometriosis (; iii) and endometriosis lesions (; iv). (i) Graphs indicate QPCR data where values are normalized to expression in samples of cycling uterus., n=9,, n=6 and, n=8. : Relative quantification. (ii-iii) Representative images of single antigen immunodetection taken from, and. Insets are negative controls (omission of primary antibody on sections of cycling uterus). Scale bars = 5 or µ. (e) Peritoneal fluid concentrations of PGE. PGE concentrations (pg/ml) were measured using ISA in the peritoneal fluid of mice with endometriosis (n=) compared to naïve (n=8), and OVX+E mice (n=7). (f-g) mrna concentrations of (f) and (g) were also analyzed in lesions and peritoneum, there was no significant difference in expression levels and therefore these particular receptors were not investigated further. Statistical analysis was performed using a one-way ANOVA and Newman-Keuls post comparison test. *p<.5, p<., p<.. 6
7 Preclinical evaluation of pain in endometriosis a b..5 c COX-.5 OVX+E Endo OVX+E. OVX+E Endometriosis Endo d TRPV % TRPV + NF- co-localizaton * OVX+E Endo erge NF- OVX+E Endometriosis f % + TRPV co-localization 8 6 OVX+E Endo erge TRPV e Fig.S Gene expression in DRGs of endometriosis mice. (a-b) QPCR analysis of the prostaglandin E receptor (a), and (b) COX- in L5-L6 DRGs from mice with endometriosis (n=9) compared to 7
8 naïve (n=7) and OVX+E control mice (n=6). : Relative quantification. Values were normalized to a single naïve DRG sample given the arbitrary value of one. eans were not significantly different. (cd) Dual label immunofluorescence was carried out to identify TRPV expression (red) in L5-6 DRG cells co-expressing neurofilament- (NF-; green). (c) Shows typical confocal images for TRPV and NF- from naïve, OVX+E and endometriosis mice (field of view, 6x6µm). Total cells counted were, 68, and, accumulated from three different naïve, OVX+E -treated and endometriosis mice in each case. (d) Shows a bar chart that summarizes % expression of TRPV in NF- -positive cells and indicates that the number of TRPV+NF-+ small DRG cells is significantly increased in mice with endometriosis. Statistical analysis was performed using a one-way ANOVA and Tukey s post-hoc test. *p<.5. (e-f) Dual label immunofluorescence was carried out to identify expression (red) in L5-6 DRG cells co-expressing TRPV (cyan). (e) Showes typical confocal images for and TRPV from naïve, OVX+E and endometriosis mice (field of view, 6x6µ). Total cells counted were 9, 58, 6, accumulated from three different naïve, OVX+E -treated and endometriosis mice in each case. (f) Shows a bar chart that summarises % expression of in TRPV- positive cells and indicates that the number of +, TRPV+ small DRG cells is significantly increased in endometriosis. Statistical analysis was performed using a one-way ANOVA and Tukey s post-hoc test. p<.. 8
9 a echanical withdrawal threshold (g) c echanical withdrawal threshold (g) e echanical withdrawal threshold (g) g echanical withdrawal threshold (g) TRPV antagonist - abdomen JNJ * 6 8 antagonist - abdomen L-698 * * 6 8 * +++ antagonist - abdomen TG antagonist - abdomen PF Naive + drug Endo + drug Endo + vehicle b d f h 5 TRPV antagonist - hind-paw JNJ antagonist - hind-paw L antagonist - hind-paw TG antagonist - hind-paw PF Fig.S Time-course of effects on local and secondary mechanical hyperalgesia of i.p injection of potential therapeutics in a mouse model of endometriosis. Graphs depict withdrawal thresholds for von Frey filaments applied to the rostral regions of the abdomen or hindpaws of endometriosis mice 9
10 compared to naïve controls. OVX+E mice were not tested because Figure indicated that their responses were unaltered from naïve control mice. (a) Shows the time-course of effects of the TRPV inhibitor JNJ 7 ( mg/kg ip) on abdominal and (b) hindpaw mechanical withdrawal responses in endometriosis mice (blue and pink lines) or naïve controls (purple lines). In both abdomen and paw tests, withdrawal thresholds were significantly lower in endometriosis mice than in naïve mice (p<. and p<.). These differences were modestly but significantly attenuated with JNJ 7 (p<.and p<.5), which had no discernible effect in naïve controls. (c) Shows the time-course effects of the antagonist TG6-- (mg/kg, ip), on abdominal and (d) paw mechanical withdrawal threshold in endometriosis mice compared to naïve controls. In both abdomen and paw tests, withdrawal thresholds were significantly lower in endometriosis mice compared to naïve controls (p<.5 and p<.). These differences were substantially and significantly attenuated by TG6-- (p<. and p<.). TG6-- had no discernible effect in naïve controls. The highly selective antagonist PF- 898 (mg/kg, ip) substantially and significantly reversed (e) abdominal and (f) hindpaw mechanical hyperalgesia (p<.). There was no discernible effect of PF-898 in naïve mice. The selective antagonist L-698 had only a very small but statistically significant effect on (g) abdominal mechanical hyperalgesia and no discernible effect on (h) paw mechanical hyperalgesia (n=5 in all cases). Statistical analysis was performed using a Two-Way ANOVA with a Dunnett s multiple comparison test. *p<.5, p<. and p<. compared to naïve mice + pharmacological agent. +p<.5, ++p<. and +++p<. compared to pre-administration baseline.
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Atlas representations of the midcingulate (MCC) region targeted in this study compared against the anterior cingulate (ACC) region commonly reported. Coronal sections are shown on
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationSUPPLEMENTARY INFORMATION. The Calcium-activated Chloride Channel Anoctamin 1 acts as a Heat. Sensor in Nociceptive Neurons
SUPPLEMENTARY INFORMATION The Calcium-activated Chloride Channel Anoctamin 1 acts as a Heat Sensor in Nociceptive Neurons Hawon Cho, Young Duk Yang, Jesun Lee, Byeongjoon Lee, Tahnbee Kim Yongwoo Jang,
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationSupplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
More informationSupplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
More informationSupplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
More informationFig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo.
T47D T47D + o SU-59 Fig SU-59 + o IHC score (-3) IHC score (-2) CD63 3 2 IHC score (-3) CD63 3 ** 2 CDb CDb * * SA9 SA9 ** * 2 IHC score (-4) αsa αsa 4 ** ** 2 Sirius Red μm IHC score (%) Sirius Red 8
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationSupplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More informationSupplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
More informationDiabetic Complications Consortium
Diabetic Complications Consortium Application Title: Cathepsin S inhibition and diabetic neuropathy Principal Investigator: Nigel A Calcutt 1. Project Accomplishments: We investigated the efficacy of cathepsin
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More informationSupplementary Information
Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,
More informationa. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.
a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure
More informationRapamycin Suppresses Astrocytic and Microglial Activation and Reduced Development of Neuropathic Pain after Spinal Cord Injury in Mice.
Rapamycin Suppresses Astrocytic and Microglial Activation and Reduced Development of Neuropathic Pain after Spinal Cord Injury in Mice. Satoshi Tateda, M.D., Haruo Kanno, M.D., Ph.D., Hiroshi Ozawa, M.D.,
More informationA subpopulation of nociceptors specifically linked to itch
Supplementary Information A subpopulation of nociceptors specifically linked to itch Liang Han 1, Chao Ma 3,4, Qin Liu 1,2, Hao-Jui Weng 1,2, Yiyuan Cui 5, Zongxiang Tang 1,2, Yushin Kim 1, Hong Nie 4,
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationGFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationCannabinoid Agonists Inhibit Neuropathic Pain Induced by Brachial Plexus Avulsion in Mice by Affecting Glial Cells and MAP Kinases
Cannabinoid Agonists Inhibit Neuropathic Pain Induced by Brachial Plexus Avulsion in Mice by Affecting Glial Cells and MAP Kinases Ana F. Paszcuk 1, Rafael C. Dutra 1, Kathryn A. B. S. da Silva 1, Nara
More informationEndocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
More informationSupplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
More informationNature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.
Supplementary Figure 1 Cytokine pattern in skin in response to urushiol. Wild-type (WT) and CD1a-tg mice (n = 3 per group) were sensitized and challenged with urushiol (uru) or vehicle (veh). Quantitative
More informationSupplemental Materials. Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in. Pancreatic Cancer.
Supplemental Materials Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in Pancreatic Cancer Jun Zhao 1, Zhilan Xiao 2, 3, Tingting Li 1, 4, Huiqin Chen 5, Ying Yuan 5, Alan
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass
More informationSupplementary Figure 1
Supplementary Figure 1 The average sigmoid parametric curves of capillary dilation time courses and average time to 50% peak capillary diameter dilation computed from individual capillary responses averaged
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Subcellular segregation of VGluT2-IR and TH-IR within the same VGluT2-TH axon (wild type rats). (a-e) Serial sections of a dual VGluT2-TH labeled axon. This axon (blue outline) has
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE
More informationSupporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
More informationSupplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
More informationSocial deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0110-8 In the format provided by the authors and unedited. Social deficits in Shank3-deficient mouse models of autism are rescued by
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationAppendix Table of Contents. 1. Appendix Figure legends S1-S13 and Appendix Table S1 and S2. 2. Appendix Figures S1-S13
Appendix Table of Contents. Appendix Figure legends S-S3 and Appendix Table S and S. Appendix Figures S-S3 . Appendix Figure legends S-S3 and Appendix Table S and S Appendix Figure S. Western blot analysis
More informationSUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.
Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain.
Supplementary Figure 1 PICALM expression in brain capillary endothelium in human brain and in mouse brain. a, Double immunostaining for PICALM (red, left) and lectin positive endothelial profiles (blue,
More informationNature Medicine: doi: /nm.4324
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression
More informationSupplemental Information. Dorsal Raphe Dual Serotonin-Glutamate Neurons. Drive Reward by Establishing Excitatory Synapses
Cell Reports, Volume 26 Supplemental Information Dorsal Raphe Dual Serotonin-Glutamate Neurons Drive Reward by Establishing Excitatory Synapses on VTA Mesoaccumbens Dopamine Neurons Hui-Ling Wang, Shiliang
More informationmarker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
More informationReal-time imaging reveals the single steps of brain metastasis fo mation r
Real-time imaging reveals the single steps of brain metastasis fo mation r Yvonne Kienast, Louisa von Baumgarten, Martin Fuhrmann, Wolfgang E.F. Klinkert, Roland Goldbrunner, Jochen Herms and Frank Winkler
More informationSupplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
More informationSupplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
More informationSupplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/366/ra25/dc1 Supplementary Materials for Viral entry route determines how human plasmacytoid dendritic cells produce type I interferons Daniela Bruni, Maxime
More informationSupplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
More informationSupplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
More informationSupplementary Information File
Supplementary Information File Supplementary Table 1. List of synthesized sirna sequences for target genes sirna Species Sequence Ctrl sirna mouse sense 5 -UUCUCCGAACGUGUCACGUTT-3 Antisense 5 -ACGUGACACGUUCGGAGAATT-3
More informationSupplementary Figure 1
CD31 FN Supplementary Figure 1 a Multivariate Cox regression analysis of predicting factors for disease-free and overall survival in 435 HNSCC patients b FN staining in whole sections of HNSCC c FN expression
More informationSupplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
More informationSUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Hippocampal sections from new-born Pten+/+ and PtenFV/FV pups were stained with haematoxylin and eosin (H&E) and were imaged at (a) low and (b) high
More informationCoding of facial expressions of pain in the laboratory mouse
nature methods Coding of facial expressions of pain in the laboratory mouse Dale J Langford 1, Andrea L Bailey 1, Mona Lisa Chanda 1, Sarah E Clarke 1, Tanya E Drummond 1, Stephanie Echols 2, Sarah Glick
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Neither the activation nor suppression of the MAPK pathway affects the ASK1/Vif interaction. (a, b) HEK293 cells were cotransfected with plasmids encoding
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Iliopsoas and quadratus lumborum motor neurons in the L2 spinal segment.
Supplementary Figure 1 Iliopsoas and quadratus lumborum motor neurons in the L2 spinal segment. (A) IL and QL motor neurons were labeled after CTb-488 (green) muscle injections at birth. At P4, the L2
More informationDisrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development
Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development 1 Frankie Hang Fung Lee, 1 Ping Su, 1 Yu Feng Xie, 1 Kyle Ethan Wang, 2 Qi Wan and 1,3 Fang Liu 1 Campbell Research Institute, Centre
More informationBoucher et al NCOMMS B
1 Supplementary Figure 1 (linked to Figure 1). mvegfr1 constitutively internalizes in endothelial cells. (a) Immunoblot of mflt1 from undifferentiated mouse embryonic stem (ES) cells with indicated genotypes;
More informationSupplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad
Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Effect of a HFD on the Acox gene expression in the livers of WT and IL-6 -/- mice. Expression of Acox in the livers of WT and IL-6 -/- mice fed STD or HFD determined through
More informationSupporting Information
Supporting Information Chen et al. 10.1073/pnas.0807991106 SI Methods Sucrose Gradient Fractionation. Fractionation by sucrose gradient was performed as described by Gasparini et al. [(2001) J Neurosci
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Drd1a-Cre driven ChR2 expression in the SCN. (a) Low-magnification image of a representative Drd1a-ChR2 coronal brain section (n = 2) showing endogenous tdtomato fluorescence (magenta).
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
More informationMicroglial Inhibition Influences XCL1/XCR1 Expression and Causes Analgesic Effects in a Mouse Model of Diabetic Neuropathy
Microglial Inhibition Influences XCL1/XCR1 Expression and Causes Analgesic Effects in a Mouse Model of Diabetic Neuropathy Magdalena Zychowska, M.D., Ewelina Rojewska, Ph.D., Anna Piotrowska, M.D., Grzegorz
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationSUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
More informationMonocytes expressing CX3CR1 orchestrate the development of vincristine-induced pain
Research article Monocytes expressing CX3CR1 orchestrate the development of vincristine-induced pain Elizabeth A. Old, 1 Suchita Nadkarni, 2 John Grist, 1 Clive Gentry, 1 Stuart Bevan, 1 Ki-Wook Kim, 3
More informationNature Immunology: doi: /ni.3631
Supplementary Figure 1 SPT analyses of Zap70 at the T cell plasma membrane. (a) Total internal reflection fluorescent (TIRF) excitation at 64-68 degrees limits single molecule detection to 100-150 nm above
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11436 Supplementary Figure 1. CRF peptide is localized cholinergic interneurons throughout the nucleus accumbens. Immunofluorescent images demonstrating localization of CRF peptide, tyrosine
More informationSilencing neurotransmission with membrane-tethered toxins
nature methods Silencing neurotransmission with membrane-tethered toxins Sebastian Auer, Annika S Stürzebecher, René Jüttner, Julio Santos-Torres, Christina Hanack, Silke Frahm, Beate Liehl & Inés Ibañez-Tallon
More informationSupplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation
Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces
More informationNature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
More informationSupplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration
Supplementary Materials for c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Saurav Brahmachari, Preston Ge, Su Hyun Lee, Donghoon Kim, Senthilkumar S. Karuppagounder, Manoj
More informationSupplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice
Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice Wang et. al. IL-6 in plasma (pg/ml) Rac1/HPRT (% of control) PSD9/HPRT
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationSchwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis
Schwarz et al Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis and Sorting Pathway Supplemental Data Supplemental Fie 1: AMPARs undergo activity-mediated ubiquitination
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSUPPLEMENTARY INFORMATION
METHODS Mice and rats. Behavioural experiments were performed in male and female 7 12 week old mice or in male 7 10 week old Wistar rats. Permissions for the animal experiments have been obtained from
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationName Animal source Vendor Cat # Dilutions
Supplementary data Table S1. Primary and Secondary antibody sources Devi et al, TXNIP in mitophagy A. Primary Antibodies Name Animal source Vendor Cat # Dilutions 1. TXNIP mouse MBL KO205-2 1:2000 (WB)
More informationAnalgesia Mediated by the TRPM8 Cold Receptor in Chronic Neuropathic Pain
Current Biology 16, 1591 1605, August 22, 2006 ª2006 Elsevier Ltd All rights reserved DOI 10.1016/j.cub.2006.07.061 Analgesia Mediated by the TRPM8 Cold Receptor in Chronic Neuropathic Pain Article Clare
More informationTEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
More informationSupplemental Information
Supplemental Information Essential role of Kir5.1 channels in renal salt handling and blood pressure control Oleg Palygin, Vladislav Levchenko, Daria V. Ilatovskaya, Tengis S. Pavlov, Oleh M. Pochynyuk,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta
More informationNature Medicine: doi: /nm.4078
Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios
More informationDepartment of Orthopaedic Surgery, Tohoku University Graduate School of Medicine, Sendai, Japan, 2
Low-energy Extracorporeal Shock Wave Therapy Promotes VEGF Expression and Angiogenesis and Improve Locomotor and Sensory Functions after spinal cord injury Kenichiro Yahata 1, Hiroshi Ozawa, M.D., Ph.D.
More informationSupplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
More informationThe subcortical maternal complex controls symmetric division of mouse zygotes by
The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1,
More informationSupplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
More informationImpact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice
Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice Shinichi Hosokawa 1,3,Kenichiro Furuyama 1,3, Masashi Horiguchi 1,3,Yoshiki
More informationFigure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
More informationRescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
More information