The role of apolipoprotein D in lipid metabolism and metabolic syndrome

Similar documents
Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?

Metabolic defects underlying dyslipidemia in abdominal obesity

Metabolism of acylglycerols and sphingolipids. Martina Srbová

Supplementary Figure 1

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Pathophysiology of Lipid Disorders

LIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI

THE CLINICAL BIOCHEMISTRY OF LIPID DISORDERS

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

In The Name Of God. In The Name Of. EMRI Modeling Group

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

SUPPLEMENTARY INFORMATION

3-Thia Fatty Acids A New Generation of Functional Lipids?

Chemistry Reference Ranges and Critical Values

Integrative Metabolism: Significance

Chemistry Reference Ranges and Critical Values

Lipids digestion and absorption, Biochemistry II

2.5. AMPK activity

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Lipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Chapter (5) Etiology of Low HDL- Cholesterol

Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis

Clinician Blood Panel Results

Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus)

ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity

The art of tracing dietary fat in humans. Leanne Hodson

High density lipoprotein metabolism

Bringing metabolic profiling into clinical practice. Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD

Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT

Plasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam

Lipoproteins Metabolism

Supplementary Appendix

Lipoprotein Pathophysiology. Lipoprotein Pathophysiology


ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

GROWTH HORMONE AND PPARα IN THE REGULATION OF GENES INVOLVED IN HEPATIC LIPID METABOLISM. Caroline Améen

Supplementary Figure 1

Intermediary metabolism. Eva Samcová

Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins

Weight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL

Weight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL

VITROS MicroSlide Assay Summary

Pathogenesis of Diabetes Mellitus

LIPID METABOLISM

Triglyceride determination

SITA 100 mg (n = 378)

Niacin Metabolism: Effects on Cholesterol

Is it really that simple? Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics

Supplementary Materials

AN OVERVIEW OF FATTY ACID ETHYL ESTERS

SUPPLEMENTARY INFORMATION

ALKA VITA DIABETES TEST

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Regulation of Lipid Homeostasis: Lipid Droplets

NASH Bench to Bedside

Supplementary Figure S1

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism

Cholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia

Metabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

Lipid Diges.on 11/4/ CLASSIFICATION OF LIPID LIPID GLYCEROL BASED NON- GLYCEROL BASED SIMPLE COMPOUND GLYCOLIPID PHOSPHOGLYCERIDES

Metabolic integration and Regulation

Gender: M Chart No: Fasting: Yes. Boston Heart HDL Map TM Test 1 ApoA-I (mg/dl) levels in HDL particles. α Range > <14 mg/dl. α-2 50.

The Role Of Crebh In Hepatic Energy Regulation Under Metabolic Stress

Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL

HOW TO DEFINE GOOD BIOMARKERS OF HEALTH? Suzan Wopereis

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity

AMPK. Tomáš Kuc era. Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze

Master class Biomolecular Sciences Molecular Cell Biology.

Supplemental Table 1. List of primers used for real time PCR.

AMPK. Tomáš Kučera.

NCBA Ground Beef Diet/Health Study

Lipids, lipoproteins and cardiovascular disease

Controls & Calibrators Clinical Chemistry

Metabolic changes in menopausal transition

determination of Triglyceride in Serum Amal Alamri

STRUCTURE AND METABOLISM Of LIPIDS AND LIPOPROTEINS. R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty

BCH 447. Triglyceride Determination in Serum

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes

2.5% of all deaths globally each year. 7th leading cause of death by % of people with diabetes live in low and middle income countries

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300

Nafith Abu Tarboush DDS, MSc, PhD

Supplementary Online Content

Complete Medical History

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Biochemistry Adult Reference Ranges

Supplementary Figure 1.

BIO 116 Practice Assignment 1 The Endocrine System and Blood This is not a required assignment but it is recommended.

Tables of Normal Values (As of February 2005)

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions

Organochloride pesticides impaired mitochondrial function in hepatocytes and. aggravated disorders of fatty acids metabolism

The lipogenic transcription factor ChREBP dissociates hepatic steatosis from insulin resistance in mice and humans

Transcription:

UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD

Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated with HDL Secretion stimulated by 25- hydroxycholesterol Ligands Arachidonic Acid Heme Steroids (progesterone, androgen, estrogen) Cholesterol and CHOL esters

Apolipoprotein D Surrenals Kidney Pancreas Thymus Central and peripheric nervous systems Lungs Ovaries and testis Central and peripheric nervous systems Adipose tissue Heart Lungs Glands Ovaries and testis

Apolipoprotein D Involved in growth and cellular differentiation Metabolic disorders and energetic homeastasis Development Cancer Protection against stress in drosophila Maintance and repair of central nervous system

Apolipoprotein D in metabolism Low plasma levels of apod associated with disorders that produce low HDL levels with or without hypertriglyceridemia Tangier disease Abeta-lipoproteine-mia LCAT deficiency Hypertrigly-ceride-mia at birth ApoD modulation in non-insulin dependent diabetes mellitus (NIDDM) Increased and defective processing of apod in Niemann-Pick disease type C mouse (NPC). Animal model of human NPC, which is a genetic disorder affecting cellular cholesterol transport

Apolipoprotein D Tissue Do Carmo et al, AJP Endo Met 2008

Tg ApoD mice characteristics Table 2. Morphometric parameters of H-apoD Tg mice and WT littermates. WT Thy-1/ApoD NSE/ApoD Body weight (g) 38.95 ± 4.57 44.06 ± 5.42 43.83 ± 4.16 Body lenght (cm) 9.86 ± 0.40 10.11 ± 0.36 10.00 ± 0.18 Body mass index (g/cm2) 0.40 ± 0.03 0.43 ± 0.05 0.44 ± 0.04 Weights of tissue (g/g of body weight, x 100) Brain 1.07 ± 0.08 0.97 ± 0.08 0.96 ± 0.07 Liver 4.03 ± 0.58 5.24 ± 0.68 4.91 ± 0.73 Inguinal fat 4.87 ± 1.54 4.40 ± 0.68 5.19 ± 0.90 Mesenteric fat 5.26 ± 1.01 4.77 ± 0.83 5.37 ± 0.95 Epididymal fat 0.88 ± 0.26 0.82 ± 0.23 0.68 ± 0.31 Data are means ± SE of 12 mice per group. p<0.05, p<0.01 vs WT mice. Table 3. Serum parameters in H-apoD Tg mice and WT littermates. WT Thy-1/ApoD NSE/ApoD Total protein (g/l) 52.20 ± 4.09 52.33 ± 5.16 55.40 ± 11.61 Albumin (g/l) 27.40 ±7.50 27.83 ± 6.71 30.20 ± 8.47 Glucose (mmol/l) 10.90 ± 0.75 12.52 ± 3.44 11.28 ± 2.95 Insulin (ng/ml) 1.44 ± 0.37 3.15 ± 0.56 2.32 ± 0.37 BUN urea (mmol/l) 8.28 ± 1.01 7.98 ± 1.79 7.62 ± 1.09 Creatinine ( mol/l) 13.33 ± 0.58 15.33 ± 5.13 17.67 ± 2.52 Total bilirubin ( mol/l) 2.92 ± 0.94 2.82 ± 1.48 3.56 ± 1.36 ALT (U/L) 39.00 ± 1.00 38.00 ± 2.65 72.00 ± 26.29 AST (U/L) 86.00 ± 20.88 78.67 ± 2.08 173.67 ± 65.26 Alkaline phosphatase (U/L) 82.40 ± 14.96 120.80 ± 62.50 73.00 ± 29.51 Creatine kinase (U/L) 85.33 ± 47.51 102.67 ± 27.01 94.00 ± 49.12 Cholesterol (mmol/l) 2.98 ± 0.36 3.13 ± 0.63 4.25 ± 1.98 HDL (mmol/l) 2.42 ± 0.31 2.60 ± 0.63 3.07 ± 1.57 Triglycerides (mmol/l) 1.15 ± 0.31 1.71 ± 0.89 1.14 ± 0.50 Data are means ± SE of 6 mice per group. p<0.05, p<0.01, p<0.001 vs WT mice. Do Carmo et al, AJP Endo Met 2008

TgApoD mice and hepatic steatosis Do Carmo et al, AJP Endo Met 2008

TgApoD mice characterization Do Carmo et al, AJP Endo Met 2008

TgApoD mice characterization 2.0 1.5 1.0 0.5 wt apod 3 2 1 0.0 PPARγ1 PPARγ2 pparg1 pparg2 wt tg PPARγ1 0 PPARγ2 PPARγ1 Amidoblack WT WT PPARγ mrna PPARγ protein PPARγ2 Liver Muscle HPRT C/EBPα mrna C/EBPβ mrna C/EBPα C/EBPβ HPRT HPRT Labrie et al. 2014 BBA-lipids submitted

TgApoD mice Lipid droplets formation 3 2 1 Plin2 protein (Relative to WT) Cide A mrna Cide B mrna (Relative to WT) 0 wt apod Plin2 Cide A Amidoblack HPRT Cide B HPRT Cide C mrna Lipid droplet size Cide C Lipid droplet number HPRT Labrie et al. 2014 BBA-lipids submitted

TgApoD mice and Fatty acid uptake 80000 60000 60000 40000 CD36 mrna CPM 3 H-oleate e / mg protein CPM 3 H-oleate/mg protein CD36 20000 0 WT Tg HPRT Labrie et al. 2014 BBA-lipids submitted

Hepatic lipogenesis Malonyl-CoA ACC Acetyl-CoA glycolysis Glucose FAS Palmitoyl-CoA Palmitoleyl-CoA C16:0 SCD1 C16:1 Stearoyl-CoA C18:0 Oleyl-CoA C18:1 Triglycerides Phospholipides Plasma Adipose tissues VLDL SFA MUFA Lipids deposits

TgApoD mice and lipogenesis AMPKα protein Phospho-AMPKα Expression AMPKα P-AMPKα Amidoblack Amidoblack ACC protein Phospho-ACC P-ACC/ ACC ACC Amidoblack P-ACC Amidoblack Labrie et al. 2014 BBA-lipids submitted

FAS protein FAS Amidoblack TgApoD mice and lipogenesis ACC Scd1 Dgat LXR-α HPRT WT mrna 0.16 0,16 0.14 0.12 0.10 0.08 0.06 0.04 0.02 0,14 0,12 0,10 0,08 0,06 0,04 0,02 ACC Scd1 3 H2 O incorporated/mg protein Ratio of 3 H2O incorporated/g/h 0 0,00 ns Labrie et al. 2014 BBA-lipids submitted

TgApoD mice and β-oxydation Labrie et al. 2014 BBA-lipids submitted

ApoD in hepg2 cells BSA AA 10 NT EV apod NT EV apod H-apoD β-actin Luciferase activity 8 6 4 2 apod AA(7µM) 0 - + - - - + + + - apod + apod PPRE PPRE PPRE LUC Myc β-actin Labrie et al. 2014 BBA-lipids submitted

ApoD mechanism of action FFA FFA FFA FFA FFA Lipid Droplet Cide-A Cide-C Plin2 TG FFA CD36 AA AA RXR Cide-C CD36 Plin2 Cide-A Labrie et al. 2014 BBA-lipids submitted

Acknowledgments Maryline Labrie Simon Lalonde Ouafa Nagyb Dr. E. Rassart