Regulation of Lipid Homeostasis: Lipid Droplets
|
|
- Sherman Shelton
- 5 years ago
- Views:
Transcription
1 Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1
2 The Basics I: FAs The Basics II: FA Activation 2
3 Basics III: TG-FA Interplay. Why? Adipocytes 3
4 Foam cells Pathologies associated with lipid droplets Obesity - mice with k.o. of structural protein, perilipin, or signaling molecule caveolin-1, are resistant to high fat induced obesitas Atherosclerosis accumulation of cholesterol loaded droplets in foam cells. Cells transform from lipid-storing into synthetic form during liver injury and repair Hepatitis/Fatty liver - hepatitis c virus core protein is associated with lipid droplets Mutation in lipid droplet-associated protein CGI-58 causes lipid storage disease Dorfman-Chanarin syndrome 4
5 What are Lipid Droplets? Lipid droplets, general principles Excess of lipids uptake, synthesis, breakdown membranes Lipid modifying enzymes Phospholipid monolayer Free fatty acid Free cholesterol Retinol TAG Cholesterol-ester Retinyl-ester Decreased usage or export 5
6 Lipid droplets, general principles Structural proteins Phospholipid monolayer Free fatty acid Free cholesterol Retinoic acid TAG Cholesterol-ester Retinyl-ester Lipid modifying enzymes Structural lipid droplet proteins: PAT domain proteins in mammalian cells: -Perilipin (adipocytes) -Adipophilin / ADRP -TIP47 -S3-12 -Oleosins(plant) - Hepatitis C core protein (oleosin-like domain) 6
7 Structural lipid droplet proteins adipocyt Wolins et al (2006) FEBS Lett 7
8 Lipid Droplets and Lipid Metabolism D.A. Brown, Current Biol Structural lipid droplet proteins are also involved in the degradation of lipid droplets. AR(1) AR(3) TNF AR(2) TNF i q i AC PLC IP3 ERK 1,2 AR(1,2) DAG s PKC TNF Ca ++ ER Ca ++ camp 5 AMP TNF TNF PDE3b mrna Nucleus ERK 1,2 PKA PDE-3B Ca 2+ 5 AMPK ALBP HSL HSL ATGL Perilipins PKB P PDK1,2 PI3K p110 p85 IRS1 Insulin NEFA + Glycerol FABP + NEFA Perilipins TAG ERK 1,2 TNF 8
9 Release of Free Fatty Acids (FFA) from adipocyte lipid droplets Perilipin KO mice show 10x elevated lipolysis reaction and are resistant to high fat diet Londos et al, 2005 Biochemie Many cells have lipid droplets Lipid droplets as dynamic organelles? 9
10 Proteomics Analysis of Lipid Droplets LDs: more than just storage organelles Liu et al (2004) JBC 10
11 Lipid droplets, more than just fat storage organelles. Structural proteins Phospholipid monolayer Free fatty acid Free cholesterol Retinoic acid Lipid modifying enzymes TAG Cholesterol-ester Retinyl-ester Signaling molecules Trafficking - distribution or uptake of lipids Regulation of lipid modifying enzymes/ structural proteins Formation/budding lipid droplets How do Lipid Droplets form? 11
12 Overexpression of Rab18 induces lipid droplet - ER contact sites Control Rab18 S. Ozeki et al (2005) JCS "Classical" model Martin & PArton (2006) Nat. Rev Mol Cell Biol 12
13 Brown (2001)Cur biol Lipid Droplet Formation: 'Budding model' Wolins et al (2006) FEBS Lett 13
14 "Classical" model Lens-like structure Martin & PArton (2006) Nat. Rev Mol Cell Biol Alternative model: Adipophilin-enriched ER domains 14
15 Alternative model: Adipophilin-enriched ER domains Methods to study lipid droplets in vitro 15
16 A Lipid Droplet Visualization B CHO-wt CHO-mutant Nile Red Bodipy LDs Rab18 Actin DAPI - slow quenching Live cell imaging - no spectral overlap Multicolor imaging Spandl et al (2009) Traffic 16
17 Induction of LD formation Oleic Acid (18:1) CHO-K1 Bodipy α-adrp CHO-K1 24 hr oleate Bodipy α-adrp Lipidomics 4000QTRAP API QTRAP 17
18 Extracted 339 = MAG-18:1 TAG-18:1,18:1,18:1 WT CHO-K1 + Oleate DAG-18:1,18:1 TAG-16:1,18:1,18:1 TAG-18:0,18:1,22:5 TAG-18:1,18:1,18:2 TAG-18:1,18:1,22:5 TAG-18:1,18:1,22:6 TAG-16:0,18:1,18:1 TAG- 18:1,18:1,20:1 TAG- 18:0,18:1,18:1 TAG 16:0, 18:0,18:1 WT CHO-K1 + Oleate contains 18-1 Cholesterol -esters 18
19 Lipid droplets, more than just fat storage organelles. Structural proteins Phospholipid monolayer Free fatty acid Free cholesterol Retinoic acid Lipid modifying enzymes TAG Cholesterol-ester Retinyl-ester Signaling molecules Trafficking - distribution or uptake of lipids Regulation of lipid modifying enzymes/ structural proteins Formation/budding lipid droplets For example... Maternal Histones in Drosophila Eggs Cermelli et al (2006) Curr. Biol. 19
20 Refugee Proteins on Lipid Droplets Welte et al. (2007) Trends Cell Biol Lipid Droplets and Protein Availability Sequestration Garbage Dump Chaperone Vehicle Welte et al (2007) TICB 20
21 Function Lipid Droplets Storage FAs (prevention lipotoxicity) Energy Source ( -oxidation Fatty Acids) Cholesterol and Lipid Homeostasis Cellular Signaling Storage Place for Refugee Proteins Size and Distribution are now recognized as important factors 21
Master class Biomolecular Sciences Molecular Cell Biology.
Master class Biomolecular Sciences Molecular Cell Biology. 04-09-08: Paul van Bergen en Henegouwen. Clathrin-indep Endocytosis 11-09-08: Willem Stoorvogel. Endocytosis and MHC classii 18-09-08: X-track
More informationChapter 1 The Lipid Droplet: a Dynamic Organelle, not only Involved in the Storage and Turnover of Lipids
Chapter 1 The Lipid Droplet: a Dynamic Organelle, not only Involved in the Storage and Turnover of Lipids Sven-Olof Olofsson, Pontus Boström, Jens Lagerstedt, Linda Andersson, Martin Adiels, Jeanna Perman,
More informationIn The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
More information1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate
More informationGlucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism
Glucose Introduction to Hormonal Regulation of Fuel Metabolism Fasting level 3.5-5 mmol (1 mmol = 18 mg/dl) Postprandial 6-10 mmol Amount of glucose in circulation is dependent on: Absorption from the
More informationSteven Michael Dragos. A Thesis. presented to. The University of Guelph. In partial fulfillment of requirements. for the degree of.
Reduced SCD1 activity decreases fatty acid re-esterification and alters markers of glyceroneogenesis and lipolysis in murine white adipose tissue and 3T3-L1 adipocytes by Steven Michael Dragos A Thesis
More informationDefining the roles of FSP27 in lipid droplet formation and apoptosis
The University of Toledo The University of Toledo Digital Repository Theses and Dissertations 2010 Defining the roles of FSP27 in lipid droplet formation and apoptosis Kun Liu Medical University of Ohio
More informationLipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel
Lipid Metabolism Department of Biochemistry and Molecular Biology II Medical Center Hamburg-ppendorf 1 Lipids. visceral fat. nutritional lipids 0 1.5 3 4.5 9 h. serum lipids. lipid accumulation in the
More informationHypothalamic Autophagy and Regulation of Energy Balance
Hypothalamic Autophagy and Regulation of Energy Balance Rajat Singh, MD Albert Einstein College of Medicine New York NuGOweek 211 Sept 6-9, 211 Autophagy Evolutionarily conserved cellular recycling program
More informationLipodystrophy: Metabolic and Clinical Aspects. Resource Room Slide Series
Lipodystrophy: Metabolic and Clinical Aspects Resource Room Slide Series Cellular Pathology of Insulin Resistance in Lipodystrophy Robert R. Henry, MD Professor of Medicine University of California, San
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationAMPK. Tomáš Kuc era. Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze
AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kuc era Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze 2013 AMPK AMP-ACTIVATED PROTEIN KINASE present in all eukaryotic
More informationGLYCEROLIPID METABOLISM AND SIGNALING IN HEALTH AND DISEASE. Short Title: GL/FFA Cycle and Signaling. Marc Prentki and S.R.
Endocrine Reviews. First published ahead of print July 8, 2008 as doi:10.1210/er.2008-0007 GLYCEROLIPID METABOLISM AND SIGNALING IN HEALTH AND DISEASE Short Title: GL/FFA Cycle and Signaling Marc Prentki
More informationMetabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
More informationCell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
More informationFat in hearts: Uptake, storage, and turnover. Chad M Trent
Fat in hearts: Uptake, storage, and turnover Chad M Trent Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School
More informationCellular control of cholesterol. Peter Takizawa Department of Cell Biology
Cellular control of cholesterol Peter Takizawa Department of Cell Biology Brief overview of cholesterol s biological role Regulation of cholesterol synthesis Dietary and cellular uptake of cholesterol
More informationLipidne mikrodomene. funkcija
Lipidne mikrodomene funkcija 1 Cellular processes involving lipid rafts - Signal transduction - Protein and lipid trafficking and sorting - Endosome(clathrin)-independent endocytosis: - potocytosis and
More informationNASH Bench to Bedside
NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent
More informationLipoproteins Metabolism
Lipoproteins Metabolism LEARNING OBJECTIVES By the end of this Lecture, the student should be able to describe: What are Lipoproteins? Describe Lipoprotein Particles. Composition of Lipoproteins. The chemical
More informationE3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination
E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments
More informationLIPID METABOLISM
LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-
More informationFSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets
Research article Related Commentary, page 2693 FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets Naonobu Nishino, 1 Yoshikazu
More informationThe role of apolipoprotein D in lipid metabolism and metabolic syndrome
UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated
More informationOVERVIEW M ET AB OL IS M OF FR EE FA TT Y AC ID S
LIPOLYSIS LIPOLYSIS OVERVIEW CATABOLISM OF FREE FATTY ACIDS Nonesterified fatty acids Source:- (a) breakdown of TAG in adipose tissue (b) action of Lipoprotein lipase on plasma TAG Combined with Albumin
More informationThe role of lipid droplets in metabolic disease in rodents and humans
Review series The role of lipid droplets in metabolic disease in rodents and humans Andrew S. Greenberg, 1 Rosalind A. Coleman, 2 Fredric B. Kraemer, 3 James L. McManaman, 4 Martin S. Obin, 1 Vishwajeet
More informationHIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD
HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte
More informationLipid droplet biogenesis: a novel process of self-digestion as a strategy of survival to stress
Lipid droplet biogenesis: a novel process of self-digestion as a strategy of survival to stress Memoria del trabajo experimental para optar al grado de doctor, correspondiente al Programa de Doctorado
More informationSponsored document from Progress in Lipid Research. Lipolysis A highly regulated multi-enzyme complex mediates the catabolism of cellular fat stores
Sponsored document from Progress in Lipid Research Lipolysis A highly regulated multi-enzyme complex mediates the catabolism of cellular fat stores Achim Lass, Robert Zimmermann, Monika Oberer, and Rudolf
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationRegulation of adipose tissue remodeling by peripheral serotonin
Regulation of adipose tissue remodeling by peripheral serotonin Sangkyu Park Catholic Kwandong University College of Medicine Department of Biochemistry Serotonin (5-HT) is a signaling molecule Hemostasis
More informationAMPK. Tomáš Kučera.
AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kučera tomas.kucera@lfmotol.cuni.cz Department of Medical Chemistry and Clinical Biochemistry 2nd Faculty of Medicine, Charles University in Prague and Motol
More informationChapter 2. The Physiology of Fat
Chapter 2 The Physiology of Fat Obesity, generalized and localized collections of adiposity, has become endemic in the United States. It is estimated that 25-40% of US adult females and 20-25% of adult
More informationPathophysiology of Lipid Disorders
Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history
More informationMobilisation des lipides du tissu adipeux et insulinorésistance. Dominique Langin
Obesity Research Laboratory Institut Universitaire de France Franco-Czech Laboratory for Clinical Research on Obesity Mobilisation des lipides du tissu adipeux et insulinorésistance Dominique Langin Séminaire
More informationCrosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea
Crosstalk between Adiponectin and IGF-IR in breast cancer Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Obesity Chronic, multifactorial disorder Hypertrophy and hyperplasia
More informationThe Protective Effects of Exercise Against Acute Inflammatory and Metabolic Challenges
The Protective Effects of Exercise Against Acute Inflammatory and Metabolic Challenges By Laura Nicole Castellani A Thesis presented to The University of Guelph In partial fulfilment of requirements for
More informationCHM333 LECTURE 34: 11/30 12/2/09 FALL 2009 Professor Christine Hrycyna
Lipid Metabolism β-oxidation FA Acetyl-CoA Triacylglycerols (TAGs) and glycogen are the two major forms of stored energy in vertebrates Glycogen can supply ATP for muscle contraction for less than an hour
More informationWhat would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes.
What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. C. Mostly non-compact G1 chromosomes. D. Compact G1 and G2 chromosomes.
More informationBA, BSc, and MSc Degree Examinations
Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-18 Department : BIOLOGY Title of Exam: Metabolism in health and disease - open assessment Marking Scheme: Total marks
More informationBCM 221 LECTURES OJEMEKELE O.
BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX
More informationAntibodies for Unfolded Protein Response
Novus-lu-2945 Antibodies for Unfolded rotein Response Unfolded roteins ER lumen GR78 IRE-1 GR78 ERK Cytosol GR78 TRAF2 ASK1 JNK Activator Intron RIDD elf2α Degraded mrna XB1 mrna Translation XB1-S (p50)
More informationAbstract. Regulation of Lipolysis By Perilipin: Influence of Obesity and Exercise Training. By: Emily Ann Johnson. June 2010
Abstract Regulation of Lipolysis By Perilipin: Influence of Obesity and Exercise Training By: Emily Ann Johnson June 2010 Director: Robert C. Hickner Department of Exercise and Sport Science Obesity is
More informationThe Perilipin Family of Structural Lipid Droplet Proteins: Stabilization of Lipid Droplets and Control of Lipolysis. Dawn L.
The Perilipin Family of Structural Lipid Droplet Proteins: Stabilization of Lipid Droplets and Control of Lipolysis Dawn L. Brasaemle Department of Nutritional Sciences and the Rutgers Center for Lipid
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism I. Chylomicrons (exogenous pathway) A. 83% triacylglycerol, 2% protein, 8% cholesterol plus cholesterol esters, 7% phospholipid (esp. phosphatidylcholine)
More information3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
More informationPlasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam
Biochemistry Department Plasma lipoproteins & atherosclerosis by Prof.Dr. Maha M. Sallam 1 1. Recognize structures,types and role of lipoproteins in blood (Chylomicrons, VLDL, LDL and HDL). 2. Explain
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationIntestinal cytoplasmic lipid droplets, associated proteins, and the regulation of dietary fat absorption
Purdue University Purdue e-pubs Open Access Dissertations Theses and Dissertations 8-2016 Intestinal cytoplasmic lipid droplets, associated proteins, and the regulation of dietary fat absorption Theresa
More informationNiacin Metabolism: Effects on Cholesterol
Niacin Metabolism: Effects on Cholesterol By Julianne R. Edwards For Dr. William R. Proulx, PhD, RD Associate Professor of Nutrition and Dietetics In partial fulfillments for the requirements of NUTR342
More informationthematic review Adipose triglyceride lipase and the lipolytic catabolism of cellular fat stores
thematic review Adipose triglyceride lipase and the lipolytic catabolism of cellular fat stores Rudolf Zechner, 1 Petra C. Kienesberger, Guenter Haemmerle, Robert Zimmermann, and Achim Lass Institute of
More informationPropagation of the Signal
OpenStax-CNX module: m44452 1 Propagation of the Signal OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
More informationDOWNLOAD PDF ADIPOSE TISSUE AND ADIPOKINES IN HEALTH AND DISEASE (NUTRITION AND HEALTH)
Chapter 1 : Adiposity, Adipokines, and Adiposopathy - Sick Fat Explained Adipose Tissue and Adipokines in Health and Disease, Second Edition is a useful resource for physicians interested in adipose tissue
More informationSupplementary Figure S1
Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao
More informationANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity
ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity I. Stearoyl coenzyme A desaturase and obesity in rodents A. Stearoyl coenzyme A desaturase (SCD) is the 9 desaturase.
More informationPROTEIN-PROTEIN INTERACTIONS AND THE CHARACTERIZATION OF ADIPOCYTE FATTY ACID BINDING PROTEIN
PROTEIN-PROTEIN INTERACTIONS AND THE CHARACTERIZATION OF ADIPOCYTE FATTY ACID BINDING PROTEIN A DISSERTATION SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY OF MINNESOTA BY Brian Raymond
More informationGene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
More informationHormones and Target Tissues
Hormones and Target Tissues The hypothalamus is the coordination center of the endocrine system Hypothalamus is a small region of the forebrain in animals with skulls It receives and integrates nerve signals
More informationImportance of TNFa and neutral lipases in human adipose tissue lipolysis
Review TRENDS in Endocrinology and Metabolism Vol.17 No.8 Importance of TNFa and neutral lipases in human adipose tissue lipolysis Dominique Langin 1,2,3,4 and Peter Arner 5 1 Inserm, U586, Unité de Recherches
More information* Author to whom correspondence should be addressed; Tel.: ; Fax:
Int. J. Mol. Sci. 2014, 15, 6184-6223; doi:10.3390/ijms15046184 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Obesity and Its Metabolic Complications:
More informationFGF21 Resistance in Adipose Tissues as a Cause of Insulin Resistance
Resistance in Adipose Tissues as a Cause of Insulin Resistance The ICDM 213 & 5 th AASD Scientific Meeting Seoul, Korea, Nov 8, 213 Aimin Xu Dept of Medicine & Dept of Pharmacology and Pharmacy The University
More informationLipids digestion and absorption, Biochemistry II
Lipids digestion and absorption, blood plasma lipids, lipoproteins Biochemistry II Lecture 1 2008 (J.S.) Triacylglycerols (as well as free fatty acids and both free and esterified cholesterol) are very
More informationSummary and concluding remarks
Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated
More informationFaculty of Applied Health Science Brock University St Catharines, Ontario, Canada
Changes in mitochondrial PLIN3 and PLIN5 protein content in rat skeletal muscle following acute contraction and endurance training Sofhia V. Ramos Submitted in partial fulfillment of the requirements for
More informationSupporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
More information1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8
Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory
More informationAdipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University
Adipose Tissue as an Endocrine Organ Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Functions of Adipose Tissue Adipose tissue expresses and secretes a variety of bioactive peptides,
More informationLecture 9: Cell Communication I
02.05.10 Lecture 9: Cell Communication I Multicellular organisms need to coordinate cellular functions in different tissues Cell-to-cell communication is also used by single celled organisms to signal
More informationPPAR history of research
PPAR Rubens, 1640 PPAR history of research number of publications 3000 2000 1000 0 till now: : 16 296 publications 1985 1990 1995 2000 2005 year liver, brown adipocytes, kidney, heart, skeletal muscles,
More informationTHE EFFECTS OF ENDOTHELIN-1 IN HUMAN ADIPOSE TISSUE
Thesis for licentiate degree 2010 Thesis for licentiate degree 2010 THE EFFECTS OF ENDOTHELIN-1 IN HUMAN ADIPOSE TISSUE THE EFFECTS OF ENDOTHELIN-1 IN HUMAN ADIPOSE TISSUE Anna Eriksson Anna Eriksson From
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationChapter 15: Signal transduction
Chapter 15: Signal transduction Know the terminology: Enzyme-linked receptor, G-protein linked receptor, nuclear hormone receptor, G-protein, adaptor protein, scaffolding protein, SH2 domain, MAPK, Ras,
More informationReviewer #1 (Remarks to the Author)
Reviewer #1 (Remarks to the Author) The authors provide an interesting data set concerning the effects of an ATGL inhibitor on energy balance and indices of insulin action in mice fed a high fat diet.
More informationAN OVERVIEW OF FATTY ACID ETHYL ESTERS
AN OVERVIEW OF FATTY ACID ETHYL ESTERS Michael Laposata, M.D., Ph.D. Director of Clinical Laboratories Massachusetts General Hospital Professor, Harvard Medical School OUTLINE OF PRESENTATION Background
More informationReceptors Functions and Signal Transduction- L4- L5
Receptors Functions and Signal Transduction- L4- L5 Faisal I. Mohammed, MD, PhD University of Jordan 1 PKC Phosphorylates many substrates, can activate kinase pathway, gene regulation PLC- signaling pathway
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationCan physical exercise and exercise mimetics improve metabolic health in humans?
Can physical exercise and exercise mimetics improve metabolic health in humans? Patrick Schrauwen, PhD NUTRIM school for Nutrition and Translational Research in Metabolism Department of Human Biology,
More informationCompanion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the
More informationEffects of immunosuppressive drugs on human adipose tissue metabolism
Effects of immunosuppressive drugs on human adipose tissue metabolism Maria João Pereira UNIVERSITY OF GOTHENBURG The Lundberg Laboratory for Diabetes Research Department of Molecular and Clinical Medicine
More informationUp-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice
Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice Shen Yon Toh 1,2,3., Jingyi Gong 2., Guoli Du 2., John
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationIL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA
UNIGASTRO Il fegato come centrale metabolica e i fattori di danno oltre ai virus epatitici IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA Dr Elisabetta Bugianesi Divisione di Gastro-Epatologia
More informationChapter 9: Biochemical Mechanisms for Information Storage at the Cellular Level. From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D.
Chapter 9: Biochemical Mechanisms for Information Storage at the Cellular Level From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D. Chapter 9: Dendritic Spine Figure 1 Summary: Three Primary
More informationA Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationEnergy metabolism - the overview
Energy metabolism - the overview Josef Fontana EC - 40 Overview of the lecture Important terms of the energy metabolism The overview of the energy metabolism The main pathways of the energy metabolism
More informationClose to site of release (at synapse); binds to receptors in
Chapter 18: The Endocrine System Chemical Messengers 1. Neural 2. Endocrine 3. Neuroendocrine 4. Paracrine 5. Autocrine Endocrine System --Endocrine and nervous systems work together --Endocrine vs. Nervous
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 Fatty acid oxidation is emphasized in 1 macrophages compared with that in macrophages. Gene expression of mitochondrial OXPHOS (Atp5j, Cox4i1, Uqcrc1/2, Ndufs1, Sdhb) and β-oxidation
More informationUniversity of Alberta
University of Alberta Role of Triacylglycerol Hydrolase in Hepatic Lipid Droplet Metabolism by Huajin Wang A thesis submitted to the Faculty of Graduate Studies and Research in partial fulfillment of the
More informationthematic review series
thematic review series Thematic Review Series: Lipotoxicity: Many Roads to Cell Dysfunction and Cell Death Lipid signaling and lipotoxicity in metaflammation: indications for metabolic disease pathogenesis
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationAbout OMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationReceptor mediated Signal Transduction
Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third
More informationEctopic lipid storage and insulin resistance: a harmful relationship
Review doi: 10.1111/joim.12071 Ectopic lipid storage and insulin resistance: a harmful relationship J. Boren 1, M.-R. Taskinen 2, S.-O. Olofsson 1, * & M. Levin 1 From the 1 Department of Molecular and
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More information