Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT Fas GGGTTCTAGCCAGCAGAGTC TCAGCCACTTGAGTGTCCTC Scd1 CCGGAGACCCCTTAGATCGA TAGCCTGTAAAAGATTTCTGCAAA Stat 3 ACCTCTACCCCGACATTCCCA AACTTGGTCTTCAGGTACGGGG Acc-2 TGTCCCAGGAGGCTGCATTGA TGTGCAGGTCCAGTTTCTTGTGT Acc-1 TAATGGGCTGCTTCTGTGACTC CTCAATATCGCCATCAGTCTTG Perilipin2 TGCTGCACGTGGAGAGTAAGGATG AGCAGGGTTGGGCCCTTGTTC Pparγ1 ACGTTCTGACAGGACTGTGTGAC CTGTGTCAACCATGGTAATTTCAGT Pparγ2 ATGGTGCCTTCGCTGATGCACT TGGCATCTCTGTGTCAACCATGG Pgc1α CCCAGAGTCACCAAATGACCCCA TGAGGAGGAGTTGTGGGAGGAGT Pdk4 GTCGAGCTGTTCTCCCGCTACA CTTGCCGCAGAAAAGCAAAGGA Ucp3 GCAGGTACCGCAGCCCTCTG CGTTCCAAGCTCCCAGACGCA Pparα TGGCACTCGGCATGTCGCAC GGTTGTGCTGGGACCCCTCG Ucp1 CCCAAGCGTACCAAGCTGTGC GTTCCAGGACCCGAGTCGCA LPL TTTGGCTCCAGAGTTTGACC TGTGTCTTCAGGGGTCCTTAG Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Chol (mmol/l) 2.93 ± 0.22 4.10 ± 0.35 * 2.28 ± 0.31 3.46 ± 0.20 HDL (mmol/l) 0.87 ± 0.05 1.18 ± 0.04 * 0.80 ± 0.13 1.08 ± 0.06 LDL (mmol/l) 0.22 ± 0.03 0.26 ± 0.06 0.16 ± 0.03 0.27 ± 0.01 TG (mmol/l) 1.22 ± 0.1 1.50 ± 0.10 1.21 ± 0.13 1.23 ± 0.06 FFA (mmol/l) 1.73 ± 0.18 1.91 ± 0.16 1.66 ± 0.26 1.98 ± 0.44 Plasma circulating levels of cholesterol (Chol), High density lipoprotein (HDL), Low density lipoprotein (LDL), triglycerides (TG) and free fatty acids (FFA) in intact female mice fed with a HFD for 12 weeks. One-way ANOVA statistical analysis: *P<0.05, ** P<0.01, *** P<0.001 for ERα -/-, ERαAF-1 0 or ERαAF-2 0 versus wt mice.
Supplementary Table 3. Plasma lipid profiles in HFD-fed female mice treated or not with E2 wt ERα -/- AF-1 0 AF-2 0 OVX OVX+E2 OVX OVX+E2 OVX OVX+E2 OVX OVX+E2 Chol (mmol/l) 3.46 ± 0.21 3.02 ± 0.17 3.85 ± 0.26 4.17 ± 0.11 3.53 ± 0.18 3.33 ± 0.15 3.46 ± 0.20 2.76 ± 0.06 HDL (mmol/l) 1.10 ± 0.06 0.92 ± 0.06 1.22 ± 0.06 1.26 ± 0.11 1.04 ± 0.03 0.95 ± 0.06 1.10 ± 0.03 0.94 ± 0.02 LDL (mmol/l) 0.30 ± 0.03 0.26 ± 0.03 0.39 ± 0.04 0.40 ± 0.04 0.27 ± 0.02 0.27 ± 0.04 0.26 ± 0.01 0.23 ± 0.01 TG (mmol/l) 1.3 ± 0.06 1.29 ± 0.1 1.22 ± 0.1 1.32 ± 0.07 1.55 ± 0.07 1.40 ± 0.04 1.27 ± 0.1 1.11 ± 0.09 FFA (mmol/l) 2.1 ± 0.17 2.30 ± 0.22 2.34 ± 0.19 2.23 ± 0.32 1.79 ± 0.1 1.90 ± 0.08 1.78 ± 0.22 1.89 ± 0.1 Plasma circulating levels of cholesterol (Chol), High density lipoprotein (HDL), Low density lipoprotein (LDL), triglycerides (TG) and free fatty acids (FFA) in placebo- and E2-treated ovariectomized female mice fed with a HFD for 12 weeks. Student T-test statistical analysis: *P<0.05, ** P<0.01, *** P<0.001 for E2-treated versus placebo-treated mice. Supplementary Figure 1. Generation and validation of ERα /, ERαAF-1 0 and ERαAF-2 0 mutant mice. (A) Schematic representation of ERα gene (Esr1) and protein structures in wild type (wt) and mutant mice. (B) ERα protein expression level assessed by Western blot analysis in perigonadic adipose tissue and in the uterus. Immunoblotting analyses were performed as previously described (references 12, 15 and 16 in the main document).
Supplementary Figure 2. Food intake and adipocyte size variability in normal chow-fed wild type and mutant mice. (A) Daily food intake. (B) Adipocyte size distribution (µm²) in perigonadic deposits. (C) Individual adipocyte size variability (expressed as mean of individual standard deviation values in each group). One-way ANOVA statistical analysis: *P<0.05, ** P<0.01, *** P<0.001 for ERα -/-, ERαAF-1 0 or ERαAF-2 0 versus wt mice.
Supplementary Figure 3. Adipocyte size variability in HFD-fed wild type and mutant female mice. (A) Adipocyte size distribution (µm²) in perigonadic deposits. (B) Individual adipocyte size variability (expressed as mean of individual standard deviation values in each group). One-way ANOVA statistical analysis: *P<0.05, ** P<0.01, *** P<0.001 for ERα -/-, ERαAF-1 0 or ERαAF-2 0 versus wt mice.
Supplementary Figure 4. Influence of E2 on food intake and uterine weight in HFD-fed ovariectomized female mice. (A) Daily food intake. (B) Wet uterus weight at sacrifice in HFD-fed wt, ERα -/-, ERαAF-1 0 and ERαAF-2 0 ovariectomized mice treated with E2 (ovx+e2) or placebo (ovx). Data are means ± SEM (n= 5-6 per group). Student T-test statistical analysis: *P<0.05, ** P<0.01, *** P<0.001 for E2-treated versus placebo treated mice.
Supplementary Figure 5. Influence of E2 on VO 2, VCO 2 and energy expenditure in HFD-fed ovariectomized female mice. (A) VO 2 measured in metabolic chambers during day (light) and night (dark) periods. (B) VCO 2 measured in metabolic chambers during day (light) and night (dark) periods. (C) Energy expenditure during day (light) and night (dark) periods. Data are means ±SEM (n= 5-6 per group). Two-way ANOVA statistical analysis: *P<0.05, ** P<0.01, *** P<0.001.
Supplementary Figure 6. Regulation of metabolic gene expression by estradiol in skeletal muscles and brown adipose tissue. Four week-old wild type (wt), ERα -/-, ERαAF-1 0 and ERαAF-2 0 female mice were ovariectomized and received either 17β-estradiol (ovx+e2) or placebo (ovx) subcutaneous administration for a 3 months period and were concomitantly fed with a HFD. Quantification of mrna levels (relative to Hprt) expressed in terms of fold change relative to wt ovx mice, from selected metabolic genes in skeletal muscles (VL) (A) and in brown adipose tissue (BAT) (B). Data are means ± SEM (n= 4-6 animal per group). Student T-test statistical analysis: *P<0.05, ** P<0.01, *** P<0.001 for E2-treated versus placebo-treated mice.