SUPPLEMENTARY FIGURES

Similar documents
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)

Supplementary Figure 1

Supplementary Figure 1

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

Quantitative Real-Time PCR was performed as same as Materials and Methods.

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.

Single administration of recombinant IL-6 restores the gene expression of lipogenic enzymes in liver of fasting IL-6-deficient mice

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

SUPPLEMENTARY INFORMATION

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Supplementary Information

Supplemental Table 1. List of primers used for real time PCR.

Supplementary Figure S1

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

Supplementary Information

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Effect of BI-1 on insulin resistance through regulation of CYP2E1

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin

Supporting Information

Supplementary Figure 1

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

SUPPLEMENTARY INFORMATION

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

Supplementary Figures

Supplementary Materials for

BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information)

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

SUPPLEMENTARY INFORMATION

A. One to three months of age. Anterior Lens (Mean ± SEM) Posterior Lens (Mean ± SEM) Mid Lens (Mean ± SEM) Cornea (Mean ± SEM) Genotype

Fig. S1. High K+ increases intracellular calcium level.

SUPPLEMENTARY INFORMATION

Supplementary Information Titles Journal: Nature Medicine

Supplementary Materials for

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Supplemental Figure 1. Vasoconstrictor responses of renal interlobular arteries to ATP. Responses of interlobular renal arterioles to ATP were

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

Supplementary Figure 1

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Materials

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplementary Materials for

Supplementary Information

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

Supplementary Figure 1

Supplemental Information. Regulatory T Cells Promote Macrophage. Efferocytosis during Inflammation Resolution

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)

Nature Medicine: doi: /nm.4078

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Supplementary Table 1. List of primers used in this study

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

TRPM8 in the negative regulation of TNFα expression during cold stress

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

Figure 6: TERT regulates MYC half-life and ubiquitination.

ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity

Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

Supplementary Figure 1

SUPPLEMENTARY INFORMATION

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

SUPPLEMENTARY INFORMATION

Supplementary methods:

SUPPLEMENTARY INFORMATION

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity

Genotype analysis by Southern blots of nine independent recombinated ES cell clones by

Identified proteins interacting with TMBIM1 by mass spectrometry

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Pyruvate Alanine 0.15 *** ** ***

NMED-A65251A. Supplementary Figures.

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

Transcription:

SUPPLEMENTARY FIGURES Figure S1. Effect of a HFD on the Acox gene expression in the livers of WT and IL-6 -/- mice. Expression of Acox in the livers of WT and IL-6 -/- mice fed STD or HFD determined through qpcr analysis. The Graph represents CNRQ means ± SEM (n=4 animals per group) and gene expression was normalized using Biogazelle s qbase PLUS software with Gapdh and Gusβ as reference genes. Comparisons between groups were analyzed using two-way ANOVA analysis and Bonferroni post-hoc tests. The analysis revealed no significant effect of diet or genotype and no interaction between both factors.

Figure S2. Effect of IL-6 replacement on the Socs3 gene expression in the livers of IL-6 -/- mice fed HFD. Expression of Socs3 in the livers of WT and IL-6 -/- mice fed STD or HFD. The Socs3 expression in IL-6 -/- mice fed HFD and chronically treated with ril-6 is also depicted. The gene expression was determined through qpcr analysis and normalized using Biogazelle s qbase PLUS software with Gapdh and Gusβ as reference genes. The columns represent CNRQ means ± SEM (n=4 animals per group) and comparisons between two groups were analyzed using Student s t test. *P<0.05, and **P<0.01 denote significant differences compared with the WT mice STD-fed group. ### P<0.001 denotes significant differences between IL-6 -/- mice fed HFD and HFD + ril-6 treated groups.

Figure S3. Effect of ril-6 treatment on the hepatic CPT1 protein expression in IL-6 -/- mice fed HFD. Western blot analysis of the CPT1 protein expression in liver samples from WT and IL-6 -/- mice fed STD or HFD. Representative blot of protein from two samples per group is shown in the upper panel. The corresponding expression of Adaptin is also shown as a loading control per lane. The histogram depicts the means ± SEM (n=4 animals per group) of CPT1/Adaptin densitometric values. Analysis by Student s t test showed no significant differences between groups.

Figure S4. Ability of recombinant human IL-6 to induce expression of lipogenic enzymes in HepG2 cells. (A) Western blot of STAT3 and p-stat3 expression after 1 h of rhil-6 exposure in HepG2 cells compared with untreated sample (control). The corresponding expression of Actin is shown as a loading control per lane. (B) The histogram represents the expression of human Acaca, Acacb, Fasn and Scd1 genes in the HepG2 cells untreated (control) or treated with hril-6 for 6 h. The gene expression was determined through qpcr analysis and was normalized using Biogazelle s qbase PLUS software with Gapdh and Gusβ as reference genes. The columns represent CNRQ means ± SEM (n=3 samples per group). Comparisons between control and hril-6 treated samples were analyzed using Student s t test. *P<0.05 denotes significant differences between hril-6-treated samples and the corresponding control.

Figure S5. expression of TNFα and IL-6 in the livers of WT and IL-6 -/- mice fed HFD. (A) Hepatic TNFα gene expression in WT and IL-6 -/- mice fed STD and HFD. The effect of IL-6 replacement on TNFα expression in IL-6 -/- mice fed HFD group is also shown. The TNFα expression was determined through qpcr analysis and was normalized using Biogazelle s qbase PLUS software with Gapdh and Gusβ as reference genes. The columns represent CNRQ means ± SEM (n=4 animals per group) and significance of differences between groups HFD fed and the corresponding goups STD fed was analyzed by Student s t test. *P<0.05, and ***P<0.001 denote significant differences compared with the IL-6 -/- mice STD-fed group. (B) Endogenous expression of the IL-6 gene in liver samples from STD and HFD fed WT mice, determined through qpcr analysis as indicated in panel A. Student s t test analysis showed significant differences (*P<0.05) between STD-fed and HFD-fed groups.

Figure S6. Hepatic CT-1 and IL-6R/gp130 gene expression in WT and IL-6 -/- mice fed HFD. Analysis by qpcr for CT-1 (A), IL-6R (B) and gp130 (C) gene expression in livers of WT and IL-6 -/- mice fed STD and HFD. Analysis of the effect of IL-6 replacement on the

hepatic expression of each gene in IL-6 -/- mice fed HFD is also shown in the corresponding histogram. The gene expression was normalized by means of Biogazelle s qbase PLUS software using Gapdh and Gusβ as reference genes. The columns represent CNRQ means ± SEM (n=4 animals per group) and comparisons between two groups were analyzed by Student s t test. *P<0.05, and **P<0.001 denote significant differences compared with the WT mice STD-fed group.

Table S1. Effect of genotype and diet on serum lipid parameters WT IL-6 -/- STD HFD STD HFD Cholesterol (mg/dl) 86.25 ± 3.84 129.00 ± 7.65*** 99.00 ± 7.65 209.00 ± 17.01***, ### HDL (mg/dl) 21.00 ± 2.45 24.00 ± 2.12 22.00 ± 1.22 19.00 ± 3.24 Triglyceride (mg/dl) 60.00 ± 6.30 45.00 ±13.25 131.00 ± 28.25 &&& 77.00 ± 8.03 ***,# Data represent means ± SEM (n=4 animals per group) ***P<0.001; significant difference compared to the corresponding STD-fed group. &&& P<0.001; significant difference between both STD-fed groups. # P<0.05; ### P<0.00; significant difference between both HFD-fed groups.

Table 2S. Mouse primer sequences used for qpcr Symbol ID Primer sequence 5' to 3' Bank AN* Amplicon length Acaca 107476 Fw GCGTCGGGTAGATCCAGTT Re CTCAGTGGGGCTTAGCTCTG NM_133360.2 70 Acacb 100705 Fw TGAATCTCACGCGCCTACTA Re GCCTCTCTTCACCAGATGGA NM_133904.2 61 Fasn 14104 Fw GCTGCTGTTGGAAGTCAGC Re AGTGTTCGTTCCTCGGAGTG NM_007988.3 76 Scd1 20249 Fw TTCCCTCCTGCAAGCTCTAC Re CAGAGCGCTGGTCATGTAGT NM_009127.4 62 Tnfa 21926 Fw TCTTCTCATTCCTGCTTGTGG Re GGTCTGGGCCATAGAACTGA NM_013693 128 CT-1 13019 Fw GCCTCCGACTCCCAATTT Re CATGAGACAAAGTAAGGGTTACACA NM_007795.1 75 Gapdh 14433 Fw CGTCCCGTAGACAAAATGGT Re TCAATGAAGGGGTCGTTGAT NM_008084 125 Gusβ 110006 Fw CTCTGGTGGCCTTACCTGAT Re CAGTTGTTGTCACCTTCACCTC NM_010368.1 73 Mouse primer sequences used for TaqMan Expression Assays (Applied Biosystems) Symbol ID Assay ID Bank AN* Amplicon length IL-11 16156 Mm00434162_m1 NM_008350.4 130 OSM 18413 Mm1193966_m1 NM_001013365 82 IL-6 16193 Mm00446190_m1 NM_031168.1 78 Gapdh 14433 Mm99999915_g1 NM_008084 107 Gusβ 110006 Mm01197698_m1 NM_010368.1 71 * Accession number Fw=Forward Rev=Reverse

Table S3. Human primer sequences used for qpcr Symbol ID Primer sequence 5' to 3' Bank AN* Amplicon length Acaca 31 Fw TGCCGGCCAGTGCTATGCTG Re TGCTCCAGGTCGCTTGACGT NM_198834.1 60 Acacb 32 Fw AGCGGGCCATCCGGTTTGTT Re TGCTCCAGGTCGCTTGACGT NM_001093.3 63 Fasn 2194 Fw CAGGCACACACGATGGAC Re CGGAGTGAATCTGGGTTGAT NM_004104.4 92 Scd1 6319 Gusβ 2990 Rpl19 6143 * Accession number Fw=Forward Rev=Reverse Fw CCTACCTGCAAGTTCTACACCTG NM_005063 Re GACGATGAGCTCCTGCTGTT 85 Fw CGCCCTGCCTATCTGTATTC Re TCCCCACAGGGAGTGTGTAG NM_000181.3 91 Fw GCTCTTTCCTTTCGCTGCT Re CATTGGTCTCATTGGGGTCT NM_000981.3 122

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback