SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of

Similar documents
Appendix. Table of Contents

SUPPLEMENTAL FIGURE LEGENDS

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

Supplementary Information

Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

T H E J O U R N A L O F C E L L B I O L O G Y

Supplementary Figure S1 Supplementary Figure S2

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

SUPPLEMENT. Materials and methods

Supplemental Information

Supplementary Materials

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

T H E J O U R N A L O F C E L L B I O L O G Y

Protocol for Gene Transfection & Western Blotting

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

Live cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for

Plasma exposure levels from individual mice 4 hours post IP administration at the

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Supplemental Material:

Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

SUPPLEMENTARY INFORMATION

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

The Schedule and the Manual of Basic Techniques for Cell Culture

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3

Inhibition of hepatocyte apob secretion by naringenin: enhanced rapid intracellular degradation independent of reduced microsomal cholesteryl esters

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.

Apolipoprotein B-containing lipoprotein assembly in microsomal triglyceride transfer protein-deficient McA-RH7777 cells

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

RayBio KinaseSTAR TM Akt Activity Assay Kit

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.

Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent

A. List of selected proteins with high SILAC (H/L) ratios identified in mass

SUPPLEMENTARY INFORMATION

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Cell Lysis Buffer. Catalog number: AR0103

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 Related Products..

Supplementary Figure 1

Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

Supplementary Information

Legends for Supplemental Figures.

Supporting Information Table of content

Supporting Information

SUPPLEMENTARY INFORMATION

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Sterol-induced degradation of HMG CoA reductase depends on interplay of two Insigs and two ubiquitin ligases, gp78 and Trc8

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

CAN Resubmission SUPPLEMENTAL INFORMATION

Supplementary Materials for

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

Supplementary Information for. Inhibitors of Hedgehog Acyltransferase Block Sonic Hedgehog Signaling. Marilyn D. Resh 1,2,6*

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death

Recruitment of HBO1 Histone Acetylase and Blocks

Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42

supplementary information

2.5. AMPK activity

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A)

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

supplementary information

Supporting Information

Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen

CAN Resubmission SUPPLEMENTAL INFORMATION

ab Membrane Fractionation Kit Instructions for Use For the rapid and simple separation of membrane, cytosolic and nuclear cellular fractions.

Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with

Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs

Supplementary Materials for

Tel: ; Fax: ;

Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document

Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Peli1 negatively regulates T-cell activation and prevents autoimmunity

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

Boucher et al NCOMMS B

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of

SUPPLEMENTARY INFORMATION

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation

SUPPLEMENTARY INFORMATION

Transcription:

SUPPLEMENTAL MATERIALS AND METHODS Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of cysteine and methionine and then treated with 10 μm puromycin in depletion medium for 10 minutes at 37ºC. Cells were washed in depletion medium three times on ice (30 minutes total) to completely remove the puromycin and then incubated in [ 35 S]cysteine/methionine containing media (with or without 25 μm MG132) for 5 minutes at 37ºC. Following the pulse, the medium was removed and chase medium (also with or without MG132) was added and cells were harvested at 5 minute intervals up to 20 minutes. Cell lysis and analysis of apob-100 was performed as described in Materials and Methods. Immunoblot Analysis - Cells were treated for 16 h with U0126 or transfected with NT or sigp78 and harvested by lysis in 1% SDS 72 hours post-transfection. Total cell lysates were resolved by SDS-PAGE in 10% (w/v) polyacrylamide gels and the indicated proteins were visualized by immunoblotting. Primary antibodies to diacylglycerol acyltransferase 1 (DGAT1) (H-255, Santa Cruz Biotechnology, Santa Cruz, CA), microsomal triglyceride transfer protein (MTP)(Novus Biologicals, Littleton, CO), hydroxymethylglutaryl coenzyme A reductase (HMGCoAR)(Upstate Cell Signalling Solutions, Lake Placid, NY), sterol regulatory element binding protein 1a (SREBP1a)(Chemicon, Temecula, CA), peroxisome proliferator activated receptor (PPAR (Chemicon), peroxisome proliferator activated receptor (PPAR (Santa Cruz Biotechnology), ERK1/2 (#9102; Cell Signaling Technology, Danvers, MA) and Phospho- ERK1/2 (#9101; Cell Signaling Technology, Danvers, MA) were incubated overnight and secondary antibodies and chemiluminescence were performed as described in Materials and Methods. 1

Trypsin digestion in radiolabelled cells Transfected HepG2 cells were depleted of cysteine and methionine and then incubated in [ 35 S]cysteine/methionine containing media for one hour. The cells were then permeabilized with digitonin and trypsin digestion was performed as described in Materials and Methods. ApoB and apoai were then collected by immunoprecipitation, visualized by SDS-PAGE with autoradiography and quantified by liquid scintillation counting. SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Gp78 knockdown reduces the cellular accumulation of nascent apob-100 in puromycin-synchronized HepG2 cells. Seventy-two hours following transfection with either NT or gp78-targeting sirna, HepG2 cells were treated with 10 μm puromycin for 5 minutes and then washed for 3 x 10 minutes on ice. Cells were immediately pulse-labeled for 5 minutes at 37ºC in medium containing [ 35 S]cysteine/methionine and then chased for up to 20 minutes. Where indicated, 25 μm MG132 was included in the pulse and chase medium. ApoB was recovered from the cells by immunoprecipitation and visualized by autoradiography. Supplemental Figure 2. Gp78 sirna does not alter levels of proteins involved in lipid metabolism. Cells were transfected with NT or and harvested by lysis 72 hours posttransfection. Total cell lysates were resolved by SDS-PAGE and the indicated proteins were visualized by immunoblotting. 2

Supplemental Figure 3. Reduced gp78 expression protects radiolabelled apob-100 from trypsin digestion in digitonin-permeabilized HepG2 cells. A. Cells were transfected with either non-targeting (NT) or gp78-targeting sirna. Seventy-two hours post-transfection the cells were labelled with [ 35 S]cysteine/methionine for 1 hour. Cells were then permeabilized with digitonin and the supernatant was discarded. The remaining monolayers were then treated with trypsin at the indicated concentration for 30 minutes on ice. Soybean trypsin inhibitor was then added and the monolayers were collected. ApoB-100 and apoai were recovered from cells by immunoprecipitation and visualized by autoradiography. B. ApoB-100 and apoai bands were excised and quantified by liquid scintillation counting. The ratio of apob-100 to apoai is expressed as percent of 0 µg/ml trypsin control (NT and ) to demonstrate the relative level of digestion. Supplemental Figure 4. U0126 does not affect global ubiquitination during MG132 treatment and does not affect phospho-erk. A. Cells were pre-treated for 16 hours with either DMSO or 10 μm U0126. Cells were incubated for one hour with 360 μm oleic acid prior to the 25 μm MG132 treatment. From total cell lysates, 6% input was loaded per lane for the total ubiquitin blot (upper left panel) and 2% input was loaded for the actin blot (lower left panel). ApoB immunoprecipitates (right panel) were performed on total cell lysates with a polyclonal anti-apob and the elutions analyzed by Western blot with anti-ubiquitin antibody. B. Cells were harvested 72 hours post-transfection or after 16 h incubation with 10 μm U0126. Total cell lysates were resolved by SDS-PAGE and total ERK and phospho-erk were visualized by immunoblot analysis. 3

NT - MG132 + MG132 - MG132 + MG132 0 5 10 20 0 5 10 20 0 5 10 20 0 5 10 20 Chase (min) apob100 incomplete apob polypeptides Fisher et al, Supplemental Figure 1

NT DGAT1 MTP HMGCoAR SREBP1a PPARα PPARγ actin Fisher et al, Supplemental Figure 2

A NT apob-100 apoai Trypsin (µg/ml) 0 5 10 25 50 0 5 10 25 50 B apob-100/apoai (% of control) 100 75 50 25 NT 0 0 5 10 25 50 Trypsin ( g/ml) Fisher et al, Supplemental Figure 3

A Total cell lysate anti-apob IP MG132 (min) 0 20 40 60 U0126 - + - + - + - + 0 20 40 60 - + - + - + - + Total ubiquitin Ub-apoB actin B DMSO U0126 NT - phospho-erk1/2 - total ERK1/2 Fisher et al, Supplemental Figure 4