Satya P. Singh,* Derhsing Lai,* Maria Cartas,* Dawn Serio,* Ramachandran Murali, Vaniambadi S. Kalyanaraman, and Alagarsamy Srinivasan*,1

Transcription

1 Virology 268, (2000) doi: /viro , available online at on Epitope-Tagging Approach to Determine the Stoichiometry of the Structural and Nonstructural Proteins in the Virus Particles: Amount of Vpr in Relation to Gag in HIV-1 Satya P. Singh,* Derhsing Lai,* Maria Cartas,* Dawn Serio,* Ramachandran Murali, Vaniambadi S. Kalyanaraman, and Alagarsamy Srinivasan*,1 *Department of Microbiology and Immunology, Kimmel Cancer Center, Thomas Jefferson University, 1020 Locust Street, Philadelphia, Pennsylvania 19107; Department of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104; and Advanced Bioscience Laboratories, Inc., 5510 Nicholson Lane, Kensington, Maryland Received October 21, 1999; returned to author for revision December 23, 1999; accepted January 5, 2000 We used an epitope-tagging approach to determine the ratio of Gag (structural) to Vpr (nonstructural) in the virus particles directed by human immunodeficiency virus type 1. For this purpose, chimeric Gag and Vpr expression plasmids were constructed with the Flag epitope (DYKDDDDK), and the sequences corresponding to the chimeric protein were introduced into human immunodeficiency virus type 1 proviral DNA (NL4-3) to determine the ratio in the virus particles when these proteins are expressed in cis. In addition, NL4-3 DNA was modified to disrupt Vpr synthesis to determine the extent of incorporation of Vpr-FL when it is expressed in trans through a heterologous promoter. The analysis of virus particles generated by transfection of proviral DNA into RD cells indicated that (1) the ratio of Gag to Vpr in virus particles, when Vpr-FL is expressed in cis (in the context of proviral DNA), is in the range of :1 (14 18 molecules of Vpr per virion) and (2) the expression of Vpr-FL in trans showed efficient incorporation with a Gag to Vpr ratio of 5 7:1 ( molecules of Vpr). These results suggest that the presence of the same epitope on different viral proteins may provide an accurate comparison of these proteins in the virus particles Academic Press INTRODUCTION Genetic analysis of the lentivirus family of retroviruses has revealed that the genomes of these viruses are complex compared with simple retroviruses (Levy, 1998). Specifically, the genome of human immunodeficiency virus type 1 (HIV-1) has been shown to code for six auxiliary proteins in addition to the Gag, Pol, and Env structural proteins (Luciw, 1996; Levy, 1998). With respect to the viral morphogenetic events, lentiviruses follow the pathway of the type C retroviruses (Hunter, 1994). Characteristically, Gag and Gag-Pol proteins are synthesized in the cytoplasm and transported to the cell membrane, and viral assembly occurs at the cell membrane of the infected cells. Although the mechanism of transport of Gag and Gag-Pol proteins to the cell membrane is not clear, the Env protein reaches the cell membrane through the secretory pathway (Hunter, 1994). This scenario suggests that the incorporation of viral proteins into the virus particles may require their interaction either in the cytoplasm or at the cell membrane (Hunter, 1994; Cohen et al., 1996). Biochemical analysis of HIV-1 particles revealed the presence of several nonstructural proteins of viral origin in the virus particles (Cullen, 1998); these include Vif, Vpr, 1 To whom reprint requests should be addressed at JAH Room 461. Fax: (215) asrinivasan@reddi1.uns.tju.edu. and Nef, which are present in different amounts in the virus particles (Levy, 1998). It has been shown that both Vif and Nef exhibit nonspecific incorporation into heterologous retrovirus particles (Cullen, 1998; Levy, 1998) in addition to the particles directed by HIV-1 Gag. A recent study reported that Vif is not present in highly purified virions (Dettenhofer and Yu, 1999). On the other hand, the incorporation of Vpr into the virus particles has been shown to be specific, involving distinct domains in HIV-1 Gag (Cullen, 1998; Emerman, 1996; Levy, 1998). To explore the mechanism or mechanisms governing the incorporation of nonstructural protein or proteins into the virus particles, we have been conducting studies on Vpr. In addition to its essential role in the infection of macrophages by HIV-1 (Emerman, 1996), the characteristic features of Vpr include cell cycle arrest at the G 2 stage (Emerman, 1996; He et al., 1995; Jowett et al., 1995; Re et al., 1995; Rogel et al., 1995), nuclear localization (Emerman, 1996; Zhao et al., 1994a), participation in the transport of the preintegration complex (Heinzinger et al., 1994), cation channel activity (Piller et al., 1996), and interaction with several candidate cellular proteins (Bouhamdan et al., 1996; Fouchier et al., 1998; Gragerov et al., 1998; Refaeli et al., 1995; Stark and Hay, 1998; Tung et al., 1997; Zhao et al., 1994a,b). Work from our laboratory and others showed the importance of putative helical domains present in Vpr for its incorporation into virus particles (Di Marzio et al., 1995; Luo et al., 1998; Mahalingam /00 $35.00 Copyright 2000 by Academic Press All rights of reproduction in any form reserved. 364

2 STOICHIOMETRY OF VIRAL PROTEINS 365 et al., 1995; Nie et al., 1998; Subbramanian et al., 1998; Yao et al., 1995). Furthermore, evidence was also presented for the interaction of Vpr and Gag in the cells, which may be the basis for its incorporation into virus particles (Lavallee et al., 1994). Regarding Gag, a role for the p6 region in the incorporation of Vpr into the virus particles has been demonstrated through deletion and the transfer of this domain to an unrelated Moloney murine leukemia virus Gag (Checroune et al., 1995; Kondo et al., 1995; Lu et al., 1993, 1995; Paxton et al., 1993). Despite a wealth of data available on Vpr, the information regarding the amount of Vpr incorporated into the virus particles is not clear. This information may be useful for elucidating the mechanism or mechanisms involved in the incorporation of Vpr into the virus particles and for developing Vpr as an analytical and therapeutic agent. In this regard, a related protein designated Vpx (Tristem et al., 1992) has been shown to be present in HIV-2 virions in equimolar quantities to that of p27 of Gag (Henderson et al., 1988). To determine the amount of Vpr incorporated into HIV-1 virus particles, we used an epitope-tagging approach on Gag and Vpr involving Flag as the epitope (Chubet and Brizzard, 1996). Combining the sensitive p24 antigen assay and immunoblot analysis of virus particles using Flag antibodies, it was estimated that the ratio of Gag to Vpr was in the range of :1 when Vpr was expressed by HIV-1 proviral DNA. A much higher level of incorporation (5 7:1 for Gag to Vpr) was noted when Vpr was expressed in trans through an efficient heterologous promoter. RESULTS Generation of recombinant plasmids containing sequences encoding Gag-FL and Vpr-FL and analysis of epitope-tagged protein Gag and Vpr coding sequences were derived from HIV-1 proviral DNA (NL4-3). The sequences corresponding to the Flag epitope (DYKDDDDK) were added to the 3 end of the Vpr and Gag followed by a termination codon using the PCR method. The Gag-FL coding sequences were bounded by EcoRI and XhoI enzyme sites at the 5 and 3 end, respectively. Similarly, Vpr-FL coding sequences were bounded by HindIII and XhoI enzyme recognition sites. The Gag-FL and Vpr-FL sequences were cloned into pcdna3 vector, which consists of cytomegalovirus immediate-early and T7 promoter upstream and bovine growth hormone poly(a) signal sequences downstream of the coding sequences. On cloning, the integrity of the sequences was determined by DNA sequence analysis. Similar strategy was used to generate Gag-Vpr-FL in which Vpr-FL sequences were fused in frame to the 3 end of Gag. Because the recombinant plasmids containing Gag-FL and Vpr-FL coding sequences have the T7 promoter, an in vitro transcription coupled translation system was used to analyze the protein. The synthesized proteins were tested with respective antibodies. Such an analysis showed that Gag-FL protein was detected from sera from HIV-1-infected individuals and the corresponding bands were not present in the control where only vector DNA was used. The same protein was also detected by using commercially available polyclonal antibodies against the Flag epitope. Consistent with the data obtained regarding Gag-FL, antibodies against Flag epitope reacted with the Vpr-FL. Furthermore, in vitro translated Gag-FL and Gag-Vpr-FL proteins showed bands of similar intensities in Western blot analysis, implying equal accessibility of Flag epitope to antibodies in the context of Gag and Vpr (data not shown). Expression of epitope-tagged proteins (Gag-FL and Vpr-FL) in cells and incorporation of Vpr-FL into virus-like particles For this purpose, we used recombinant vaccinia virus expressing T7 polymerase as described previously (Serio et al., 1997). HeLa cells, plated at a density of per 100-mm Petri dish, were infected with the recombinant vaccinia virus the next day for 1 h. The cells were washed, and the plasmid DNAs were transfected either alone or in combination into cells by using Lipofectin. Approximately h posttransfection, the culture supernatant and the cells were collected separately. On lysis of the cells, an aliquot was analyzed for the expression of Gag-FL and Vpr-FL. As observed with the in vitro synthesized proteins, antibodies against Flag epitope detected Gag-FL and Vpr-FL (Fig. 1A). To determine the incorporation of Vpr-FL into virus-like particles, the culture supernatant was concentrated by centrifugation using the Amicon p30 column. The virus particles were lysed, and the Gag-FL and Vpr-FL were tested by immunoblot analysis. The results indicated that transfection of Gag-FL resulted in the release of viral particles and that Vpr-FL was observed in the supernatant only in association with Gag (Fig. 1B). Sensitivity of the epitope-tag approach The quantification of nonstructural proteins present in the virus particles is generally carried out with the protein of interest expressed in a prokaryotic system, followed by purification of the protein for its use as a standard in the immunoblot analysis. However, such an approach for this study may still require the use of different antibodies to characterize the extent of incorporation of Vpr in relation to Gag into the virus particles. Because the affinity of the antibodies generally varies for the respective proteins, which may complicate the interpretation of the data, we decided to generate Vpr-FL and Gag-FL using Flag epitope for quantitative assays. We reasoned that the availability of a sensitive ELISA assay

3 366 SINGH ET AL. FIG. 1. Expression of Gag-FL and Vpr-FL in cells. Vaccinia virusinfected cells were transfected with the respective plasmid DNA either alone or in combination. Immunoblot analysis of the cell lysate (A) and virus-like particles (B) was carried out using Flag antibodies. M, molecular weight markers (kda); lane 1, pcdna3; lane 2, Vpr-FL; lane 3, Gag-FL; and lane 4, Gag-FL Vpr-FL. for the quantification of viral antigen in combination with immunoblot analysis using Flag antibodies may provide sufficient sensitivity to examine the ratio of Gag to Vpr in the virus particles. The proviral DNA NL4-3 and NL-Gag-FL (Fig. 2) were independently transfected into RD cells. The virus particles released into the medium were collected at the end of 5 days posttransfection. Immunoblot analysis using antibodies against Flag epitope detected as little as 6 pg of p24 antigen equivalent of virus particles on the separation of proteins on SDS PAGE (Figs. 3A and 3B). The extent of reactivities of Flag epitope antibodies to different concentration of proteins suggests that the approach considered here has the desired sensitivity. Determination of the ratio of Gag to Vpr in the virus particles The specific incorporation of Vpr into the virus particles directed by HIV-1 is a prerequisite for determining the ratio of Gag to Vpr in the virus particles. The possibility that nonspecific association of Vpr with contaminating vesicles in the virus preparation may lead to a wrong estimation with respect to Vpr was considered. To rule this out, we used wild-type and mutant Vpr-containing substitutions in helical domain I region in cotransfection experiments with HIV-1 proviral DNA lacking Vpr expression. The immunoblot analysis of virus particles showed that incorporation was observed only for wildtype Vpr and not for mutant Vpr under the conditions used in our experiments (data not shown). To obtain information regarding the number of molecules of Vpr present in the virus particles, we decided to use an epitope-tagged Vpr in combination with and without an epitope-tagged Gag. The modified NL4-3 proviral DNA containing Vpr-FL (Fig. 2) was transfected into RD cells. The virus particles released into the medium were harvested and quantified by p24 antigen assay, and immunoblot analysis was carried out using Flag antibodies. The results (Fig. 4A) indicate that Vpr-FL can be detected in the virus particles using viral lysate. In the context of NL-Vpr-FL proviral DNA, only Vpr has the Flag epitope. In an effort to generate information regarding the ratio of Gag to Vpr in the virus particles, we used HIV-1 proviral DNA in which both the Gag and Vpr have the Flag epitope (Fig. 2). Hence, the analysis of virus particles using Flag antibodies may shed light on the relative amount of each protein present in the virus particles. The results generated with this approach may show two possible scenarios. First, an equal amount of Gag to Vpr in the virus particles would yield bands of similar intensities at Pr55 (Gag) and p14 (Vpr). Second, a differential amount of Vpr in relation to Gag would yield an intense band at Pr55 and a weak signal at p14. The immunoblot analysis of virus particles derived from transfection of NL-GV-FL revealed an altered ratio of Gag to Vpr in the range of :1 (Fig. 4B). Because Vpr-FL in HIV-1 proviral DNA is expressed as a late protein, it is likely that the level of incorporation may be due to the low level of Vpr-FL present in the cells. To test this, it was important to examine the extent of incorporation of Vpr-FL into the virus particles when Vpr-FL was expressed in trans. Toward this goal, cotransfection of NL-Gag-FL and Vpr-FL expression plasmid into RD cells was carried out, and the viral particles were subjected to immunoblot analysis. The results showed that Vpr-FL, expressed in trans, is incorporated into the virus particles at a higher level than Vpr-FL expressed in the context of the proviral DNA (Fig. 5). The ratio of Gag to Vpr was in the range of 5 7:1 in several independent experiments when only Pr55 band was considered for estimation. The inclusion of bands reactive to Flag antibodies below Pr55 showed a ratio in the range of 11 14:1. DISCUSSION Among retroviruses, members of the lentivirus subfamily exhibit a unique feature of incorporation of nonstructural proteins of viral origin into virus particles similar to that of several DNA viruses (Fields et al., 1996). Interestingly, HIV-1 has been shown to contain three nonstructural proteins in the virus particles: Vif, Vpr, and Nef (Cullen, 1998; Levy, 1998). The precise number of molecules present in the virus particles has been reported only for Vif (5 75 molecules) and Nef (5 20 mol-

4 STOICHIOMETRY OF VIRAL PROTEINS 367 FIG. 2. Schematic representation of HIV-1 proviral DNA (NL4-3) containing Vpr, Vpr-FL, Gag-FL, and Gag-FL Vpr-FL. The restriction enzyme cleavage sites used for cloning chimeric Vpr and Gag containing Flag epitope sequences are indicated at the top. ecules) (Camaur and Trono, 1996; Liu et al., 1995; Simon et al., 1998; Welker et al., 1996). The number of molecules of Vpr present in a virion is not clear. Currently, there are conflicting data indicating that the number of Vpr molecules may be similar to that of RT molecules derived from the Gag-Pol precursor protein (Kobinger et al., 1998) and may also be similar to that of Gag (Cohen et al., 1990). HIV-2/simian immunodeficiency virus particles contain a protein known as Vpx, which is related to Vpr (Tristem et al., 1992), and studies showed that Vpx is present in the virus particles in quantities similar to that of p27 (Henderson et al., 1988). The virion-specific incorporation of HIV-1 nonstructural proteins into virus particles has led to the suggestion that these molecules can be explored to develop antiviral agents against lentiviruses, as well as analytical tools to dissect the events associated with the HIV-1 life-cycle (Fletcher et al., 1997; Kobinger et al., 1998; Okui et al., 1998; Serio et al., 1997; Wu et al., 1996, 1997). To further develop this strategy, it would be desirable to know the relative number of Vpr molecules present in the virus particles. The report presented here provides an unique approach to quantify the proteins present in the virus particles. The experimental system that we used takes advantage of the addition of Flag epitope on both the Gag and Vpr. In combining the p24 antigen assay to quantify Gag and immunoblot analysis using Flag antibodies, an attempt was made to determine the ratio of Gag to Vpr in the virion. The assay that has been routinely used to determine the number of molecules of nonstructural versus structural proteins in the virus particles requires generation of the candidate protein using a bacterial expression system for use as a standard in the immunoblot analysis (Liu et al., 1995). Kobinger et al. (1998) recently reported that the number of molecules of Vpr incorporated into the virus particles is similar to the number of RT molecules. This estimation was based on generating radiolabeled virus particles by incubating the cells with 35 S-methionine. The viral proteins were subjected to immunoprecipitation by using antibodies specific to Vpr and RT and analyzed after SDS PAGE. By taking into account the number of methionine residues present in RT and Vpr, the signal intensity of the respective protein in the autoradiogram was analyzed to estimate the number of Vpr molecules in the virus particles. These approaches assume that the affinity of the anti-

5 368 SINGH ET AL. FIG. 5. Quantitative analysis of the ratio of Gag to Vpr in the virus particles when Vpr expression was directed in trans by a heterologous promoter. Cotransfection of NL-Gag-FL and Vpr-FL expression plasmid was carried out to derive the virus particles. On the addition of chemiluminescent substrate, the blot was exposed for 15 min (A) or 30 min (B). Lane 1, NL- Vpr Vpr-FL; lane 2, NL- Vpr; lane 3, NL-Gag-FL Vpr-FL (30 l of virus lysate); and lane 4, NL-Gag-FL Vpr-FL (50 l of virus lysate). FIG. 3. (A) Immunoblot analysis of virus particles using antibodies against Flag epitope. Different concentrations of viral lysate, based on p24 antigen values, were subjected to the analysis after SDS PAGE. M, molecular weight markers (kda); lanes 1 6, 192, 96, 48, 24, 12, and 6pg p24 antigen equivalent of viral lysate. (B) Densitometric analysis of Gag-FL in the virus particles. Chemiluminescence intensity of each band was plotted against p24 antigen values. bodies for the candidate proteins remains the same. The use of Flag epitope on both Gag and Vpr proteins, in our opinion, is advantageous because the same epitope on both proteins eliminates the differential affinity generally observed when using different antibodies and provides an accurate molecule-to-molecule comparison. The Flag epitope-tagging approach was successful in obtaining the number of Vpr molecules present in the virus particles, which varies according to the mode (cis or trans) of expression of Vpr. The ratio of Gag to Vpr is found to be in the range of :1. It is assumed that there are 2750 molecules of Gag present per virion (Arthur et al., 1992). Considering this, it is likely that each FIG. 4. Immunoblot analysis of virus particles using antibodies against Flag epitope. (A) Lane 1, NL-Vpr-FL; lane 2, virus particles derived from cotransfection of NL- Vpr Vpr-FL. (B) Quantitative analysis of the ratio of Gag to Vpr in the virus particles directed by NL-GV-FL. Vpr-FL is expressed in the context of HIV-1 proviral DNA. Lanes 1 3, 50, 5, and 0.5 l of viral lysate. Virus particles derived from NL4-3 and NL- Vpr did not show the corresponding Vpr-FL band. virion may contain approximately molecules of Vpr as shown by densitometric analysis. It is to be noted that the ratio :1 is only for the virus particles directed by HIV-1 proviral DNA containing both Gag-FL and Vpr- FL. As Vpr is subjected to regulation by Rev, the low incorporation of Vpr into virus particles may be due to the low amount of Vpr present in cells. Further, we also examined whether the trans expression of Vpr affects the efficiency of incorporation of Vpr into the virus particles. This was addressed by cotransfection of modified HIV-1 proviral DNA lacking the ability to express Vpr (NL-Gag- FL) and Vpr-FL expression plasmid in cells. The expression of Vpr in trans resulted in an enhancement in the incorporation of Vpr into the virus particles with Vpr molecules per virion. The estimated number of molecules of Vpr present in the virus particles in this study is in disagreement with earlier studies (Cohen et al., 1990; Kobinger et al., 1998). The overestimation with regard to the number of molecules of Vpr present in the virus particles reported earlier, in our view, may stem from the methodologies used for evaluation. Because our method uses an epitope-tag approach, we have also considered the possibility that the addition of a tag may be detrimental to the virion incorporation phenotype of Vpr. Immunoblot analysis of virus particles derived from cotransfection of NL Vpr proviral DNA with either wild-type Vpr or Vpr-FL expression plasmid showed bands with similar reactivities to antibodies against Vpr (data not shown), implying that the addition of Flag epitope did not interfere with the virion incorporation of Vpr. Furthermore, the presence of a similar amount of Vpr-FL in the virus-like particles assembled by Gag and Gag-FL also supports the above conclusion (data not shown). Hence, the results presented here suggest that one of the limiting factors for the extent of incorporation of Vpr may be the expression level of Vpr as noted for Vif (Simon et al., 1998), and extrapolation of the data from the analysis of virus particles generated through expression of Vpr in trans as opposed to its expression in cis should be made with caution.

6 STOICHIOMETRY OF VIRAL PROTEINS 369 The differential level of Vpr and Gag present in the virus particles may provide clues to understanding the mechanism or mechanisms underlying the incorporation of Vpr into the virus particles. Earlier studies by Lavallee et al. (1994) showed an interaction between Vpr and Gag in the infected cells. It should also be noted that specific interaction of Vpr with p17 matrix (Sato et al., 1996) and nucleocapsid p7 (de Rocquigny et al., 1997) has been documented. It is not clear whether these interactions exist in the context of the precursor Pr55 Gag and provide help for the incorporation of Vpr into the virus particles. Because the incorporation of Vpr into virus particles can be achieved through the transfer of the carboxyl-terminal p6 domain of Gag to heterologous Gag-directed virus particles (Kondo et al., 1995), it is also likely that a specific interaction between the p6 domain and Vpr is possible. The quantitative data regarding the amount of Vpr incorporation into virus-like particles directed by p55 Gag versus heterologous virus particles containing only the p6 may provide information regarding the mechanism. This quantitative study further demonstrates that Vpr can be used to develop antiviral agents targeting virus maturation and can be used as a tool to analyze the events associated with virus morphogenesis. MATERIALS AND METHODS Construction of recombinant plasmids encoding Gag-FL and Vpr-FL and cloning of sequences corresponding to epitope-tagged Gag and Vpr into HIV-1 proviral DNA Cloning of wild-type Gag and Vpr was carried out using the pcdna3 expression vector as described previously (Mahalingam et al., 1995). For the generation of chimeric proteins containing Flag epitope, sequences corresponding to the epitope (DYKDDDDK residues) were incorporated in the 3 primer. The primers used to generate Gag-FL were GACTGTTAAGTGTTTCAATTG [Apa( )] located upstream of ApaI restriction enzyme cleavage site and CCCCCCTCGAGCTACTT- GTCATCGTCGTCCTTGTAGTCTTGTGACGAGGGGTCGCT [Gag-FL( )] corresponding to the 3 end of Gag coding sequences followed by Flag and XhoI restriction enzyme cleavage site sequences. Primers TCTAGAAGCTTGC- CGCCACCATGGAACAAGCCCCAGAAGAC [HKVpr( )] corresponding to HindIII restriction enzyme cleavage site, kozak consensus, and 5 end of Vpr coding sequences and CCCCCCTCGAGCTACTTGTCATCGTCGT- CCTTGTAGTCGGATCTACTGGCTCCTT [Vpr-FL( )] representing the 3 end of Vpr coding sequences followed by Flag and XhoI restriction enzyme cleavage site sequences were used to generate Vpr-FL. For the construction of Gag-Vpr-FL, the individual PCRs were initiated with Apa( ) and TTCTGGGGCTTGTTCCATTTGTGACGA- GGGGTCGCTGCC [Gag-Vpr( )] to amplify the 3 end of Gag and to generate Vpr-FL using the primers ATGGAA- CAAGCCCCAGAAGAC [Vpr( )] and Vpr-FL( ). The DNAs derived from both reactions were purified, mixed, and amplified by using Apa( ) and VprFL( ) primers. The amplified DNA was digested with ApaI and XhoI restriction enzymes and ligated to the Gag clone cleaved appropriately. Gag-FL and Vpr-FL sequences were introduced into HIV-1 NL4-3 proviral DNA. The schematic representation of the proviral DNAs used is shown in Fig. 2. The proviral DNA designated NL Vpr lacks Vpr expression due to a frameshift mutation (close to the EcoRI recognition site) in the coding sequences. To avoid disruption of the overlap of vpr and tat at the 3 end, the unique EcoRI and SalI restriction endonuclease cleavage sites were used to introduce the 3 end of chimeric Vpr from the recombinant plasmid to generate NL-Vpr-FL. Similarly, the 3 end fragment generated by using ApaI from the Gag-FL plasmid was ligated to NL- Vpr cleaved with ApaI enzyme to generate NL-Gag-FL. The generation of NL-GV- FL, containing Gag-FL and Vpr-FL, used NL-Vpr-FL plasmid to introduce the Gag-FL 3 end fragment at the ApaI site. In vitro transcription/translation and radioimmunoprecipitation analysis of proteins The coupled T7 transcription/translation system (Promega, Madison, WI) was used to characterize the expression of the recombinant clones. Incubation conditions were followed according to manufacturer s instructions. Radioimmunoprecipitation analysis of in vitro translated proteins was carried out using polyclonal sera to Gag, Vpr, and Flag epitope (Serio et al., 1997). Expression and incorporation of Vpr-FL into virus-like particles To assess the expression of Vpr-FL and Gag-FL in cells and incorporation of Vpr-FL into virus-like particles, we used the vaccinia virus T7 polymerase expression system. Vpr-FL and Gag-FL expression plasmids were transfected alone and in combination into HeLa cells after infection with vaccinia virus expressing T7 polymerase. Cell lysates and culture supernatants were subjected to immunoblot analysis as described previously (Serio et al., 1997). Generation of virus particles directed by HIV-1 proviral DNA HIV-1 proviral DNA (wild type and modified in Gag and Vpr coding sequences) was transfected into RD cells (ATCC CCL 136, American Type Culture Collection, Rockville, MD) as described previously (Nagashunmugam et al., 1992). Virus particles released into the culture medium were harvested 120 h posttransfection and quanti-

7 370 SINGH ET AL. fied by p24 antigen assay with an ELISA (Organon Teknika, Durham, NC). Immunoblot analysis Virus-containing culture supernatants were precleared for 10 min at 10,000 rpm and subjected to sucrose density gradient centrifugation (Serio et al., 1997). Virus pellets were lysed in lysis buffer (62.5 mm Tris HCl, ph 6.8, 0.2% SDS, 1% -mercaptoethanol, and 10% glycerol). Samples were normalized on the basis of p24 antigen values and were run on 10% or 16% SDS PAGE before transfer to nitrocellulose membrane. Membranes were then blocked in TBS (20 mm Tris, 500 mm NaCl, ph 7.5) containing 5% (w/v) nonfat dry milk (Bio-Rad, Hercules, CA). Subsequent incubations with primary (anti-flag M2; 1:1000) (Eastman Kodak Company, New Haven, CT) and secondary antisera [anti-mouse IgG (H&L) AP conjugate; 1:3000] (Promega) were performed in TTBS (TBS containing 0.05% Tween-20). Each incubation was followed by several washings in TTBS. The blot was then incubated with Western blue detection reagent, or CDP-Star (Promega) was used as the chemiluminescent substrate in a nonradioactive detection system. Quantification by densitometry The intensity of the bands obtained through immunoblot analysis was used for determination of the ratio of Gag to Vpr. Blots were scanned and densitometric analysis was performed using the Molecular Dynamics ImageQuant program as described previously (Serio et al., 1999). ACKNOWLEDGMENTS We would like to express our thanks to Mr. Sashi Reddi for his help in preparation of the manuscript. This work was supported by National Institutes of Health Grant AI D. Lai was supported by the NRSA training program for AIDS research (T32 AI07523). REFERENCES Arthur, L. O., Bess, J. W., Jr., Sowder, R. C., II, Benveniste, R. E., Mann, D. L., Chermann, J. C., and Henderson, L. E. (1992). Cellular proteins bound to immunodeficiency viruses: Implications for pathogenesis and vaccines. Science 258, Bouhamdan, M., Benichou, S., Rey, F., Navarro, J. M., Agostini, I., Spire, B., Camonis, J., Slupphaug, G., Vigne, R., Benarous, R., and Sire, J. (1996). Human immunodeficiency virus type 1 Vpr protein binds to the uracil DNA glycosylase DNA repair enzyme. J. Virol. 70, Camaur, D., and Trono, D. (1996). Characterization of human immunodeficiency virus type 1 Vif particle incorporation. J. Virol. 70, Checroune, F., Xao, X. J., Gottlinger, H. G., Bergeron, D., and Cohen, E. A. (1995). Incorporation of Vpr into human immunodeficiency virus type 1: Role of conserved regions within the P6 domain of Pr55gag. J. Acquir. Immune Defic. Syndr. 10, 1 7. Chubet, R. G., and Brizzard, B. L. (1996). Vectors for expression and secretion of FLAG epitope-tagged proteins in mammalian cells. Biotechniques 20, Cohen, E. A., Dehni, G., Sodroski, J. G., and Haseltine, W. A. (1990). Human immunodeficiency virus vpr product is a virion associated regulatory protein. J. Virol. 64, Cohen, E. A., Subbramanian, R. A., and Gottlinger, H. G. (1996). Role of auxiliary proteins in retroviral morphogenesis. Curr. Topics Microbiol. Immunol. 214, Cullen, B. R. (1998). HIV-1 auxiliary proteins: Making connections in a dying cell. Cell 93, de Rocquigny, H., Petitjean, P., Tanchou, V., Decimo, D., Drouot, L., Darlix, J. L., and Roques, B. P. (1997). The zinc fingers of HIV nucleocapsid protein NCp7 direct interactions with the viral regulatory protein Vpr. J. Biol. Chem. 272, Dettenhofer, M., and Yu, X-F. (1999). Highly purified human immunodeficiency virus type 1 reveals a virtual absence of Vif in virions. J. Virol. 73, Di Marzio, P., Choe, S., Elbright, M., Knoblauch, R., and Landau, N. (1995). Mutational analysis of cell cycle arrest, nuclear localization, and virion packaging of human immunodeficiency virus type 1 Vpr. J. Virol. 69, Emerman, M. (1996). HIV-1 Vpr and the cell cycle. Curr. Biol. 6, Fields, B. N., Knipe, D. M., and Howley, P. M. (1996). Fields Virology, Vol. 2, 3rd ed., Lippincott-Raven, Philadelphia. Fletcher, T. M., III, Soares, M. A., McPhearson, S., Hui, H., Wiskerchen, M., Muesing, M. A., Shaw, G. M., Leavitt, A. D., Boeke, J. D., and Hahn, B. H. (1997). Complementation of integrase function in HIV-1 virions. EMBO J. 16, Fouchier, R. A. M., Meyer, B. E., Simon, J. H. M., Fischer, U., Albright, A. V., Gonzalez-Scarano, F., and Malim, M. M. (1998). Interaction of the human immunodeficiency virus type 1 Vpr protein with the nuclear pore complex. J. Virol. 72, Gragerov, A., Kino, T., Ilyina-Gragerara, G., Chrousos, G. P., and Pavlakis, G. N. (1998). HHR23A, the human homologue of the yeast repair protein RAD23, interacts specifically with Vpr protein and prevent cell cycle arrest but not the transcriptional effects of Vpr. Virology 245, He, J., Choe, S., Walker, R., Di Marzio, P., Morgan, D. O., and Landau, N. R. (1995). Human immunodeficiency virus type 1 viral protein R (Vpr) arrests cells in the G2 phase of the cell cycle by inhibiting p34 cdc2 activity. J. Virol. 69, Heinzinger, N. K., Bukrinsky, M. I., Haggerty, S. A., Ragland, A. M., Kewalramani, V., Lee, M. A., Gendelman, H. E., Ratner, L., Stevenson, M., and Emerman, M. (1994). The Vpr protein of human immunodeficiency virus type 1 influences nuclear localization of viral nucleic acids in non dividing host cells. Proc. Natl. Acad. Sci. USA 91, Henderson, L. E., Sowder, T. D., Copeland, R. E., Beneveniste, R. E., and Oroszlan, S. (1988). Isolation and characterization of a novel protein (X-ORF product) from SIV and HIV-2. Science 241, Hunter, E. (1994). Macromolecular interactions in the assembly of HIV and other retroviruses. Semin. Virol. 5, Jowett, J. B. M., Planelles, V., Poon, B., Shah, N. P., Chen, M.-L., and Chen, I. S. Y. (1995). The human immunodeficiency virus type 1 vpr gene arrests infected T cells in the G2 M phase of the cell cycle. J. Virol. 69, Kobinger, G. P., Borsetti, A., Nie, Z., Mercier, J., Daniel, N., Gottlinger, H. G., and Cohen, E. A. (1998). Virion-targeted viral inactivation of human immunodeficiency virus type 1 by using Vpr fusion proteins. J. Virol. 72, Kondo, E., Mammano, F., Cohen, E. A., and Gottlinger, H. G. (1995). The p6 gag domain of human immunodeficiency virus type 1 is sufficient for the incorporation of Vpr into heterologous virus particles. J. Virol. 69, Lavallee, C., Yao, X. J., Ladha, H., Gottlinger, H. G., Haseltine, W., and Cohen, E. A. (1994). Requirement of the Pr55 gag precursor for incorporation of the vpr product into human immunodeficiency virus type 1 viral particle. J. Virol. 68,

8 STOICHIOMETRY OF VIRAL PROTEINS 371 Levy, J. A. (1998). HIV and the Pathogenesis of AIDS. ASM Press, Washington, DC. Liu, H., Wu, X., Newman, M., Shaw, G. M., Hahn, B. H., and Kappes, J. C. (1995). The Vif protein of human and simian immunodeficiency viruses is packaged into virions and associated with viral core structures. J. Virol. 69, Lu, Y.-L., Bennett, R. P., Wills, J. W., Gorelick, R., and Ratner, L. (1995). A leucine triplet repeat sequence (LXX) 4 in P6 gag is important for Vpr incorporation in human immunodeficiency virus type 1 particles. J. Virol. 69, Lu, Y.-L., Spearman, P., and Ratner, L. (1993). Human immunodeficiency virus type 1 viral protein R localization in infected cells and virions. J. Virol. 67, Luciw, P. A. (1996). Human immunodeficiency viruses and their replication. In Fields Virology (B. N. Fields, D. M., Knipe, and P. M. Howley, Eds.), pp Lippincolt-Raven, Philadelphia. Luo, Z., Butcher, D. J., Murali, R., Srinivasan, A., and Huang, Z. (1998). Structural studies of synthetic peptide fragments derived from the HIV-1 Vpr protein. Biochem. Biophys. Res. Commun. 244, Mahalingam, S., Khan, S. A., Murali, R., Jabbar, M. A., Monken, C. E., Collman, R. G., and Srinivasan, A. (1995). Mutagenesis of the putative -helical domain of the Vpr protein of human immunodeficiency virus type 1: Effect on stability and virion incorporation. Proc. Natl. Acad. Sci. USA 92, Nagashunmugam, T., Velpandi, A., Goldsmith, C. S., Zaki, S. R., Kalyanaraman, V. S., and Srinivasan, A. (1992). Mutation in the primer binding site of the type 1 human immunodeficiency virus genome affects virus production and infectivity. Proc. Natl. Acad. Sci. USA 89, Nie, Z., Bergeron, D., Subbramanian, R. A., Yao, X. J., Checroune, F., Rougeau, N., and Cohen, E. A. (1998). The putative alpha helix 2 of human immunodeficiency virus type 1 Vpr contains a determinant which is responsible for the nuclear translocation of proviral DNA in growth-arrested cells. J. Virol. 72, Okui, N., Kobayashi, N., and Kitamura, Y. (1998). Production of uninfectious human immunodeficiency virus type 1 containing viral protein R fused to a single-chain antibody against viral integrase. J. Virol. 72, Paxton, W., Connor, R. I., and Landau, N. (1993). The p6 gag domain of human immunodeficiency virus type 1 is sufficient for the incorporation of Vpr into heterologous virus particles. J. Virol. 67, Piller, S. C., Ewart, G. D., Premkumar, A., Cox, G. B., and Gage, P. W. (1996). Vpr protein of human immunodeficiency virus type 1 forms cation-selective channels in planar lipid bilayers. Proc. Natl. Acad. Sci. USA 93, Refaeli, Y., Levy, D. N., and Weiner, D. B. (1995). The glucocorticoid receptor type II complex is a target of the HIV-1 Vpr gene product. Proc. Natl. Acad. Sci. USA 92, Re, F., Braten, D., Franke, E. K., and Luban, J. (1995). Human immunodeficiency virus type 1 Vpr arrests the cell cycle in G2 by inhibiting the activation of p34 cdc2 -cyclin B. J. Virol. 69, Rogel, M. E., Wu, L. I., and Emerman, M. (1995). The human immunodeficiency virus type 1 vpr gene prevents cell proliferation during chronic infection. J. Virol. 69, Sato, A., Yoshimoto, J., Isaka, Y., Miki, S., Suyama, A., Hayami, M., Fujiwara, T., and Yoshie, O. (1996). Evidence for direct association of Vpr and Matrix protein p17 within the HIV-1 virion. Virology 220, Serio, D., Rizvi, T. A., Cartas, M., Kalyanaraman, V. S., Weber, I. T., Koprowski, H., and Srinivasan, A. (1997). Development of a novel anti-hiv-1 agent from within: Effect of chimeric Vpr containing protease cleavage site residues on virus replication. Proc. Natl. Acad. Sci. USA 94, Serio, D., Weber, I. T., Harrison, R. W., Louis, J. M., and Srinivasan, A. (1999). Epitope-based assay to determine the efficiency of cleavage by HIV-1 protease. Biotechniques 26, Simon, J. H. M., Miller, D. L., Fouchier, R. A. M., and Malim, M. (1998). Virion incorporation of human immunodeficiency virus type-1 Vif is determined by intracellular expression level and may not be necessary for function. Virology 248, Stark, L. A., and Hay, R. T. (1998). Human immunodeficiency virus type 1 (HIV-1) viral protein R (Vpr) interact with Lys-tRNA synthetase: Implications for priming of HIV-1 reverse transcription. J. Virol. 72, Subbramanian, R. A., Yao, X. J., Dilhuydy, H., Rougeau, N., Bergeron, D., Robitaille, Y., and Cohen, E. A. (1998). Human immunodeficiency virus type 1 Vpr localization: Nuclear transport of a viral protein modulated by a putative amphipathic helical structure and its relevance to biological activity. J. Mol. Biol. 278, Tristem, M., Marshall, C., Karpas, A., and Hill, F. (1992). Evolution of the primate lentiviruses: evidence from vpx and vpr. EMBO J. 11, Tung, H. Y. L., Rocquigny, De., Zhao, H., Cayla, L.-J. X., Roques, B. P., and Ozon, R. (1997). Direct activation of protein phosphatase-2ao by HIV-1 encoded protein complex Ncp7: Vpr. FEBS Lett. 401, Welker, R., Kotler, H., Kalbitzer, H. R., and Krausslich, H. G. (1996). Human immunodeficiency virus type 1 Nef protein is incorporated into virus particles and specifically cleaved by the viral proteinase. Virology 219, Wu, X., Liu, H., Xiao, H., Conway, J. A., and Kappes, J. C. (1996). Inhibition of human and simian immunodeficiency virus protease function targeting Vpx-protease-mutant fusion protein into viral particles. J. Virol. 70, Wu, X., Liu, H., Xiao, H., Conway, J. A., Hunter, E., and Kappes, J. C. (1997). Functional RT and IN incorporated into HIV-1 particles independently of the Gag/Pol precursor protein. EMBO J. 16, Yao, X. J., Subbramanian, R. A., Rougeau, N., Boisvert, F., Bergeron, D., and Cohen, E. A. (1995). Mutagenic analysis of human immunodeficiency virus type 1 Vpr: Role of a predicted N-terminal alpha-helical structure in Vpr nuclear localization and virion incorporation. J. Virol. 69, Zhao, L. J., Mukherjee, S., and Narayan, O. (1994a). Biochemical mechanism of HIV-1 Vpr function: Specific interaction with a cellular protein. J. Biol. Chem. 269, Zhao, L. J., Wang, L., Mukherjee, S., and Narayan, O. (1994b). Biochemical mechanism of HIV-1 Vpr function: Oligomerization mediated by the N-terminal domain. J. Biol. Chem. 269,