Complementation of Human Immunodeficiency Virus Type 1 Replication by Intracellular Selection of Escherichia coli trna 3 Lys Supplied in trans

Transcription

1 JOURNAL OF VIROLOGY, Oct. 2006, p Vol. 80, No X/06/$ doi: /jvi Copyright 2006, American Society for Microbiology. All Rights Reserved. Complementation of Human Immunodeficiency Virus Type 1 Replication by Intracellular Selection of Escherichia coli trna 3 Supplied in trans Anna McCulley and Casey D. Morrow* Department of Cell Biology, University of Alabama at Birmingham, Birmingham, Alabama Received 7 April 2006/Accepted 12 July 2006 Human immunodeficiency virus type 1 (HIV-1) exclusively selects trna 3 as the primer for the initiation of reverse transcription, even though both trna 3 and trna 1,2 are found in HIV-1 virions. Alteration of the HIV-1 primer-binding site (PBS) to be complementary to alternate trnas results in the use of those trnas for replication, indicating that primer complementarity with the PBS is an important determinant of primer selection. In previous studies, we have exploited this fact to develop a system in which yeast (Saccharomyces cerevisiae) trna Phe is provided in trans to complement the replication of HIV-1 with a PBS complementary to yeast trna Phe. Recent studies have demonstrated that the presence of lysyl-trna synthetase in HIV-1 virions might account for the preference for the selection of trna 3 in HIV-1 replication. To establish a complementation system more reflective of HIV-1 primer selection, we have altered the HIV-1 PBS to be complementary to the Escherichia coli trna 3, which shares near identity with mammalian trna 3 except in the 3 -terminal 18-nucleotide sequence that binds to the PBS. E. coli trna 3 expressed from a plasmid was aminoacylated in mammalian cells. Cotransfection of cells with a plasmid that encodes E. coli trna 3 and a plasmid encoding an HIV-1 provirus with a PBS complementary to E. coli trna 3 resulted in the production of infectious virus. A comparison of the two complementation systems revealed that higher levels of intracellular E. coli trna 3 than of yeast trna Phe were needed to achieve equal levels of infectious virus, indicating that there was no preferential selection of E. coli trna 3. To examine the specificity of trna selection, E. coli trna 3 was modified to trna 1,2. This trna was also aminoacylated when expressed in mammalian cells and complemented the infectivity of HIV-1 at levels similar to those seen for E. coli trna 3. Additional mutations in the anticodon of E. coli trna 3 were constructed; these mutations did not significantly correlate with the capacity of the trna primer to complement infectivity of HIV-1, even though they had a drastic effect on the aminoacylation of the trnas. The results of these studies demonstrate that E. coli trna 3 provided in trans can complement HIV-1 genomes with the PBS altered to E. coli trna 3. However, the capacity of trna 3 to interact with lysyl-trna synthetase does not entirely explain the enhanced preference for selection of trna 3 for the replication of HIV-1. * Corresponding author. Mailing address: University of Alabama at Birmingham, Department of Cell Biology, 802 Kaul Building, th Street South, Birmingham, AL Phone: (205) Fax: (205) caseym@uab.edu. The conversion of the single-stranded RNA genome of retroviruses into a double-stranded DNA intermediate prior to integration in the host cell chromosome requires a virally encoded enzyme, reverse transcriptase, and a host cell trna (31). The initiation of reverse transcription (minus-strand viral DNA synthesis) begins with the extension of a cellular trna that is bound to a specific sequence of viral RNA genome known as the primer-binding site (PBS) (31). The PBS is an 18-nucleotide sequence that is located at the 5 end of the viral genome and is complementary to the 3 -terminal 18-nucleotide sequence of the primer trna (24, 25, 31). The primer trna is selected from the host cell intracellular milieu. Even though different retroviruses select different trna primers for reverse transcription, primer selection is conserved within a group of retroviruses (20, 21). Human immunodeficiency virus type 1 (HIV-1), like most lentiviruses, selects trna 3 as the primer for reverse transcription (20, 21). Previous studies from this laboratory and others have shown that substitution of the PBS to be complementary to alternative trnas results in a virus that can transiently utilize this trna for replication (4, 17, 34). Since it is difficult to manipulate endogenous levels of trna, we have developed a complementation system that required trna to be provided in trans for HIV-1 infectivity (13, 14, 37, 38). As described in previous reports, the alteration of the HIV-1 PBS to be complementary to yeast (Saccharomyces cerevisiae) trna Phe resulted in a virus that was noninfectious in mammalian cells unless yeast trna Phe was provided in trans. Expression of yeast trna Phe from a cdna resulted in a trna that had undergone aminoacylation, nuclear transport, and inclusion into the cycle of host cell protein synthesis (15). The ability of the trna to be transported from the nucleus to the cytoplasm was critical for the selection of the trna as a primer (13). While the system utilizing yeast trna Phe has revealed some of the basic elements of the trna molecule required for primer selection, recent studies have suggested that HIV-1 has evolved several different mechanisms by which trna 3 can be preferentially selected for encapsidation (3, 9, 10, 16, 19). Early studies demonstrated that Gag-Pol was needed for the enrichment of HIV-1 virions with trna 1,2,3, since pseudovirions which did not contain Gag-Pol incorporated a variety of trnas but showed no preference for trna 1,2,3 (16, 19). Re- 9641

2 9642 MCCULLEY AND MORROW J. VIROL. cently, lysyl-trna synthetase has been found within the HIV-1 virion (3, 9). The finding of lysyl-trna synthetase in the virion led to the postulation that a selective incorporation of trna 1,2,3 in the virions is facilitated through interaction with lysyl-trna synthetase. However, the chaperoning of trna 1,2,3 into HIV-1 virions by lysyl-trna synthetase does not explain why trna 3, as opposed to trna 1,2, is preferentially selected for HIV-1 replication, since both trnas are present at relatively equal amounts in the HIV-1 virion (11). Previous studies from this laboratory and others have revealed that HIV-1 with a PBS altered to trna 1,2 had severely reduced capacity for replication and reverted back to utilizing trna 3 following limited in vitro culture (1, 12). In order for trna 1,2 to be stably utilized during replication, these viruses require supplementary mutations within the U5 with the altered PBS (1, 12). Even with the alterations to allow use of trna 1,2, the virus does not replicate with kinetics the same as those of the wild type. Collectively, the results of these studies suggest that trna 3 might have unique properties that would facilitate the preferential selection and use of this trna as a primer for HIV-1 replication. To further understand the preferential selection mechanism of trna 3, it would be advantageous to have a complementation system that requires the selection of exogenously added trna 3. Since the levels of endogenous trna 3 are difficult to manipulate in mammalian cells, we have approached this problem by developing a complementation system which requires the addition of Escherichia coli trna 3 in trans to complement the HIV-1 provirus with the PBS of E. coli trna 3. Modifications to trna 3 have been shown to be important for HIV-1 replication (6, 7). E. coli trna 3 has many base modifications that are either identical or similar to the corresponding mammalian trna 3 base modifications, as well as a high level of sequence identity to mammalian trna 3 (28). In the current study, we have found that the HIV-1 provirus with the E. coli trna 3 PBS requires cotransfection of the plasmid encoding the E. coli trna 3 to generate infectious virus. We have demonstrated that E. coli trna 3 undergoes aminoacylation. Greater amounts of E. coli trna 3 than of yeast trna Phe were required to achieve similar levels of complementation, indicating that no selective preference exists for E. coli trna 3, even though the trna can interact with lysyl-trna synthetase. Furthermore, alteration of the E. coli trna 3 anticodon to trna 1,2 resulted in complementation levels similar to those found with E. coli trna 3, suggesting that additional features of primer selection, other than trna interaction with lysyl-trna synthetase, are probably important for the preferential use of trna 3 as a primer. MATERIALS AND METHODS Tissue culture. 293HEK and JC53 L cells were cultured in Dulbecco s modified Eagle s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% antibiotic (Gibco/BRL, Gaithersburg, MD). All cell cultures were maintained in a 37 C incubator supplemented with 5% CO 2. Proviral plasmids. The plasmid HXB2gpt, which encodes the HIV-1 provirus, was used for the substitution of the PBS in order to create proviral HIV-1 mutants containing a PBS complementary to the first 3 -terminal 18 nucleotides of either yeast trna Phe or E. coli trna (15, 26, 37). A previously constructed puc119 PBS shuttle vector that contains an HIV-1 DNA fragment of the 5 long terminal repeat (LTR), PBS, and the gag leader region was used as a template for PBS mutagenesis (39). Mutagenesis of the PBS in the puc119 PBS shuttle vector to yeast trna Phe PBS was performed using the GeneEditor in vitro site-directed mutagenesis system (Promega, Madison, WI) with the following mutagenic primer: 5 TCTCTAGCAGTGGTGCGAATTCTGTGGATGGAAA GCGAAAGGGAAACCAGAGGAGC3. Mutagenesis of the PBS in the puc119 PBS shuttle vector to PBS complementary to E. coli trna was performed using a QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) with the following primers: 5 CTCTAGCAGTGGTGGGTCGTGC AGGACTTGAAAGCGAAAGGGAAACCAGA3 (forward) and 5 TCTG GTTTCCCTTTCGCTTTCAAGTCCTGCACGACCCACCACTGCTAGAG3 (reverse). The manufacturer s instructions were followed for all mutagenic reactions. The puc119 PBS shuttle vector with the substituted PBS was digested with BssHII and HpaI enzymes in order to release an 868-bp fragment. The fragment was ligated back into phxb2gpt, which was digested with BssHII and HpaI restriction enzymes. Resulting HIV-1 proviral mutants were labeled phxb2(ypbs Phe ) and phxb2(ecpbs ). All mutations were screened by restriction digests. Final mutants were verified by DNA sequencing. trna plasmids. The yeast trna Phe gene was constructed previously (14, 15). The E. coli trna gene was constructed using PCR extension with the following primers: 5 GCAGGGCTCGAGGTCCGGGTCGTTAGCTCAGTTGGTA GAGCAGTTGACTTTTAATC AATTGGTCGCAGG3 (forward) and 5 GCG GACGAAGCTTCCAAAAAATGGGTCGTGCAGGACTTGAACCTGCGA CCAATTGATTAAAAGTCAA3 (reverse). The PCR product was TA cloned into pgem-t Easy vector (Promega, Madison, WI), and the resultant plasmid was digested with XhoI and HindIII in order to release the E. coli trna gene (approximately 100 bp). The E. coli trna gene was then ligated into an LS9 plasmid, downstream of the human U6snRNA promoter, by use of the XhoI and HindIII restriction sites (14, 15, 18). The end product was a plasmid labeled pu6ec. The anticodon bases of E. coli trna were substituted to CUU (corresponding to the anticodon of trna 1,2 ), CUA, UUA, and UCA by use of QuikChange site-directed mutagenesis (Stratagene, La Jolla, CA), pu6ec as the template, and the following primers: 5 GGTAGAGCAGTTGACTCTTAA TCAATTGGTCGCAGGTT3 (CUU forward) and 5 AACCTGCGACCAATT GATTAAGAGTCAACTGCTCTACC3 (CUU reverse); 5 GGTAGAGCAGT TGACTCTAAATCAATTGGTCGCAGGTT3 (CUA forward) and 5 AACCT GCGACCAATTGATTTAGAGTCAACTGCTCTACC3 (CUA reverse); 5 GG TAGAGCAGTTGACTTTAAATCAATTGGTCGCAGGTT3 (UUA forward) and 5 AACCTGCGACCAATTGATTTAAAGTCAACTGCTCTACC3 (UUA reverse); and 5 GGTAGAGCAGTTGACTTCAAATCAATTGGTCGCAGG TT3 (UCA forward) and 5 AACCTGCGACCAATTGATTTGAAGTCAACTG CTCTACC3 (UCA reverse). The resultant plasmids were labeled pu6ec 1,2, pu6ec CUA, pu6ec UUA, and pu6ec UCA. All plasmids were screened with restriction digest reactions and verified by DNA sequencing. Transfections. Complementation of HIV-1 proviral mutants was accomplished by cotransfection of trna-carrying plasmids with HIV-1 proviral mutants into 293HEK cells. Complementation of HIV-1 proviral genomes was described previously (13, 14, 37, 38). Cotransfection was achieved by using a calcium phosphate-based mammalian transfection kit (Stratagene, San Diego, CA) with the instructions scaled down for six-well plates. Briefly, 293HEK cells were seeded at a concentration of cells per well. The cells were cotransfected with 500 ng of proviral plasmid and 50 ng, 100 ng, 500 ng, and 1,000 ng of trna-carrying plasmid 24 h later. At approximately 7 h posttransfection, the cells were washed once with 1 phosphate-buffered saline and supplied with fresh media. Supernatants were collected approximately 48 h posttransfection, centrifuged at 3,000 g, and used in a JC53 L assay to determine luciferase activity, which has been determined to correlate to the units of the infectious virus that is being tested. Viral infection. Supernatants collected from cotransfections were used in a JC53 L reporter assay in order to determine infectious viral units (36). JC53 L cells were seeded 24 h preinfection. Supernatants were diluted 1:3 in DMEM supplemented with 2% FBS and subsequently with two sequential 1:5 dilutions. The cells were incubated with the virus for2hina37 C incubator supplemented with 5% CO 2. After 2 h, DMEM with 10% FBS was added to each well, and the cells were incubated for an additional 48 h. To determine luciferase activity, cells were lysed using M-PER mammalian protein extraction reagent (Pierce, Rockford, IL), and approximately 20 l of each lysed sample was transferred to a microplate. Reporter lysis buffer (Promega, Madison, WI) was added to each sample in the microplate, and the light intensity was measured using a LUMIstar luminometer (BMG Labtech, Durham, NC). Uninfected cells in wells represented the background luciferase activity, which was subtracted from all other samples. Luciferase activity for phxb2(ypbs Phe ) and phxb2(ecpbs ), without complementing trna, was set as the background activity and was subtracted from complementation samples. The luciferase values for two dilutions per sample were averaged. Relative light units (rlu) per ml were calculated by dividing the luciferase values by their corresponding dilution values.

3 VOL. 80, 2006 E. COLI trna 3 COMPLEMENTATION OF HIV REPLICATION 9643 FIG. 1. Mammalian trna 3, Escherichia coli trna 3, and HIV-1 proviral PBS sequences. (A) Cloverleaf depictions of mammalian trna 3 and E. coli trna 3. The boldface nucleotides in the mammalian trna 3 represent the 3 -terminal 18 nucleotides that are complementary to the HIV-1 PBS; the anticodon of the trna is boxed. The boldface nucleotides in the E. coli trna 3 represent base differences from mammalian trna 3. Posttranscriptionally modified bases are shown for both trnas. (B) Schematic representation of the U5 region with proviral sequences from wild-type HXB2 and mutant HXB2(EcPBS ). The underlined sequences correspond to the A-rich regions and the PBS, which are complementary to mammalian trna 3 for the wild-type HXB2 and E. coli trna 3 for the mutant HXB2(EcPBS ). RNA isolation and trna analysis. 293HEK cells were transfected with pu6ec, pu6ec 1,2, pu6ec CUA, pu6ec UUA,orpU6Ec UCA with the use of the mammalian transfection kit (Stratagene, San Diego, CA). The first set of transfected cells was used for the collection of total RNA, while the second set was used for the collection of aminoacyl trnas at 48 h posttransfection. The collection and isolation of total RNA and aminoacylated trnas was performed as previously described (13 15). Total RNA and aminoacyl trna were also isolated from mock-transfected 293HEK cells. Previously constructed oligonucleotide probes that are complementary to yeast trna Phe and mammalian trna 3 were used for Northern analysis (14). E. coli trna was detected using a[ - 32 P]ATP-kinased oligo labeled with the use of Ready-to-go T4 polynucleotide kinase (Amersham Pharmacia Biotech, Piscataway, N.J.) with the following probe: 5 -GGTCGTGCAGGATTCGAACCTGCGACCAATTGATTAAAAG TCAACTGCTCTACCAACTGAGCTAACGAC3. Analyses of total RNA and aminoacyl trna were performed using acidic polyacrylamide gels and Northern blotting (13 15). The membranes were exposed to X-ray film, which was developed using an SRX-101A developer (Konica, Wayne, NJ). Areas of the membrane corresponding to the bands on the X-ray film were excised and counted for radioactivity with an LS 5000TA scintillation counter (Beckman Coulter, Fullerton, CA). In vitro transcription. In vitro transcripts were designed, and reactions were carried out as indicated in a MEGAshortscript T7 kit (Ambion, Austin, TX). In vitro transcripts for yeast trna Phe were prepared using the MEGAshortscript T7 kit with previously obtained oligonucleotides (14). The following oligonucleotides were used with a plasmid template pu6ec in order to produce E. coli trna 3 in vitro transcripts: 5 CTGCAGTAATACGACTCACTATAGGGTCG TTAGCTCAGTTGGT3 (T7Ec forward) and 5 TGGTGGGTCGTGCAG GACTTGAACCT3 (T7Ec reverse). The transcripts were diluted to yield final concentrations of 5 ng, 10 ng, 20 ng, 40 ng, and 80 ng, which were used as standards in the Northern blots. RESULTS Construction of HIV-1 proviral genome with PBS complementary to E. coli trna 3. trna 3 contains several modified nucleotides as a result of posttranscriptional processing. Previous studies have shown that nucleotides within the anticodon loop impart a unique structure to this trna which could account for its preferential selection by HIV-1 as the primer (2, 32). The E. coli trna 3 has near identity with mammalian trna 3 in the anticodon, T C, and D-loop regions (Fig. 1A). Differences between these two trnas exist mainly in the acceptor stem region (3 -terminal 18 nucleotides), which interacts with the PBS of HIV-1. To express E. coli trna 3, we have utilized a plasmid similar to that previously reported for the expression of yeast trna Phe (14, 15). This plasmid contains a U6 snrna polymerase III promoter and nucleotides at the 3 terminus necessary for polymerase III termination. The trna gene was cloned in to the transcription cassette between the

4 9644 MCCULLEY AND MORROW J. VIROL. FIG. 2. Complementation of HXB2(EcPBS ) with the plasmid that encodes E. coli trna 3 and of HXB2(yPBS Phe ) with the plasmid that encodes yeast trna Phe. (A) Representation of luciferase activity obtained from JC53 L cells after infection with viruses that were collected from cotransfections of 293HEK cells with 500 ng of HIV-1 proviral plasmids in the presence or the absence of 500 ng of plasmid encoding the specified trna, relative to that for wild-type HIV-1 transfected at 500 ng. Dilutions of collected supernatants that were acquired from cotransfections were used to infect the JC53 L cell line which contains a luciferase gene under the transcriptional control of the HIV-1 LTR (5, 36). (B) Luciferase activity obtained from JC53 L cells after infection with viruses that were collected from cotransfections of 293HEK cells with 500 ng of proviral plasmids and trna plasmids that were titrated in at the indicated quantities. Luciferase activity, in rlu/ml, for the complementation of plasmid HXB2(yPBS Phe ) with pu6 Phe is represented by closed triangles, and that of plasmid HXB2(EcPBS ) with pu6ec is represented by open squares. Wild-type HXB2 (500 ng and no trna) is represented by a closed square. Background luciferase activity obtained from mock-transfected cultures was subtracted from each sample. Background luciferase activity obtained from HXB2(yPBS Phe ) alone was subtracted from all complementation samples of HXB2(yPBS Phe ) with yeast trna Phe, while background luciferase activity obtained from HXB2(EcPBS ) alone was subtracted from all complementation samples of HXB2(EcPBS ) with E. coli trna 3. The data denote means standard deviations derived from three independent experiments. promoter and the termination signal. The PBS of the HIV-1 proviral genome (HXB2) was modified to be complementary to the 3 -terminal 18 nucleotides of E. coli trna 3. The nucleotides of the wild-type HIV-1 PBS and the altered HIV-1 E. coli PBS have a degree of sequence variation sufficient to preclude the native trna primer from binding to the altered HIV-1 PBS (Fig. 1B). Complementation of HIV-1 genomes by trna supplied in trans. Previous studies from our laboratory have shown that a mutation within the first 9 nucleotides of the PBS can have a drastic impact on the infectivity of wild-type HIV (33). Thus, the nucleotide variation that exists between the wild type HIV-1 PBS and the altered HIV-1 PBS, as well as between the 3 -terminal 18 nucleotides of E. coli trna 3 and mammalian trna 3, should preclude the use of the mammalian trna 3 by the altered HIV-1. To determine whether the E. coli trna 3 would complement the replication of the altered HIV-1 proviral genome (PBS to E. coli trna 3 ), cotransfection experiments were done with the proviral plasmid (phxb2ecpbs ) containing the altered PBS and with different amounts of the plasmid (pu6ec ) encoding E. coli trna 3. For comparison, we utilized the HIV-1 provirus in which the PBS was altered to be complementary to yeast trna Phe and plasmid (pu6 Phe ) encoding the cdna of yeast trna Phe. For these studies, the production of infectious virus was measured by using a JC53 L assay, in which a HeLa indicator cell line was infected with viruses recovered from cotransfections. The indicator cell line contains a luciferase gene under the control of the HIV-1 LTR. The expression of luciferase is dependent upon infection, reverse transcription, and expression of Tat (5, 36). Consistent with our previously reported results with yeast trna Phe,we found that no infectious virus was produced unless the plasmid encoding yeast trna Phe was provided in the cotransfection and that increasing the amounts of plasmid encoding yeast trna Phe resulted in an increase in infectious virus, as determined by the luciferase activity induced in JC53 L cells, to a level of approximately 10 6 over background (proviral plasmid transfected without trna Phe ) (Fig. 2A and B) (14, 15). We next tested the complementation system, which requires cotransfection of HIV-1 proviral plasmid containing a PBS to E. coli trna 3 in conjunction with the plasmid encoding E. coli trna 3. We obtained a low basal level of luciferase activity (approximately 1,000 light units) after transfection of the proviral plasmid alone, in the absence of the plasmid encoding E. coli trna 3. Cotransfection of the E. coli trna 3 plasmid in conjunction with the altered HIV-1 proviral plasmid (PBS to E. coli trna 3 ) resulted in a level of production of infectious virus that was approximately fivefold lower than that of wildtype HIV-1 (Fig. 2A and B). Increasing the amounts of the E. coli trna 3 plasmid in cotransfections resulted in an increase of infectious virus that reached a plateau at a level approximately greater than that of the background control (no E. coli trna 3 ) (Fig. 2B). Surprisingly, the overall levels of the infectious virus generated in the E. coli trna 3 complementation system under these conditions were approximately fivefold less than those for the same system with yeast trna Phe (Fig. 2B). We next wanted to investigate the reason for the lower complementation in the E. coli trna 3 system. In previous studies, we have shown that the aminoacylation of yeast

5 VOL. 80, 2006 E. COLI trna 3 COMPLEMENTATION OF HIV REPLICATION 9645 FIG. 3. Expression of E. coli trna 3 in mammalian cells. (A) Analysis of aminoacylation for E. coli trna 3 and E. coli trna 1,2. The migration of the aminoacylated (AA) and deacylated (DA) samples is shown. Cytoplasmic trnas were collected from 293HEK cells that were transfected with pu6 Phe, pu6ec, and pu6ec 1,2. All cytoplasmic RNA was isolated under acidic conditions, and 3.7 g of the RNA was loaded per well. Lanes 1, 2, 9, and 10 were loaded with cytoplasmic RNA from mock transfection; lanes 3, 4, 11, and 12 were loaded with cytoplasmic RNA from pu6ec transfection; lanes 5, 6, 13, and 14 were loaded with cytoplasmic RNA from pu6ec 1,2 transfection; and lanes 7, 8, 15, and 16 were loaded with cytoplasmic RNA from pu6 Phe transfection. Lanes 1 to 8 were probed for E. coli trna 3, while lanes 9 to 16 were probed for mammalian trna 3. Deacylated controls were prepared by adjustment of ph to basic conditions and incubation for 1hat42 C. Deacylated samples are shown in lanes 1, 3, 5, 7, 9, 11, 13, and 15. The exposure times for the blots varied. (B) Relative ratio of E. coli trna 3 molecules to yeast trna Phe. 293HEK cells were transfected with 500 ng of pu6ec and pu6 Phe. Total RNA was collected, and 15 g was loaded per lane (Northern blot). In vitro-transcribed standards of E. coli trna and yeast trna Phe were loaded at 5 ng, 10 ng, 20 ng, 40 ng, and 80 ng per lane, respectively. The blots were probed for E. coli trna and yeast trna Phe and exposed to X-ray film. Areas of the membrane corresponding to the bands on film were excised and counted for radioactivity with a scintillation counter. Known amounts of in vitro-transcribed trna were used to generate a standard curve (R ). Using this curve, we found that the amount of trna molecules per sample for E. coli trna 3 was 0.42 ng per 15 g total RNA and that for yeast trna Phe was 8.91 ng per 15 g total RNA. (C) Luciferase activity obtained from JC53 L cells after infection with viruses that were collected from cotransfections of 293HEK cells with 500 ng of proviral plasmids and trna plasmids that were titrated in at the indicated quantities. Note that yeast trna Phe had 20 times less plasmid DNA than E. coli trna 3 to normalize amounts of intracellular E. coli trna 3 and yeast trna Phe. Subsequent analysis of intracellular levels of each trna expressed at each concentration revealed four times more E. coli trna 3 than yeast trna Phe. Carrier DNA (puc19) was included with yeast trna Phe plasmid to account for lower DNA concentrations during calcium phosphate cotransfections. Luciferase activity, in rlu/ml, for complementation of plasmid HXB2(yPBS Phe ) with pu6 Phe is represented by closed triangles, and that of plasmid HXB2(EcPBS ) with pu6ec is represented by open squares. Background luciferase activity obtained from mock-transfected cultures was subtracted from each sample. Background luciferase activity obtained from HXB2(yPBS Phe ) alone was subtracted from all complementation samples of HXB2(yPBS Phe ) with yeast trna Phe, while background luciferase activity obtained from HXB2(EcPBS ) alone was subtracted from all complementation samples of HXB2(EcPBS ) with E. coli trna 3. The data denote means standard deviations derived from three independent experiments. trna Phe was an important element in facilitating the selection of this trna as a primer for HIV-1 replication (14, 15). One explanation for the lower complementation activity of E. coli trna 3 could be that it does not undergo aminoacylation in mammalian cells. However, Schimmel s group previously reported that E. coli trna 3 is aminoacylated by mammalian lysyl-trna synthetase (27). To confirm this result, we analyzed the aminoacylation status of E. coli trna 3 in mammalian cells. Following the transfection of the pu6ec plasmid encoding the cdna for E. coli trna 3, we found that majority of the E. coli trna 3 was aminoacylated (Fig. 3A); the minor levels of deacylated E. coli trna 3 noted in this experiment were also found by analysis of yeast trna Phe in cells transfected with the pu6 Phe plasmid encoding the cdna for yeast trna Phe and were possibly due to the hydrolysis of the amino acid-trna bond during the processing of the RNA sample. Next, we compared the total amounts of yeast trna Phe and E. coli trna 3 generated in cells following transfection of their respective cdnas. In this case, we titrated in various amounts of each plasmid DNA encoding the trnas and determined the quantity of trna molecules compared to known standards generated through in vitro transcription. Surprisingly, we found that the levels of E. coli trna 3 were approximately 20 times less than those for yeast trna Phe (Fig. 3B). The reason for this difference in trna amounts following transfection of plasmids with essentially the same promoter elements for the trnas was not clear, although this phenomenon could be due to differential regulation of trna pools in the cell for trna versus trna Phe. To follow up this result, we then adjusted the levels of the plasmids encoding E. coli trna 3 and yeast trna Phe to give equal levels of production of infectious virus (Fig. 3C). Under these conditions, we found that from the four

6 9646 MCCULLEY AND MORROW J. VIROL. FIG. 4. Cloverleaf diagrams of lysine trna molecules. The anticodon of E. coli trna 3 was substituted from UUU to CUU in order to represent trna 1,2. The U34C base change is indicated by an arrow. Mammalian trna 1,2 is shown for comparison. Boldface nucleotides correspond to the 3 -terminal 18 nucleotides that interact with the PBS. amounts of trna plasmids transfected, an average of four times more intracellular E. coli trna 3 than yeast trna Phe was needed for the production of equal amounts of virus. Thus, we conclude that E. coli trna 3 can function as a primer for HIV-1 but exhibits no enhanced selection/complementation compared to that for yeast trna Phe or that for mammalian trna. Complementation of HIV-1 with E. coli trna 1,2 provided in trans. We next wanted to resolve the question of whether HIV-1 with a PBS complementary to E. coli trna 3 would show a preferential selection for E. coli trna 3 versus E. coli trna 1,2. Earlier studies have shown that although both trna 3 and trna 1,2 are found in HIV-1 virions, HIV-1 has a clear preference for trna 3, since the alteration of the PBS to be complementary to trna 1,2 did not result in a virus that could utilize trna 1,2 (1, 12). Mutations within U5, or the primer activation site, are required for this virus to maintain a PBS complementary to trna 1,2 following in vitro culturing; however, these viruses grow more slowly than the wild type (1, 12, 23). As a result, HIV-1 has evolved a clear preference for the selection of trna 3 over trna 1,2. To determine if this is also the case for the HIV-1 provirus designed to use E. coli trna 3, we modified the anticodon region of E. coli trna 3 so that it corresponded to that for trna 1,2. The anticodon for trna 1,2 is CUU, whereas the anticodon for trna 3 is UUU (Fig. 4). We first determined if this anticodon base mutation would affect the capacity of this E. coli trna 1,2 to be aminoacylated, given that the anticodon of trna is also an important identity element for synthetase recognition. We analyzed the aminoacylation status of E. coli trna 1,2 generated from transfection. No clear differences were observed between the level of aminoacylation of E. coli trna 3 and that for E. coli trna 1,2, indicating that both trnas are competent to interact with mammalian lysyl-trna synthetase (Fig. 3A). Next, we tested the ability of the E. coli trna 1,2 to complement the replication of HIV-1 with the PBS complementary to E. coli trna 3. Titration of increasing amounts of plasmid pu6ec 1,2 and pu6ec encoding E. coli trna 1,2 and E. coli trna 3 resulted in the complementation of HIV-1. Thus, the substitution of the E. coli trna 3 anticodon to that for trna 1,2 did not have an impact on the capacity of this trna to complement the replication. In fact, analysis of the complementation levels for all concentrations of plasmid analyzed revealed that the amount of infectious virus recovered was somewhat greater with the plasmid encoding E. coli trna 1,2 than with the plasmid encoding E. coli trna 3 (Fig. 5A). Finally, we compared the total amounts of E. coli trna 1,2 and E. coli trna 3 found in transfected cells. Using identical amounts of plasmid, we found that intracellular E. coli trna 3 levels were approximately two times lower than those for E. coli trna 1,2 (Fig. 5B). If higher amounts of E. coli trna 1,2 in the cell are taken into account, then E. coli trna 1,2 and E. coli trna 3 complement the altered HIV-1 genome at similar levels, indicating that there is no preference by the HIV-1 provirus for trna 3. Complementation of HIV-1 with E. coli trna mutants provided in trans. Alteration of nucleotide U35 in trna 3 to A or G leads to a severe loss of aminoacylation due to poor recognition of the trna by the lysyl-trna synthetase, while alterations of U34 and U36 have a less severe effect on aminoacylation (22, 29, 30). Because our earlier studies had found that aminoacylation of the trna is important for primer selection, we decided to determine whether or not this was also the case for E. coli trna 3. To address this point, we generated mutations within the anticodon region of E. coli trna 3 that altered the anticodon from UUU to CUA, to UUA, and to UCA (Fig. 6A). We then compared the levels of complementation of these mutant trnas with those for wild-type E. coli trna 3. Analysis of the complementation for each of the mutant trna revealed that the level of infectious virus for the mutant with the anticodon CUA was approximately equal to that of the wild-type E. coli trna 3 (Fig. 6B). Mutation of the anticodon UUU to UCA or UUA somewhat compromised the capacities of these mutant trnas to complement HIV-1 replication to the level found with E. coli trna 3 (Fig. 6B). We

7 VOL. 80, 2006 E. COLI trna 3 COMPLEMENTATION OF HIV REPLICATION 9647 FIG. 5. Complementation of HXB2(EcPBS ) with plasmids that encode E. coli trna 3 and E. coli trna 1,2. (A) 293HEK cells were cotransfected with 500 ng of proviral plasmids and with trna plasmids that were titrated in at the indicated quantities. Dilutions of collected supernatants that were acquired from cotransfections were used to infect the JC53 L cell line which contains a luciferase gene under the transcriptional control of the HIV-1 LTR (5, 36). Luciferase activity, in rlu/ml, for complementation of plasmid HXB2(EcPBS ) with pu6ec 1,2 is represented by closed squares, and that of plasmid HXB2(EcPBS ) with pu6ec is represented by closed diamonds. Background luciferase activity obtained from mock-transfected cultures was subtracted from each sample. Background luciferase activity obtained from HXB2(EcPBS ) alone was subtracted from all complementation samples of HXB2(EcPBS ) with E. coli trna. The data denote means standard deviations derived from three independent experiments. (B) Relative ratio of E. coli trna 3 to E. coli trna 1,2. 293HEK cells were transfected with 500 ng of pu6ec and pu6ec 1,2. Total RNA was collected, and 15 g was loaded per lane (Northern blot). In vitro-transcribed standards of E. coli trna were loaded at 5 ng, 10 ng, 20 ng, 40 ng, and 80 ng per lane, respectively. The blots were probed for E. coli trna and exposed to X-ray film. Areas of the membrane corresponding to the bands on film were excised and counted for radioactivity with a scintillation counter. Known amounts of in vitro-transcribed trna were used to generate a standard curve (R ). Using this curve, we found that the amount of trna molecules per sample of E. coli trna 3 was 0.42 ng per 15 g total RNA and that for E. coli trna 1,2 was 1.00 ng per 15 g total RNA. next determined whether the levels of complementation were consistent with the levels of aminoacylation of the mutant trnas. We found that trna mutants with CUA and UUA anticodon alteration were aminoacylated, albeit at low levels, while the mutant with UCA showed no detectable aminoacylation (Fig. 6C). Interestingly, the mutant with the CUA anticodon had complementation, but not aminoacylation, comparable to that of E. coli trna 3. All three altered trnas demonstrated considerably less aminoacylation than the E. coli trna 3. The observed results suggest that primer selection is not entirely dependent on trna aminoacylation. DISCUSSION In the current study, we have further investigated the mechanism for the preferential selection of trna 3 as the primer for HIV-1 reverse transcription. A complementation system which utilizes E. coli trna 3 as the primer for HIV-1 reverse transcription was developed. The PBS of the HIV-1 proviral genome was modified to be complementary to the 3 -terminal 18 nucleotides of E. coli trna 3. The production of infectious virus was dependent upon the expression of E. coli trna 3. However, no preference was found for trna 3, yeast trna Phe,ortRNA 1,2 with respect to complementation levels. Finally, the lack of aminoacylation for trna 3 anticodon mutants did not correlate to the complementation levels produced by cotransfection of those mutant trna plasmids with the HIV-1 proviral plasmid containing the PBS complementary to E. coli trna 3, indicating that interaction with the lysyl-trna synthetase does not entirely explain HIV-1 primer preference. Previous studies from this laboratory and others have addressed the issues of primer preference by using HIV-1 proviruses in which the PBS was altered to be complementary to trnas other than trna 3 (4, 17, 34). In each case, it was found that the resulting virus was unstable and reverted back to utilize trna 3 as the primer, highlighting the fact that HIV-1 prefers to select trna 3 as the primer for replication. Previous studies have suggested that viral (HIV-1 Gag-Pol) and cellular (lysyl-trna synthetase) proteins are important for the preferential selection and use of trna 3 (3, 9, 10). Since it is difficult to manipulate the endogenous levels of trna 3, our earlier studies used a complementation system by supplying yeast trna Phe in trans (14, 15, 37, 38). A limitation of this yeast trna Phe complementation system, though, was the inability to access the viral proteins or lysyl-trna synthetase which might be needed for preferential selection of trna 3. The use of E. coli trna 3 circumvents some of these issues because, as shown in our studies, E. coli trna 3 is aminoacylated following expression in mammalian cells, indicating the interaction with the mammalian synthetase. Since the anticodon loop of E. coli trna 3 contains transcriptional modifications analogous to mammalian trna 3 modifications and the trnas are alike in sequence, we expected that complementation using this system would be enhanced compared to the yeast trna Phe complementation (2, 28, 32). However, we found that the absolute complementation levels observed for E. coli trna 3 were lower than those for yeast trna Phe. The absolute differences in complementation levels were most likely due to the smaller amounts of E. coli trna 3 expressed in the transfected cells, even though both trnas were expressed from identical plasmids. To achieve similar levels of complementation, we still needed approximately four times more intracellular trna 3 than trna Phe. Thus, there was no preferential selection of E. coli trna 3, even though this trna could interact with lysyl-trna synthetase. One of the unique features of the HIV-1 primer selection is

8 9648 MCCULLEY AND MORROW J. VIROL. Downloaded from FIG. 6. Complementation of HIV-1 infectivity with E. coli trna 3 mutants. (A) Cloverleaf structures of mutant trna. The anticodon of E. coli trna 3 was mutated from UUU to CUA, to UUA, and to UCA. Boldface nucleotides indicate the anticodon of each trna. Base changes are indicated by arrowheads. (B) Complementation of HXB2(EcPBS ) infectivity with plasmids that encode E. coli trna anticodon mutants. 293HEK cells were cotransfected with 500 ng of proviral plasmids and trna plasmids that were titrated in at the indicated quantities. Dilutions of supernatants that were collected from cotransfections were used to infect the JC53 L cell line (5, 36). Luciferase activity, in rlu/ml, for complementation of plasmid HXB2(EcPBS ) with pu6ec is represented by closed diamonds, that with pu6ec CUA is represented by closed squares, that with pu6ec UCA is represented by closed triangles, and that with pu6ec UUA is represented by. Background luciferase activity obtained from mock-transfected cultures was subtracted from each sample. Background luciferase activity obtained from HXB2(EcPBS ) alone was subtracted from all complementation samples of HXB2(EcPBS ) with E. coli trna anticodon mutants. The data denote means standard deviations derived from three independent experiments. Note that the standard deviation at 1 g for pu6ec UUA is slightly shifted for clarity in viewing. (C) Aminoacylation for E. coli trna anticodon mutants. The migration of the aminoacylated (AA) and deacylated (DA) samples is shown. Cytoplasmic trnas were collected from 293HEK cells that were transfected with pu6ec, pu6ec CUA, pu6ec UUA, and pu6ec UCA. All cytoplasmic RNA was isolated under acidic conditions. Lanes 1 and 2 were loaded with cytoplasmic RNA from pu6ec UCA transfection; lanes 3 and 4 were loaded with cytoplasmic RNA from pu6ec UUA transfection; lanes 5 and 6 were loaded with cytoplasmic RNA from pu6ec CUA transfection; lanes 7 to 10 were loaded with cytoplasmic RNA from pu6ec transfection; and lanes 11 and 12 were loaded with cytoplasmic RNA from mock transfection. All samples were probed for E. coli trna. Deacylated controls were prepared by adjustment of samples to basic conditions and incubation for 1hat42 C. Deacylated samples are shown in lanes 2, 4, 6, 8, 10, and 12. on April 25, 2018 by guest the preference for trna 3 over trna 1,2. This is not due to the inability of trna 1,2 to be incorporated into HIV-1 virions, since previous studies have shown that trna 1,2 is generally present at levels equal to and sometimes greater than those for trna 3 (11). If incorporation into the virion was the sole determinant for primer selection, then one would suspect that an HIV-1 provirus which might utilize trna 1,2 rather than trna 3 as the primer for reverse transcription could be generated. Previous studies have shown that alteration of the proviral PBS to be complementary to trna 1,2 does not result in a virus that stably utilizes trna 1,2 as a primer for reverse transcription (1, 12, 23). It is only through additional mutations in the U5 region (A-loop or primer activation signal) that the virus can stably utilize trna 1,2. However, even under these conditions, the virus has a replication capacity that is reduced compared to that of the wild-type virus. To further explore this

9 VOL. 80, 2006 E. COLI trna 3 COMPLEMENTATION OF HIV REPLICATION 9649 selectivity for trna 3, we substituted the E. coli trna 3 anticodon to correspond to that for trna 1,2 and then analyzed the capacity of this trna to complement the HIV-1 proviral genome in which the PBS was complementary to E. coli trna 3. While the E. coli trna 1,2 did complement this genome, we were surprised to find that the levels of complementation following normalization for intracellular trna levels were similar to those for trna 3, indicating that there was no preferential selection and use of E. coli trna 3 over E. coli trna 1,2. The facts that both E. coli trna 1,2 and E. coli trna 3 interact with the lysyl-trna synthetase (as confirmed by the analysis of the aminoacylation status of these trnas following transfection) and that the virus shows no preference for the E. coli trna 3 over E. coli trna 1,2 imply that the preference for mammalian trna 3 over trna 1,2 may be more complex than the capacity to interact with lysyl-trna synthetase. A further insight into the complexity of primer selection came from our analysis of additional E. coli trna 3 mutants containing substitutions of the anticodon nucleotides. The anticodon of the trna is a critical identity element for synthetase recognition. The substitution of nucleotide U35 in trna 3 to an A or a G leads to the loss of binding and aminoacylation by the lysyl-trna synthetase (22, 29, 30). Upon testing our mutants in the complementation system, we found that certain mutants had complementation levels close to that for E. coli trna 3. The mutant with an anticodon CUA had complementation levels comparable to those for wild-type E. coli trna 3, while trnas with anticodon UCA or UUA had slightly lower levels of complementation, suggesting that the selective preference for trna 3 does not fully reside in the unique features of the trna molecule. That is, structural features of trna 3, such as greater flexibility in the anticodon region, are probably not entirely responsible for the preferential use of trna 3 as the primer for HIV-1 reverse transcription, although it is possible that structural features of trna 3 are more important in the processivity of the reverse transcriptase (2, 6, 21). A previous study suggests that the trna 3 anticodon is a key determinant for the incorporation of the primer by HIV-1 and that packaging correlates with aminoacylation (8). However, our trna 3 UCA mutant, which is not aminoacylated by the synthetase due to the U35C mutation, complements infectivity of the mutant HIV-1 provirus. These results highlight the possibility that primer selection and packaging may be two independent mechanisms. This idea is also supported by our previous studies using a virus that is engineered to use trna His. Analysis of the trna content of this virus revealed that it contained amounts/ratios of trna 1,2,3 similar to those for the wild-type virus (39). Recent studies have confirmed these results by use of viruses which stably use trna His or trna Met (35). Collectively, these results suggest that the selection of the primer used for reverse transcription and the inclusion of the primer in HIV-1 virions might not be linked. Previous studies from our laboratory have suggested that primer selection might be linked with viral translation (14, 15). If this is the case, the availability of certain trnas for use in translation could impact their selection as primers for reverse transcription. The preferential selection of trna 3 as the primer for HIV-1 reverse transcription might be due to a coordinated process between primer selection and viral translation. How this occurs is unknown, but the use of the E. coli trna 3 system will facilitate studies to explore this relationship. ACKNOWLEDGMENTS We thank the members of the Morrow laboratory for helpful suggestions. We thank Adrienne Ellis for preparation of the manuscript. The DNA sequencing was carried out by the UAB CFAR DNA Sequencing Core (AI 27767). C.D.M. acknowledges helpful suggestions from M.A.R. A.M. was supported by training grant T32 AI This research was supported by a grant from the NIH (AI34749). REFERENCES 1. Abbink, T. E. M., N. Beerens, and B. Berkhout Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self trna primer for reverse transcription: involvement of viral RNA sequences and the reverse transcriptase enzyme. J. Virol. 78: Agris, P. F., R. Guenther, P. C. Ingram, M. M. Basti, J. W. Stuart, E. Sochacka, and A. Malkiewicz Unconventional structure of trna()suu anticodon explains trna s role in bacterial and mammalian ribosomal frameshifting and primer selection by HIV-1. RNA 3: Cen, S., H. Javanbakht, S. Kim, K. Shiba, R. C. Craven, A. Rein, K. L. Ewalt, P. Schimmel, K. Musier-Forsyth, and L. Kleiman Retrovirus-specific packaging of aminoacyl-trna synthetases with cognate primer trnas. J. Virol. 76: Das, A. T., B. Klaver, and B. Berkhout Reduced replication of human immunodeficiency virus type 1 mutants that use reverse transcription primers other than the natural trna 3. J. Virol. 69: Derdeyn, C. A., J. M. Decker, J. N. Sfakianos, X. Wu, W. A. O Brien, L. Ratner, J. C. Kappes, G. M. Shaw, and E. Hunter Sensitivity of human immunodeficiency virus type 1 to the fusion inhibitor T-20 modulated by coreceptor specificity defined by the V3 loop of gp120. J. Virol. 74: Isel, C., J. M. Lanchy, S. F. Le Grice, C. Ehresmann, B. Ehresmann, and R. Marquet Specific initiation and switch to elongation of human immunodeficiency virus type 1 reverse transcription require the post-transcriptional modifications of primer trna3. EMBO J. 15: Isel, C., R. Marquet, G. Keith, C. Ehresmann, and B. Ehresmann Modified nucleotides of trna(3) modulate primer/template loop-loop interaction in the initiation complex of HIV-1 reverse transcription. J. Biol. Chem. 268: Javanbakht, H., S. Cen, K. Musier-Forsyth, and L. Kleiman Correlation between trna 3 aminoacylation and its incorporation into HIV-1. J. Biol. Chem. 277: Javanbakht, H., R. Halwani, S. Cen, J. Saadatmand, K. Musier-Forsyth, H. Gottlinger, and L. Kleiman The interaction between HIV-1 Gag and human lysyl-trna synthetase during viral assembly. J. Biol. Chem. 278: Jiang, M., J. Mak, Y. Huang, and L. Kleiman Reverse transcriptase is an important factor for the primer trna selection in HIV-1. Leukemia 8:S149 S Jiang, M., J. Mak, A. Ladha, E. Cohen, M. Klein, B. Rovinski, and L. Kleiman Identification of trnas incorporated into wild-type and mutant human immunodeficiency virus type 1. J. Virol. 67: Kang, S.-M., Z. Zhang, and C. D. Morrow Identification of a human immunodeficiency virus type 1 that stably uses trna 1,2 rather than trna,3 for initiation of reverse transcription. Virology 257: Kelly, N. J., and C. D. Morrow Structural elements of the trna T C loop critical for nucleocytoplasmic transport are important for human immunodeficiency virus type 1 primer selection. J. Virol. 79: Kelly, N. J., and C. D. Morrow Yeast trna Phe expressed in human cells can be selected by HIV-1 for use as a reverse transcription primer. Virology 313: Kelly, N. J., M. T. Palmer, and C. D. Morrow Selection of retroviral reverse transcription primer is coordinated with trna biogenesis. J. Virol. 77: Kohorchid, A., H. Javannbakht, S. Wise, R. Halwani, M. A. Parniak, M. A. Wainberg, and L. Kleiman Sequences within Pr160gag-pol affecting the selective packaging of primer trna,3 into HIV-1. J. Mol. Biol. 299: Li, X., J. Mak, E. J. Arts, Z. Gu, L. Kleiman, M. A. Wainberg, and M. A. Parniak Effects of alterations of primer-binding site sequences on human immunodeficiency virus type 1 replication. J. Virol. 68: Lobo, S. M., and N. Hernandez A7bpmutation converts a human RNA polymerase II snrna promoter into an RNA polymerase III promoter. Cell 58: Mak, J., M. Jiang, M. A. Wainberg, M.-L. Hammarskjold, D. Rekosh, and L. Kleiman Role of Pr160 gag-pol in mediating the selective incorporation