UNDERSTANDING RECEPTOR ADAPTATION AND CO-RECEPTOR USE FOR FELINE LEUKEMIA VIRUSES. Naveen Hussain

Transcription

1 UNDERSTANDING RECEPTOR ADAPTATION AND CO-RECEPTOR USE FOR FELINE LEUKEMIA VIRUSES By Naveen Hussain A thesis submitted in conformity with the requirements for the degree of Masters of Science Graduate Department of Molecular Genetics University of Toronto Copyright by Naveen Hussain 2009

2 ii Understanding Receptor Adaptation And Co-Receptor Use For Feline Leukemia Viruses Masters of Science, 2009 Naveen Hussain Graduate Department of Molecular Genetics University of Toronto ABSTRACT Feline leukemia viruses (FeLVs) are pathogenic retroviruses of the domestic cat. FeLV transmission and emergence of pathogenic variants show striking similarity to HIV pathogenesis. The emergence of pathogenic subgroup-c FeLV from the transmitted subgroup-a FeLV coincides with a switch in host receptor used for infection as a result of mutations in the viral envelope protein (Env). I have characterized a novel FeLV Env that may represent an evolutionary intermediate between FeLV-A and FeLV-C. I have also reported evidence suggesting that FeLVs may use co-factors/co-receptors for infection. I have found that FeLVs inefficiently infect murine NIH3T3 cells overexpressing FeLV receptors (NIH3T3/Receptor). I have provided evidence that the low infection is caused by a block at a post-binding but pre-entry stage of FeLV infection. Furthermore, fusion of NIH3T3/Receptor cells with highly susceptible cells rescues inhibition to infection suggesting that FeLVs, like HIV, may also use co-receptors for infection.

3 iii ACKNOWLEDGEMENTS I would like to thank a few people without whom this degree would not have been possible. First of all like to thank my supervisor Dr. Chetankumar Tailor for providing me the opportunity to work in his lab and to explore the exciting world of FeLVs. Thank you for always being supportive and for your ever optimistic outlook. I have learnt so much from you. I would also like to thank all the members of the Tailor Lab. Thank you Rati for acclimatizing me to the lab, and for teaching me the ins and outs of the Tailor lab. You will be greatly missed. Thank you Michelle for all your support, guidance, and expert advice, not just on matters relating to FeLV but life in general. I am so grateful for all your help. Thank you Zvi for your support and camaraderie. I really enjoyed working across the bench from you. And finally, thank you Simon for your guidance and mentorship through every step of my degree. You are such a great scientist, and I am very glad that I joined the lab with you as the post-doc. I would also like to thank my committee members, Dr. John Brumell and Dr. Leah Cowen. Thank you for challenging me and for providing support and guidance. I would also like to thank all the members of the seventh floor Elm wing at Sickkids, especially the members of the Sherman, Opavsky and Lingwood lab. It was really great working with all of you. Finally I would like to thank my family and friends for all their support. I specially want to thank my husband. Thank you for supporting me on every step of the way, for your understanding, and for being patient with me. I could not have done it without you.

4 iv TABLE OF CONTENTS ABSTRACT... ii ACKNOWLEDGEMENTS... iii TABLE OF CONTENTS... iv LIST OF FIGURES... ix LIST OF TABLES... xi LIST OF ABBREVIATIONS... xii 1 INTRODUCTION Overview Retroviruses Classification of retroviruses Structure of retroviruses Life cycle of simple retroviruses Gammaretroviruses Subgroup classification Envelope glycoprotein of γ-retroviruses Mechanism of envelope-receptor interaction for γ-retroviruses Pseudotyped viruses to study envelope receptor interactions Feline leukemia viruses (FeLVs)... 13

5 v Historical perspective Subgroups of FeLV Receptors Gammaretrovirus receptors FeLV receptors FeLV-A receptor FeLV-B receptor FeLV-C receptor FeLV-T receptor Determinants of FeLV receptor specificity and pathogenicity Relationship to HIV Use of co-receptors/co-factors Receptor adaptation and emergence of pathogenic strains Thesis Aims and Outline UNDERSTANDING RECEPTOR ADAPTATION AND EVOLUTION OF PATHOGENIC FELINE LEUKEMIA VIRUS BY CHARACTERIZING NATURAL VIRUS VARIANT FA Abstract Introduction Isolation of novel FeLV Env sequences Initial characterization of FA

6 vi 2.3 Materials and Methods Cell lines Generation of receptor expressing cells Generation of FGA mutant envelopes Viruses and infection studies SU binding assay Interference assay Isolation of porcine ASCT Results Characterization of FA27-53 Env FA27-53 Env expressing viruses infect porcine and human cells Viruses expressing FeLV-A mutant Envs with a single aspartic acid mutation in VRA have an expanded host range to porcine cells Surface units of FeLV-A mutant Envs do not bind to porcine cells Viruses expressing FA27-53 Env infect cells expressing the FeLV-A receptor THTR1 and the RD114 receptor ASCT2 for infection RD114 virus interferes with FA27-53 infection Cells overexpressing the porcine ASCT2 are infected by FA27-53 pseudotyped virus Detection of cell line contamination Packaging cell lines producing FA27-53 and FGA-ND expressing virus were contaminated with a replication competent virus with an RD114 like host range... 46

7 vii Contaminated packaging cell lines and feline CCC cells express replication competent RD114 virus Discussion Why was the RD114 contamination not detected earlier in the study? How did the packaging cells get contaminated with RD114 virus? POTENTIAL USE OF CO-FACTORS/CO-RECEPTORS BY FELINE LEUKEMIA VIRUSES Abstract Introduction Materials and Methods Cell lines Viruses and infection studies SU binding assay Analysis of receptor expression Testing receptor glycosylation Generation of hybrid cell lines Results FeLVs infect NIH3T3 cells expressing specific FeLV receptors inefficiently compared to Mus dunni (MD) cells expressing specific FeLV receptors Low titer on NIH3T3/Receptor cells is not a result of a defect in virus infection post entry... 68

8 viii Inefficient FeLV infection on NIH3T3/Receptor cells are not due to low receptor expression FeLV SU binds efficiently to both NIH3T3/Receptor and MD/Receptor cells Inefficient FeLV infection on NIH3T3/Receptor cells cannot be attributed to glycosylation of cell surface receptor Fusion of NIH3T3/Receptor cells to MD cells rescues FeLV infection FeLVs infect BHK/Receptor cells inefficiently and this inefficient infection can be rescued when BHK/Receptor cells are fused to MD cells The co-factor required for efficient FeLV infection on MD cells is not a secreted factor Discussion GENERAL DISCUSSION AND FUTURE DIRECTIONS Evolution of pathogenic FeLVs Contamination with endogenous retroviruses Potential use of co-factors/co-receptors by FeLVs REFERENCE LIST...88

9 ix LIST OF FIGURES Chapter 1 Figure 1-1 Figure 1-2 Figure 1-3 Figure 1-4 Figure 1-5 Figure 1-6 Virion structure of a simple retrovirus...4 Genome of a simple retrovirus...5 Life cycle of a simple retrovirus...6 Model for retroviral interference...8 γ-retrovirus envelope glycoprotein...10 Generation of pseudotyped viruses to study Env-Receptor interaction...14 Chapter 2 Figure 2-1 Figure 2-2 Figure 2-3 Figure 2-4 Figure 2-5 Schematic showing isolation of virus envelope clones from natural virus isolates...31 Sequence alignment of FA27 Env isolates...32 Infection of FA27-53 on porcine cells...39 Sequence alignment, infection studies and binding assays for FeLV-A mutants...41 Infection assays and binding studies on cells expressing human γ-retrovirus receptors...43 Figure 2-6 Interference between RD114 and FA Figure 2-7 Figure 2-8 Figure 2-9 Amino acid sequence comparison of porcine and human neutral-amino-acid transporter, ASCT Mediation of infection by porcine ASCT Sequence alignment between FGA, FGA-ND (V210A) and FGA-ND...47

10 x Figure 2-10 Figure 2-11 Schematic showing the outcomes of the troubleshooting assay...50 Amplification of RD114 envelope from packaging cell lines...52 Chapter 3 Figure 3-1 Infection study on murine NIH3T3 and MD cells expressing different γ- retrovirus receptors...68 Figure 3-2 Figure 3-3 Figure 3-4 Figure 3-5 Receptor expression, receptor binding and receptor glycosylation on NIH3T3 cells...70 Generation of hybrid cell lines...72 Infection study on MD-NIH3T3/Receptor hybrid cells...73 Infection study on MD-BHK/Receptor hybrid cells...74 Chapter 4 Figure 4-1 Alignment of the VRA sequence for FeLV-A and the novel Envs FS-40, FS-4 and FS

11 xi LIST OF TABLES Chapter 1 Table 1-1 Table 1-2 Classification of retroviruses...2 γ-retrovirus receptors...18 Chapter 2 Table 2-1 Table 2-2 Table 2-3 Table 2-4 Table 2-5 Isolation of novel Env sequences from the primary isolate FA27 and their subgroup prediction...30 Titers for pseudotyped viruses expressing the Envs isolated from FA27, FeLV-A Glasgow, and FeLV-C Sarma on a panel of cell lines from different species...33 Titers for pseudotyped virus expressing the recloned FGA-ND and FA Infection data for re-pseudotyped FeLV-C, FGA, RD114, FGA NDV210A, FGA-ND and FA Infection data for the second round of infection from troubleshooting assay...51

12 xii LIST OF ABBREVIATIONS A-MLV Amphotropic MLV ASCT1 ASCT2 CA Alanine/serine/cysteine/threonine transporter 1/ neutral amino acid transporter Alanine/serine/cysteine/threonine transporter 2/ neutral amino acid transporter Capsid CCR5 Chemokine (C-C motif) receptor 5 CXCR4 Chemokine (C-X-C motif) receptor 4 DBA EDTA E-MLV Env FACS FBS FCS FeLV FGA Diamond Blackfan Anemia Ethylenediaminetetraaceticacid Ecotropic murine leukemia virus Envelope protein Fluorescence-activated cell sorting Fetal bovine serum Prototype FeLV-C, Sarma Feline leukemia virus Prototype FeLV-A, Glasgow FLVCR1 Feline leukemia virus subgroup C receptor 1 GALV HA HIV HSC HTLV HRP IN LTR Gibbon ape leukemia virus Hemagglutinin Human immunodeficiency virus Hematopoietic stem cell Human T-lymphotropic virus Horseraddish-Peroxidase Integrase Long terminal repeat

13 xiii MA MLV NC PBS PERV Matrix Murine leukemia virus Nucleocapsid Phosphate buffered saline Porcine endogenous virus Pit1 Inorganic phosphate symporter 1 Pit2 Inorganic phosphate sympoter 2 PCR P-MLV Pol PR PRR PRCA RBD RD114 RT SDS-PAGE SU Polymerase chain reaction Polytropic murine leukemia virus Polymerase Protease Proline rich region Pure red cell aplasia Receptor binding domain Feline endogenous virus Reverse transcriptase Sodium dodecyl sulfate polyacrylamide gel electrophoresis Surface unit of viral envelope protein THTR1 Thiamine transporter 1 TM VRA VRB VRC X-MLV Transmembrane region of viral envelope protein Variable region A of viral envelope protein Variable region B of viral envelope protein Variable region C of viral envelope protein Xenotropic murine leukemia virus

14 1 1 INTRODUCTION 1.1 Overview Retroviruses are a large family of enveloped RNA viruses found in animals and humans. They induce a diverse range of diseases that include lymphoma, leukemia, severe anemia, neurological disorders, and immune deficiency. Although human retroviruses such as human immune deficiency virus (HIV) and human T-lymphotropic virus (HTLV) have been widely studied because of their impact on human health, the study of animal retroviruses such as murine leukemia viruses (MLVs) and feline leukemia viruses (FeLVs) has received considerable attention because of their ability to be used as vectors for human gene therapy. This thesis focuses on the study of FeLVs, specifically how the envelope protein (Env) of FeLVs bind to specific host cell surface receptors to gain entry into host cells. This study is important because many of the FeLV induced diseases, which are often governed by Envreceptor interactions, are highly related to human diseases. Thus the study of FeLV Envreceptor interaction provides a model to study human diseases. Moreover the pathogenesis and host receptor adaptation of FeLVs shows striking analogy to HIV pathogenesis and receptor adaptation, suggesting an important relationship between FeLVs and HIV. Finally, FeLVs in particular the subgroup C FeLV efficiently infect human hematopoietic stem cells making FeLVs excellent candidate vectors for human gene therapy. In this thesis I report on the characterization of a novel FeLV that could be an evolutionary intermediate that arises during the emergence of pathogenic FeLVs in domestic cats. Furthermore I report evidence suggesting that in addition to using their cognate receptors, FeLVs may use co-receptors for infection. My findings could have important implications for understanding FeLV entry and pathogenesis and for developing efficient FeLV vectors for gene therapy. 1.2 Retroviruses Retroviruses (Family: Retroviridae) are of great interest, not only because they cause several diseases in humans, but also because of their unique biology. Retroviruses are a large

15 family of enveloped RNA viruses defined by common replicative properties. While in most organisms genetic information is transcribed from DNA into RNA, retroviruses make a DNA copy of their RNA genome in infected cells using the viral enzyme reverse transcriptase. The viral DNA is then stably integrated into the host genome where the viral genes are replicated and transcribed using the host cell machinery. Due to this unique replication strategy retroviruses are used as tools in molecular biology and as therapeutic agents for retroviral gene therapy Classification of retroviruses The Retroviridae family was previously divided into three subfamilies; Oncovirinae, Spumavirinae, and Lentivirinae. This classification was based on virion morphology, type of disease caused by the virus, and host species etc. Retroviruses are currently divided into seven genera (Table 1-1). This new classification is based on sequence similarity in the retroviral genome, and accurately correlates with evolutionary relationships of retroviruses (Petropoulos, 1997). The genera are classified as simple or complex, based on their genome organization. Table 1-1 Classification of retroviruses. Genus Species* Genome Structure Alpharetrovirus Avian leukosis virus Simple (α-retrovirus) Betaretrovirus Mouse mammary tumor virus, Simple (β-retrovirus) Mason-Pfizer monkey virus Gammaretrovirus Murine leukemia virus, Feline Simple (γ-retrovirus) leukemia virus Deltaretrovirus Bovine leukemia virus, Human Complex (δ-retrovirus) T-lymphotropic virus Epsilonretrovirus Walleye dermal sarcoma virus, Complex (ε-retrovirus) Viper retrovirus Lentivirus Human immunodeficiency Complex virus (HIV), Simian immunodeficiency virus Spumavirus Chimpanzee foamy virus, Human foamy virus Complex *Type species are shown in bold Five of the seven genera in the retrovirus family represent viruses with oncogenic potential (previously classified as oncoviruses). These oncogenic viruses act as natural carcinogens in all classes of vertebrates. The retrovirus of interest in this thesis is feline leukemia virus (FeLV). FeLV belongs to the gamma-retrovirus (γ-retrovirus) genera and causes 2

16 3 various diseases in domestic cats. FeLV will be discussed in further detail in Section 1.4. The other two genera include spumavirus and lentivirus. Members of the spumavirus genera cause no known disease in their hosts, but cells infected with spumaviruses have a characteristic foamy cytoplasm. Lentiviruses often induce immune deficiency as a result of targeting and disrupting T-cells in infected hosts. The best characterized lentivirus, and by far the most studied retrovirus, is human immunodeficiency virus (HIV). HIV causes acquired immune deficiency syndrome (AIDS) in humans Structure of retroviruses There is considerable diversity between various types of retroviruses, but generally, retrovirus virions are nm in diameter (Figure 1-1). The virions are enclosed by a host derived membrane envelope. Embedded in this membrane are virally encoded envelope proteins (Env) that are responsible for binding to the host cell. The retroviral envelope and its interaction with the host cell surface receptor for infection are the main focus of the studies described in this thesis. The envelope protein consists of a surface (SU) and a transmembrane (TM) subunit. The inner surface of the viral membrane is coated by the viral matrix protein (MA). The capsid protein (CA) forms the inner core of the virus that contains the retroviral genome complexed with the nucleocapsid (NC) protein. The virus encoded enzymes protease (PR), integrase (IN), and reverse transcriptase (RT) are also localized within the viral core (Figure 1-1). The retroviral genome is 7-12 kb in size and consists of positive sense, single stranded RNA molecules that are capped at the 5 end and carry poly-a tail at the 3 end. Each retrovirus carries two identical copies of the genome (Billeter et al., 1974; Beemon et al., 1976; Kung et al., 1975). All retroviruses contain three major genes, gag, pol and env (Figure 1-2). Retroviruses that carry only gag, pol and env genes are classed as simple retroviruses. Other retroviruses, such as lentiviruses and delta viruses carry additional genes and are known as complex retroviruses. The viral genes are flanked by the long terminal repeats (LTR) that encode promoter and enhancer sequences. The gag gene codes for structural proteins that form the matrix, capsid and the nucleocapsid of the virion (Vogt and Eisenman, 1973). The pol gene encodes the viral enzymes; reverse transcriptase, integrase, and protease [Reviewed in (Katz and Skalka, 1994)]. The surface unit and the transmembrane region of the envelope protein (Env) are coded by the env gene (Duesberg et al., 1970). While simple retroviruses carry only this elementary

17 4 information, complex retroviruses code for additional factors that are involved in viral replication, regulation and pathogenicity. The virus of interest for this thesis, FeLV, is a simple retrovirus carrying gag, pol and env genes only. Figure 1-1 Virion structure of a simple retrovirus. The virions are enclosed by membrane envelope. Embedded in this membrane are envelope proteins. The envelope protein contains an external surface unit (SU) and a transmembrane (TM) region. The inner surface of the membrane is coated by the viral matrix protein (MA). The capsid protein (CA) forms the inner core of the virus. Inside the capsid is the retroviral genome complexed with the nucleocapsid (NC) protein. The virus encoded enzymes; protease (PR), integrase (IN), and reverse transcriptase (RT) are also associated with the viral core.

18 5 Figure 1-2 Genome of a simple retrovirus. The cartoon shows the organization of a simple retroviral genome. The RNA genome is capped at the 5`end and contains a poly A tail at the 3`end. Each end codes for long terminal repeats (LTR) that contain promoter and enhancer sequences. The coding region codes for the different retroviral genes. The polyproteins coded in different reading frames are shown below (underlined). The gag gene encodes for the matrix (MA), capsid (CA) and nucleocapsid (NC) proteins, while the pol gene encodes for the protease (PR), reverse transcriptase (RT), and integrase (IN) genes. The env gene encodes for the viral envelope protein that consists of a surface protein (SU) and a transmembrane segment (TM) Life cycle of simple retroviruses There are two phases of the life cycle for simple retroviruses, early phase and late phase (Figure 1-3). The early phase starts with viral binding to the cell surface and ends with the integration of virally encoded DNA into the host genome. Virus interaction with its host relies on the surface subunit of the Env that recognizes and binds to specific host cell surface receptors. Binding of virus Env to host cell surface receptors, brings about conformational changes in the envelope protein that allow the viral membrane to fuse with the host cell membrane. While only one cell surface protein has been shown to serve as a receptor for γ- retroviruses, lentiviruses, such as HIV-1 use a primary receptor as well as a co-receptor that aids in fusion. The use of co-receptors for other retroviruses has not been well characterized. Once the virus fuses with the cell membrane, the virion core is released into the cytoplasm. Here the viral RNA is transcribed into DNA using the virally encoded enzyme reverse transcriptase and cellular deoxynucleoside triphosphates. This DNA copy of the viral genome is called the provirus. The proviral DNA is then inserted non-specifically into the host by the virally encoded enzyme integrase. This completes the early phase of the viral life cycle. Once integrated, the retroviral infection of the host is for life. The late phase of the retroviral life cycle involves expression and synthesis of viral proteins and the assembly and budding of new viruses. The late phase of the retroviral life cycle may not start for a long period of time after viral DNA integration. Many retroviruses can stay latent in the host genome after infection. Once integrated, the proviral DNA becomes a part of the host genome and is replicated using host cell transcriptional and translational machinery.

19 6 Once the virally encoded proteins are synthesized new viral particles are assembled, containing all the structural proteins, virally encoded enzymes and the viral genome. The virus then buds through the plasma membrane and acquires a host cell based envelope embedded with virally encoded envelope protein. Once the virions assemble and bud off from the cell, the viral protease is activated and it cleaves the polyproteins into individual structural and enzymatic proteins. At this stage, the virion becomes infectious and this marks the end of the retroviral life cycle. Figure 1-3 Life cycle of a simple retrovirus. The life cycle of a simple retrovirus is divided into two phases: early phase (labelled in blue) and late phase (labelled in red). Early Phase: The virion is adsorbed through non-specific, reversible interactions with molecules on the cell surface. For entry, the virus envelope protein binds to a specific cell surface receptor leading to fusion of the viral and cell membranes. After entry, the virus uncoats through the loss of the capsid protein. The RNA genome is reverse transcribed into DNA and then integrated into the host genome using the viral enzyme integrase. This marks the end of the early phase. Late Phase: The viral DNA is transcribed and translated using the host cell machinery. Upon translation of the viral transcripts in the cytoplasm, the polypeptides are transported to the cell surface where the virus buds from the host cell. After budding the virus matures and the polypeptides are cleaved into their respective proteins by the viral protease.

20 1.3 Gammaretroviruses Members of the gammaretroviruses (γ-retroviruses) genus cause several different diseases including lymphomas, immune deficiency, anemia and neurological disorders in infected hosts (Hardy, Jr., 1993; Kozak and Ruscetti, 1993; Payne, 1993). Many of these diseases serve as models for understanding human diseases. However, because of their simple genome organization and their replicative properties, many gene therapy vectors are based on γ- retroviruses Subgroup classification Gammaretroviruses include murine leukemia virus (MLV), feline leukemia virus (FeLV), porcine endogenous virus (PERV), gibbon ape leukemia virus (GALV) and the feline endogenous retrovirus (RD114). These viruses are further classified into subgroups based on virus host range and the principle of viral interference. Interference is a phenomenon where a cell infected with a retrovirus blocks subsequent infection of another virus that uses the same cell surface receptor (Figure 1-4) (Weiss, 1993). A cell infected with a particular retrovirus, produces viral envelope protein that interact with, and saturate the cell surface receptor. This renders the receptor non-functional both for its cellular use and its use as a viral receptor for any infecting virus. As a result, the cell becomes resistant to infection by viruses that use the saturated receptor, while it remains susceptible to viruses that use alternate cell surface receptors. Murine leukemia viruses (MLVs) are the best studied in the γ-retrovirus genus and are commonly used to study leukemogenesis and carcinogenesis in general [Reviewed in (Kozak and Ruscetti, 1992)]. MLV was classified into subgroups based on receptor use and interference properties. MLV subgroups include ecotropic MLV (E-MLV) (Klement et al., 1969), xenotropic MLV (X-MLV) (Levy, 1978), amphotropic MLV (A-MLV) (Hartley and Rowe, 1976), polytropic MLV (P-MLV) (Rein and Schultz, 1984), 10A1 MLV and Mus dunni endogenous virus (Bonham et al., 1997; Miller and Wolgamot, 1997; Prassolov et al., 2001). FeLVs are also categorized into subgroups; FeLV-A, FeLV-B, FeLV-C and FeLV-T, based on receptor use and interference properties. Much work to understand the receptor-envelope interaction has been carried out using MLV envelopes and receptors. This has made MLV a model for understanding the envelope receptor interactions for other γ-retroviruses like FeLV, as well as a suitable choice for early gene therapy vectors. 7

21 Figure 1-4 Model for retroviral interference. A schematic depicting the phenomenon of retroviral interference. 8

22 9 Other γ-retroviruses of interest to this thesis include RD114 and FeLV. RD114 is a replication-competent, xenotropic retrovirus present in the normal cellular genome of domestic cats (Fischinger et al., 1973). RD114 envelope is found only in species of the genus Felis, and not in other closely related genera (Reeves and O'Brien, 1984). While it is not associated with any disease in cats, it is expressed by several feline cell lines (Haapala et al., 1985). FeLV is a virus common in domestic cats. It will be discussed in detail in section Envelope glycoprotein of γ-retroviruses The envelope protein (Env) of MLVs is best characterized amongst the γ-retroviruses. The FeLV Envs show a high degree of sequence similarity and structural organization to the MLV Env and the identification of domains in the FeLV Env is based on their sequence similarity to the MLV Env (Figure 1-5b). The viral envelope protein is composed of a surface unit (SU) that protrudes from the viral surface and a transmembrane region (TM) that is embedded in the viral membrane (Figure 1-5a). The SU is composed of three structurally distinct domains; the receptor binding domain (RBD) (the first amino acids), the proline rich region (PRR) (50-60 amino acids) and the carboxy-domain (C-dom) ( amino acids) (Figure 1-5). The RBD is responsible for recognition of the specific host receptor (Battini et al., 1995; Battini et al., 1992). The highly conserved amino acid sequence of the RBD is interrupted by segments of variable regions A, - C and B (VRA, VRC and VRB). Receptor recognition residues have primarily been mapped to VRA, however residues within the VRC and VRB influence Env binding to receptor.

23 Figure 1-5 γ-retrovirus envelope glycoprotein. A. A schematic of the envelope glycoprotein (Env) showing the variable region-a (VRA) (red), -C (VRC) (blue) and B (VRB) (orange), proline rich region (PRR) (purple), C- domain (C-dom) (green) and transmembrane region (TM) (yellow). The VRA, VRC, VRB, and the C1-C3 regions are cysteine bounded loops. The position of the PHQ motif is marked in the N-terminal of the Env and the Fusion peptide is marked in the TM. B. Alignment of the FeLV-A, -B, -C and T Env and A-MLV Env. Dots represent identical amino acids. The different regions of the Env are color coded as in the schematic. 10

24 11 The crystal structure for the RBD of FeLV-B and E-MLV have been solved and they show that variable regions extrude as loops from a globular domain of the RBD (Barnett et al., 2003). Thus, the variable regions are more exposed for contact with specific cell surface receptors. The RBD of FeLV-B and E-MLV serve as models for other γ-retroviruses. The variable regions of the other γ-retroviruses are also predicted to be exposed on the outer surface of the RBD for receptor binding. The PRR has been suggested to act like a hinge between the RBD and the C-domain and maintains the correct conformational shape of the SU (Battini et al., 1992). It is shown to be necessary for efficient viral entry as it provides structural support for the RBD (Gray and Roth, 1993) (Battini et al., 1995). The C-domain is comprised of three regions, C1-C3. Just like the variable regions in the RBD, C1-C3 regions also show significant sequence variation between MLVs and FeLVs. Our lab has shown that the C-domain forms a second receptor binding domain that is involved in receptor recognition and binding (Rey et al., 2008b). The transmembrane region of the Env is fairly well conserved between different γ- retroviruses and contains the fusogenic domain required to initiate virus-cell membrane fusion Mechanism of envelope-receptor interaction for γ-retroviruses The precise mechanism for γ-retrovirus infection through envelope receptor interactions is not completely understood. The current model for γ-retrovirus infection is based primarily on direct studies carried out on MLVs and other model systems like HIV and influenza. According to the current model, the surface subunit, specifically the RBD and the C-dom bind to the cell surface receptor (Rey et al., 2008b). The binding of the SU induces conformational changes that expose residues involved in the fusion process. Several regions in the SU have been implicated as determinants for fusion. Regions within the PRR are involved in signaling that allow for conformational changes ultimately leading to fusion (Lavillette et al., 1998). A conserved PHQ amino acid motif, found near the amino-terminal of almost all γ- retroviruses has also been shown to be critical for fusion (Figure 1-5a)(Lavillette et al., 2000; Bae et al., 1997). Deletion of the histidine in this PHQ motif (ΔH) blocks membrane fusion but not receptor binding. Fusion defective envelope (ΔH) can be rescued when a soluble RBD (or SU), with an intact PHQ motif is provided in trans (Barnett et al., 2001) Interestingly, for some

25 12 H viruses, the rescuing RBD need not be homologous to the H virus, as long as receptors for both the H virus and soluble RBD are present (Lavillette et al., 2000). The model of virus envelope fusion with the host cell membrane is based primarily on the fusion model for influenza virus. After receptor binding, the Env goes through several conformational changes, including cleavage of the SU and the TM subunits (England et al., 1977; Ng et al., 1982) (Sattentau et al., 1993). These conformational changes expose a fusion peptide in the TM which penetrates the host cell membrane (Martin et al., 1994). This brings the viral membrane in close proximity to the cell membrane which allows for fusion (Hunter, 1997). Envelope proteins act as multimeric complexes for virus entry (Layne et al., 1990; Bachrach et al., 2000; Tailor et al., 2003). These multimeric envelope complexes possibly interact with clusters of receptors [Reviewed in (Tailor et al., 2003)]. In HIV for example, the contact with more than one CD4 enhances infectivity (Platt et al., 1998a). Similarly, receptor clusters have been shown to enhance infection of some γ-retroviruses (Davey et al., 1999; Salaun et al., 2002; Valsesia-Wittmann et al., 1997). It remains unclear whether these clusters are composed of multiple copies of the same receptor or different cell surface receptors. It appears that interaction of the viral envelope protein and the cell surface receptor is not merely a point of contact and attachment, but much more complex and interesting. For this reason further research is required to better understand virus-cell interaction Pseudotyped viruses to study envelope receptor interactions Use of pseudotyped, replication defective viruses is a useful and powerful tool for studying the envelope receptor interaction in isolation. Pseudotyping is a phenomenon in which retroviruses (as well as other enveloped viruses) incorporate the envelope protein of another virus (Weiss, 1993). Pseudotyped viruses can be generated naturally as a result of the budding process. Retroviruses bud through the plasma membrane acquiring a host derived envelope embedded with virally encoded envelope protein. In cells co-infected with two retroviruses, budding can lead to the production of viral particles that have incorporated functional envelope protein form one virus into a virion derived from an unrelated genome (Boettiger, 1979). Pseudotyped viruses can also be generated artificially, where the env gene from one virus is expressed in trans with gag/pol from another virus to generate a chimeric pseudotyped virus.

26 13 Production of such chimeric retroviruses is usually carried out in a packaging or virus producing cell line. Retroviral packaging cells were initially developed to produce replication defective retroviruses for use as gene therapy vectors that would transfer the therapeutic gene of interest without the fear of viral infection. Packaging cells express all the viral proteins to produce a virion, but do not transmit the RNA genome (Mann et al., 1983; Watanabe and Temin, 1983). Instead of the viral genome, a gene of interest (a therapeutic gene or a selectable marker) is packaged into the virion, providing a vector for gene transfer. While packaging cell lines were developed to produce vectors for gene therapy, they provide a great system to understand envelope-receptor interactions. To study specific envelopereceptor interactions, the packaging cell line is transfected with a plasmid expressing the gag/pol that encodes for all the structural and functional proteins of the virus. Another plasmid encodes for a packagable selectable marker (like antibiotic resistance genes, β-galactosidase etc.). A gene encoding the envelope protein of interest is then transfected into this packaging cell line to generate a virion that carries a selectable marker and expresses the specific envelope of interest (Figure 1-6). Different envelope genes can be transfected to generate pseudotyped viruses that are identical in all other aspects except the envelope protein that is expressed on the virus surface. These genetically identical viruses carrying different Envs can then be used to study specific envelope-receptor interactions and compare the infectivity and binding properties between different Envs. 1.4 Feline leukemia viruses (FeLVs) Feline leukemia viruses (FeLVs) are pathogenic γ-retroviruses that are found commonly in domestic cats. Between 37-47% of cats are known to carry FeLV proviral sequences (Arjona et al., 2007). FeLVs cause different diseases in infected host, and are the leading cause of death amongst young cats. The study of FeLVs is not only of veterinary interest, but also serves as a model for understanding human disease. Many diseases induced by FeLVs, including anaemia and AIDs, are clinically identical to human diseases. Furthermore, the transmission, host receptor adaptation and evolution of FeLVs are analogous to that of HIV and therefore provide a model for studying HIV pathogenesis. Finally the ability of FeLVs to efficiently transduce hematopoietic stem cells (HSC) makes them an excellent candidate for human gene therapy.

27 Figure 1-6 Generation of pseudotyped viruses to study Env-Receptor interaction. Virus packaging cells express the viral genome (gag/pol) without a packaging signal (ψ-), and a selectable marker that carries a packaging signal (ψ+). The env gene of interest is transfected to produce pseudotyped viruses carrying the selectable marker and expressing the Env of interest. 14

28 1.4.1 Historical perspective FeLVs were discovered in 1964 as the causative agent of lymphosarcoma in a group of household cats (Jarrett et al., 1964a; Jarrett et al., 1964b). The virus like particles from these cats closely resembled mice and chicken leukemia viruses that were previously isolated, and were thus named accordingly. FeLVs are thought to have evolved from an ancestral rodent virus and is closely related in genetic structure and primary sequence to the murine leukemia viruses (Neil et al., 1991). FeLVs are found both in the saliva and the blood of infected cats. Expression of the FeLV capsid protein, in the blood is used as a detection test in infected cats. The virus is transmitted between cats primarily through biting, scratching and licking. The virus can also be transmitted from the infected mother to the newborn kittens via the milk, but no placental transmission has been reported (Hardy, Jr. et al., 1976). FeLVs are not isogenic species, but a genetically complex family of related virus subgroups. Genetic variation in FeLVs is generated as a result of error prone reverse transcription as well as by recombination of the virus with endogenous FeLV-like sequences present naturally in the cat genome. The subgroup of feline leukemia virus that is transmitted between cats is primarily FeLV-A. After transmission, the virus accumulates in the lymph nodes and bone marrow which are the sites for high titer virus replication and at this stage it is believed that the FeLV-A gives rise to the other subgroups of FeLVs (Neil et al., 1991; Hardy, Jr., 1992) Subgroups of FeLV There are four FeLV subgroups; FeLV-A, FeLV-B, FeLV-C and FeLV-T. The genome of FeLV subgroups is highly conserved and variations are predominantly found in the env gene (Figure 1-5). FeLV-A is the progenitor subgroup, and causes a non-fatal T-cell lymphoma in infected cats (Jarrett et al., 1984; Hardy, Jr., 1993). Other FeLV subgroups have been shown to arise from FeLV-A in infected cats. The gene encoding the FeLV-A Env often undergoes recombination with Env-like sequences in the cat genome (Overbaugh et al., 1988b; Stewart et al., 1986). This gives rise to FeLV-B. FeLV-C and FeLV-T subgroups arise as a result of subtle

29 16 mutations in the FeLV- A env gene (Abkowitz et al., 1987; Neil et al., 1991; Onions et al., 1982; Overbaugh et al., 1988a). Because of the variations in their Env protein, FeLV subgroups use distinct cell surface receptors for infection and display unique host range in vitro (Sarma and Log, 1973). Several studies have suggested that the specific disease induced by FeLVs is caused by Env binding to, and disrupting the cellular function of its host receptor (Brojatsch et al., 1992; Donahue et al., 1991; Overbaugh et al., 1988a; Riedel et al., 1986; Riedel et al., 1988; Rigby et al., 1992). Because FeLV subgroups use distinct receptors, they cause different diseases in an infected host. FeLV-A is only mildly pathogenic and is associated with lymphomas in infected cats (Jarrett et al., 1984; Hardy, Jr., 1993). FeLV-B has been associated with a number of different diseases including mild non-fatal anaemia, lymphosarcomas and other myeloproliferative diseases (Jarrett and Russell, 1978; Tzavaras et al., 1990). FeLV-C causes non-regenerative anaemia (pure red cell aplasia, PRCA) (Abkowitz et al., 1987; Dornsife et al., 1989b; Neil et al., 1991) and FeLV-T causes feline immune deficiency syndrome (Donahue et al., 1991; Overbaugh et al., 1988a). Our lab has shown that the expression of FeLV-C Env in erythroid progenitor cells specifically disrupts erythroid differentiation, that is the cause of pure red cell aplasia observed in cats infected with FeLV-C (Rey et al., 2008a). Not only do the FeLV subgroups cause different diseases through their use of distinct cell surface receptors, they also display unique host range in vitro. FeLV-A has the most restricted host range, and can efficiently infect and replicate in feline cells lines. While FeLV-A had been shown to infect cells of other species including human and canine, FeLV-A replication in these cells is not at the same level as feline cells (Moser et al., 1998). FeLV-C has the most expanded host range, and can infect several different cell lines including feline, canine, human and mink cells. FeLV-C also has the unique ability to infect guinea pig cell (Riedel et al., 1988). FeLV-T host range is restricted to feline T-cells (Overbaugh et al., 1988a). FeLV envelope and its interaction with the specific cell surface receptors is the main focus of the studies reported in this thesis.

30 1.5 Receptors There has been a considerable body of research focused on identifying retroviral receptors and defining the interaction between viral envelope protein and their cognate cell surface receptors. This is so because several retroviral diseases are associated with the virus disrupting the cellular functioning of the receptor. Furthermore, retroviruses are used as vectors for gene therapy, aimed at efficiently transferring genetic material to specific cell types. Thus a thorough understanding of the interaction between the viral envelope and receptors is needed, both for understanding viral pathogenesis, and for developing efficient vectors for gene therapy Gammaretrovirus receptors Many of the receptors used by γ-retroviruses have been cloned and identified, but even before the cloning of these receptors, a large body of information was available on viral-receptor usage based on interference assays (Figure 1-4). Retroviruses that demonstrated reciprocal receptor interference were placed in a distinct receptor group (Table 1-2). Viruses that did not show superinfection interference were placed in another receptor group. Using these assays distinct receptor groups were delineated for most of the oncogenic retroviruses (Sommerfelt and Weiss, 1990) (Table 1-2). Interestingly some viruses showed non-reciprocal interference. After cloning and identification of receptors, it has been shown that this non-reciprocal interference resulted from viruses using more than one receptor. Retroviruses use a small group of cell surface receptors for infection [Reviewed in (Tailor et al., 2003)]. All of the γ-retrovirus receptors identified are multiple transmembrane proteins that serve as transporters of important solutes (Table 1-2). Interestingly, almost all other viruses use receptors that have a single transmembrane region. Different γ-retroviruses can use one receptor for infection, for example, FeLV-B as well as well as A- MLV and GALV use the inorganic phosphate transporter 1 (Pit1) as a receptor. From an evolutionary perspective, this receptor use suggests that γ-retroviruses diverged from a common origin and may have jumped species while retaining their commitment to use orthologous receptor in the new host [Reviewed in (Tailor et al., 2003)]. Interestingly some viruses use multiple related receptors for infection, for example, FeLV-B uses the phosphate transporter Pit1 as well as its paralog Pit2 as receptors. BAEV uses the neutral amino acid transporters, ASCT1 and ASCT2 as receptors for infection. 17

31 18 Table 1-2 γ-retrovirus receptors. Viruses Receptor Group Predicted Topology Cellular Function E-MLV CAT1 Cationic Amino Acid Transporter FeLV-B GALV 10A1-MLV Pit1 Phosphate Transporter GALV FeLV-B A-MLV 10A1-MLV PERV-A Pit2 PAR-1 PAR-2 Phosphate Transporter Unknown X-MLV P-MLV RD114, BaEV SRV, REV HERV-W X-receptor ASCT2 Unknown (Putative Inorganic Phosphate Transporter) Neutral Amino Acid Transporter BaEV ASCT1 Neutral Amino Acid Transporter FeLV-C FLVCR1 Heme Exporter FeLV-A THTR1 Thiamine Transporter

32 19 The receptor for E-MLV was the first retroviral receptor to be cloned (Albritton et al., 1989). The receptor was identified by transferring genomic DNA from a susceptible mouse cell line to a non-permissive human cell line and screening for the E-MLV receptor. The receptor was identified as a transporter for cationic amino acids, and was termed CAT1 (Kim et al., 1991). The advent of cdna libraries and retroviral vectors made the screening for receptors much less tedious. Using this method a non-permissive cell line is infected with a retroviral cdna library from a permissive cell line. The cells are then screened for the cdna clone that renders the non-permissive cell line susceptible to infection. The receptors for FeLV subgroup A (THTR1) (Mendoza et al., 2006) and subgroup C (FLVCR1) (Tailor et al., 1999c; Quigley et al., 2000) were cloned using this method FeLV receptors FeLV-A receptor The feline receptor for FeLV-A has been identified as thiamine transporter, THTR1 (Mendoza et al., 2006). The human ortholog of THTR1 (hthtr1), shows 93% sequence identity to the feline THTR1 (fethtr1) and also serves as a receptor for FeLV-A although the efficiency of infection is much lower compared to that with feline THTR1 (fethtr1) (Mendoza et al., 2006). This may explain why FeLV-A infects human cells less efficiently compared to feline cells. It remains unclear whether FeLV-A binding to THTR1 is responsible for any specific disease induced by FeLV-A. Mutations of THTR1 in humans are associated with the autosomal recessive disorder Rogers syndrome, which causes megaloblastic anemia, among other abnormalities (Diaz et al., 1999; Labay et al., 1999). It has been speculated that FeLV-A dependant block of THTR1 may lead to megalosblastic anaemia that is observed in some cats infected with FeLV-A (Cotter, 1979) FeLV-B receptor The receptor for FeLV-B has been identified as the phosphate transporter Pit1 (Takeuchi et al., 1992). Some strains of FeLV-B also use a homologous protein Pit2 as a receptor for infection (Anderson et al., 2001). It has also been shown that FeLV-B can use the human

33 20 ortholog of Pit1 (hpit1) efficiently. This allows the virus to expand its host range to human cells in vitro FeLV-C receptor The receptor for FeLV-C has been cloned and identified as the cell surface protein FLVCR1 (Quigley et al., 2000; Tailor et al., 1999c). Both the feline and the human FLVCR1 (feflvcr1, hflvcr1) serve as receptors for FeLV-C. FLVCR1 is a twelve transmembrane spanning protein that functions as a heme exporter (Keel et al., 2008; Quigley et al., 2004). Blocking FLVCR1 disrupts erythroid differentiation, causing a specific block in erythroid development similar to what is seen in cats infected with FeLV-C (Quigley et al., 2004; Rey et al., 2008a) FeLV-T receptor It is not completely clear how FeLV-T enters cells and what receptor/s it uses for infection. To infect feline T-cells, FeLV-T requires Pit1 and the soluble co-factor Felix. Felix is highly related to FeLV-B SU and has been suggested to trigger FeLV-T infection after binding to Pit1(Anderson et al., 2000). However, presence of E-MLV RBD in the absence of Pit1 can also trigger FeLV-T infection if the E-MLV receptor CAT-1 is present (Barnett et al., 2003). FeLV-A RBD in the presence of THTR1, and FeLV-C RBD in the presence of FLVCR1 can also allow FeLV-T infection in vitro (Cheng et al., 2007). Thus the identity of the unique FeLV- T receptor remains unclear Determinants of FeLV receptor specificity and pathogenicity FeLVs cause different diseases in cats and display distinct host range in vitro. It was not clear whether the disease outcomes were a result of FeLV subgroups expressing additional pathogenic/oncogenic genes, or if the determinants of pathogenicity were encoded by the retroviral genomes (Mullins and Hoover, 1989). Thus early research was focused on understanding how the FeLV subgroups cause different diseases in cats and display distinct host range in vitro. Most of the work done to identify the determinants of FeLV pathogenicity and host range was carried out using FeLV-C. It was known that FeLV-C was found specifically in cats with aplastic anemia (also called pure red cell aplasia, PRCA). Furthermore, biologically cloned FeLV-C as well as a molecular clone of FeLV-C was shown to cause PRCA when inoculated in the bone marrow of new born cats (Onions et al., 1982) (Dornsife et al., 1989b; Riedel et al.,

34 ). Thus it was clear that PRCA in an infected cat was a direct result of the emergence of FeLV-C. Molecular analysis of the FeLV-C subgroups showed that the virus carried no extra pathogenic or oncogenic genes, and thereby the determinants of pathogenicity were encoded by the viral genome. To identify the regions within the FeLV-C genome crucial for pathogenicity, chimeras between the FeLV-C genome and FeLV-A genome were made and tested for pathogenicity. It was shown that in an FeLV-A genomic clone substituting the N-terminal of the env gene allowed for the induction of PRCA in kittens, identical to the anemia caused by the parental FeLV-C (Riedel et al., 1988). Thus the pathogenic determinants of FeLV-C were localized to the envelope gene (Linemeyer et al., 1982). Interestingly the chimeras that induced anemia in cats also acquired the unique host range for FeLV-C in vitro. FeLV-A isolates replicate poorly in cells from heterologous species while FeLV-C can infect several different cell lines and has the unique ability to infect guinea pig cells. Interestingly substituting the first 241 amino acids (SU region) of the FeLV-A Env with FeLV-C Env allowed the FeLV-A virus to expand its host range to guinea pig cells (Riedel et al., 1988). Host range properties of retroviruses are determined primarily by the interaction of the viral Env with the cell surface receptor. Thus FeLV-C Env was responsible for its receptor specificity and thereby FeLV-C pathogenicity and host range. Further proof for the role of FeLV Env in pathogenicity came from a comparison of the genomes of the FeLV isolates. Genomic clones of FeLV isolated from naturally infected cats show a great deal of homology in their genomic sequence. The exception to the uniformly high degree of conservation is noted in the envelope glycoprotein. An alignment of the envelope glycoproteins from different FeLV subgroups shows that the amino acid variability is clustered with five variable regions of the envelope surface protein; VRA, VRB and VRC (which collectively form the RBD), PRR and the C-domain (Figure 1-5). Studies to further narrow down the regions involved in pathogenicity and host range have shown that VRA from FeLV-C substituted in an FeLV-A backbone is sufficient to induce an FeLV-C-like phenotype; infecting guinea pig cells, and inducing PRCA in cats (Brojatsch et al., 1992; Rigby et al., 1992). With the cloning of the FeLV-C receptor, the mechanism of FeLV-C pathogenicity has become clearer. The FeLV-C receptor, FLVCR1 is a heme exporter, required for erythroid development (Keel et al., 2008; Quigley et al., 2004; Rey et al., 2008a). FeLV-C Env binds to

35 22 FLVCR1, blocking erythroid development leading to the PRCA observed in infected cats (Rey et al., 2008a) (Tailor et al., 1999c). The SU, specifically the VRA, is responsible for binding FLVCR1, and thus is critical in determining FeLV-C receptor specificity, host range and pathogenicity. The specific amino acids in the VRA that determine FeLV-C receptor specificity have not been identified. Different FeLV-C isolates, while sharing some features in the VRA, all have variable sequence in this region. Thus it is not yet clear what the minimal amino acid requirements are for switching the virus from a mildly pathogenic FeLV-A to a PRCA causing FeLV-C. The study reported in Chapter 2 of this thesis was aimed at identifying specific amino acids that are responsible for determining receptor specificity of FeLV-A and FeLV-C. While most of the work has been done on FeLV-C, similar chimeric studies have also been carried out to identify the region that determines the pathogenicity and host range of FeLV-T. The region has been mapped to N-terminal of the envelope glycoprotein similar to what has been determined for FeLV-C (Donahue et al., 1991). But, because the unique receptor for FeLV-T has not been identified, several aspects of FeLV-T infection are not completely clear. Further understanding of the FeLV-T envelope-receptor interaction is required to fully understand the mechanisms of FeLV-T pathogenicity. While several questions remain unanswered, studies on both FeLV-C and FeLV-T have highlighted that the FeLV envelope protein is not only involved in host cell recognition, but plays crucial role in virus evolution and disease. Further understanding FeLV envelope-receptor interactions, will not only provide a better insight into virus-host interaction, but also FeLV evolution and pathogenicity. 1.6 Relationship to HIV Although FeLV and HIV belong to different retrovirus sub-families, and differ considerably in their genome organization, there is striking analogy between FeLV and HIV in several aspects of virus-host interaction. FeLV virus entry, receptor adaptation as well as the transmission of the virus and the emergence of pathogenic strains in an infected host are closely related to HIV and may provide a model for further understanding HIV infection and pathogenesis.

36 1.6.1 Use of co-receptors/co-factors The mechanism of envelope-receptor binding and virus entry are highly related for all retroviruses. While it has been proposed that the receptors for γ-retroviruses, like FeLV and MLV, provide all the necessary determinants of virus binding and fusion, lentiviruses, including HIV, require co-receptors in addition to the primary receptor for infection. HIV entry into cells requires an initial interaction of the Env with a primary binding receptor, CD4 (Dalgleish et al., 1984; Klatzmann et al., 1984) followed by a secondary interaction with the chemokine receptors CCR5 or CXCR4 (Deng et al., 1996; Dragic et al., 1996; Feng et al., 1996) that act as coreceptors and facilitate fusion. The use of CCR5 or CXCR4 by HIV is dependent on the strain of HIV. Macrophage-tropic HIV, which predominantly infects macrophages/monocytes, uses CCR5 as co-receptors, whereas T-cell tropic HIV that predominantly target T-cells uses CXCR4. In addition, HIV variants have been identified that use other related chemokine receptors as co-receptors (Deng et al., 1997; Hartley et al., 2005). Some studies have suggested that γ-retroviruses, may also use co-receptors or co-factors for infection. While no co-receptors have been identified for γ-retroviruses, it has been shown that cellular factors aid virus-cell interaction for two of the γ-retroviruses. FeLV-T has been shown to use the secreted factor Felix for infection of feline T- cells (Anderson et al., 2000), though it is unclear whether Felix is necessary for infection (Shojima et al., 2006). Similarly, E- MLV has been shown to require additional factors for efficient infection. Cellular protease cathepsin B acts at an envelope dependent step to aid infection of ecotropic Moloney MLV (Kumar et al., 2007). Cathepsin B cleaves the surface unit of the Env to allow conformational changes leading to virus fusion (Kumar et al., 2007). In Chapter 3, I report studies investigating the potential use of co-receptors by FeLVs. Data reported in this study suggests that the primary receptor for FeLVs may not be sufficient, and co-receptors/co-factors may be required for efficient infection by FeLVs Receptor adaptation and emergence of pathogenic strains While there are multiple strains of HIV present in an infected host, the strain of HIV that is predominantly transmitted uses CCR5 as a co-receptor (R5 HIV). Once transmitted, R5 HIV gives rise to the highly pathogenic strain of HIV that uses CXCR4 as a co-receptor (X4 HIV). Emergence of X4 HIV has been attributed to mutations in HIV Env, specifically in the disulfide- 23

37 24 bonded V3 loop [Reviewed in (Hartley et al., 2005)]. In addition, mutations in the V3 loop give rise to HIV intermediates that are dual-tropic using both CCR5 and CXCR4 as coreceptors. The emergence of X4 HIV, coincides with the depletion of CD4+ T-cells and a progression of AIDS [Reviewed in (Regoes and Bonhoeffer, 2005)]. Thus, the emergence of the highly pathogenic HIV coincides with a switch in the co-receptor used for infection and development of AIDS. Similarly, while infected cats contain a mixture of different FeLV subgroups, the primary FeLV that is transmitted is FeLV-A [Reviewed in (Hardy, Jr., 1992)]. Mutations in the FeLV-A Env lead to a switch in the host receptor used for infection, and subsequent emergence of the highly pathogenic subgroups FeLV-C. The emergence of FeLV-C coincides with the onset of fatal PRCA (Abkowitz et al., 1987; Dornsife et al., 1989b; Neil et al., 1991). However, it remains unclear which specific mutations lead to the emergence of FeLV-C. Furthermore, it is not clear whether the emergence of FeLV-C from FeLV-A involves FeLV intermediates that can use both the FeLV-A receptor THTR1 and the FeLV-C receptor FLVCR1. In Chapter 2, I report the identification and characterization of a novel FeLV that may be an evolutionary intermediate between FeLV-A and FeLV-C. The study aimed at identifying the specific amino acids in the Env that determine receptor specificity and host range. 1.7 Thesis Aims and Outline The overall goal of this thesis is to use FeLVs as a model to understand virus-host interactions and receptor adaptation. Studies reported in Chapter 2 aimed to understand how the virus envelope protein adapts to use distinct cell surface receptors that allow the virus to evolve in an infected host. This chapter reports experiments carried out to characterize a novel FeLV Env that may represent an evolutionary intermediate between FeLV-A and FeLV-C. The chapter also reports the discovery of retroviral contamination in the experimental system that led to the suspension of the project. The chapter concludes with suggestions to detect and contain contamination from endogenous retroviruses in future studies. Studies reported in the Chapter 3 aimed to further understand the mechanism of FeLV infection. This chapter reports preliminary results from initial studies suggesting that FeLVs may require additional co-factors/co-receptors for infection.

38 25 Chapter 4 summarizes the findings of the thesis, suggests future studies developing from the results of Chapter 2 and Chapter 3 and discusses how these results have contributed to the study of FeLV envelope receptor interactions.

39 26 2 UNDERSTANDING RECEPTOR ADAPTATION AND EVOLUTION OF PATHOGENIC FELINE LEUKEMIA VIRUS BY CHARACTERIZING NATURAL VIRUS VARIANT FA Abstract The emergence of the highly pathogenic subgroup C feline leukemia virus (FeLV-C) from subgroup A FeLV coincides with a change in the host receptor used for infection as a result of envelope (Env) mutations. To understand the evolution of FeLV-C in infected cats, I analyzed FeLV Env sequences isolated from primary FeLV isolate FA27 derived from an anemic cat (Adema, 2003). The FA27 primary isolate contained a heterogeneous population of FeLV Env sequences. One of the Envs, FA27-53 showed 99% amino acid identity to FeLV-A, but when pseudotyped, was reported to display an expanded host range to infect porcine cells (Adema, 2003). In this study, I further characterized FA27-53 Env. Experiments with FeLV-A based mutant Envs suggested that a single aspartic acid residue in the VRA of FA27-53 Env was responsible for the expanded host range. I also tested the ability of FA27-53 to use a panel of human gammaretrovirus receptors. Surprisingly, in addition to using the FeLV-A receptor THTR1, I found that FA27-53 also employed the human RD114 endogenous virus receptor ASCT2 for infection. Further testing showed that the experimental system was contaminated by a replication competent RD114 virus, and the results from the characterization of FA27-53 Env were actually an artefact of the RD114 contamination. 2.2 Introduction The emergence of pathogenic retroviruses from the transmitted retrovirus in an infected host often coincides with a switch in the host receptor used for infection (Hoatlin et al., 1998; Apetrei et al., 2004; Regoes et al., 2005). The switch in the host receptor is primarily attributed to small amino acid changes in the retroviral envelope (Env) glycoprotein that is responsible for receptor recognition and which expands the host range of the pathogenic retrovirus. In addition to the emergence of the pathogenic retrovirus, other variants of the retrovirus also evolve from the transmitted virus that are dual-tropic in their receptor use which are capable of using both the receptor used by the transmitted virus and the receptor used by the emerged retrovirus. For

40 27 example, during HIV infection highly pathogenic HIV variants that use the CXCR4 chemokine receptor as co-receptor for infection evolve from the transmitted HIV that uses the related CCR5 co-receptor for infection [Reviewed in (Ho et al., 2007; Regoes et al., 2005)]. This switch in co-receptor use is often associated with accelerated progression to CD4 + T-cell depletion and AIDS (Koot et al., 1993; Rowland-Jones, 2003). Similarly, variants of subgroup B avian leukemia virus (ALV-B), which evolve from the parental ALV-B, contain two amino acid changes in the ALV-B Env protein and are dual tropic in their receptor use, capable of using the ALV-B receptor CAR-1 and the related ALV-E receptor TEF for infection (Adkins et al., 1997; Adkins et al., 2001; Brojatsch et al., 1996). Feline leukemia virus provides an excellent model for studying such virus evolution. The highly pathogenic FeLV-C emerges in domestic cats infected with the weakly pathogenic FeLV- A through subtle mutations in the Env glycoprotein. These mutations allow the virus to switch the receptor used for infection from the thiamine transporter, THTR1 (Mendoza et al., 2006) to the heme exporter FLVCR1 (Quigley et al., 2000; Tailor et al., 1999c). The emergence of the FeLV-C subgroup coincides with the development of pure red cell aplasia, a fatal feline anemia characterized by the specific disruption in the development of erythroid progenitor cells (Dornsife et al., 1989a; Onions et al., 1982). The FeLV-C induced anaemia is attributed to the FeLV-C Env protein blocking the cellular function of FLVCR1 that is critical for erythroid progenitor cell development (Keel et al., 2008; Quigley et al., 2004; Rey et al., 2008a). Not only does of FeLV-C result in a distinct disease in the infected host, the virus displays a unique host range in vitro, making it possible to identify and characterize the different FeLV subgroups in a cell culture system. FeLV-A has a restricted host range, and it can proliferate efficiently in feline and mink cells. FeLV-C displays an expanded host range, and has the unique ability of infecting guinea pig cells amongst other cell lines. The unique host range makes it simple to study the evolution of FeLVs in a cell culture system. Furthermore, receptors of both FeLV-A and FeLV-C, as well as the receptors of many other γ-retroviruses, have been identified and characterized. With the cloning and identification of these receptors, many techniques have been developed to study virus-receptor interactions. Several studies have even identified specific regions on the cell surface receptors that are critical for virus infection (Brown et al., 2006; Tailor et al., 2000a). The vast information available on γ-retrovirus receptors and their interaction with the viral envelopes is a valuable resource for

41 28 understanding FeLV-C evolution, as the virus evolves through its ability to switch its cell surface receptor. Because FeLV-C evolves from FeLV-A with only a few amino acid mutations in the envelope gene that allow the virus to switch its receptor use, one question of interest has been to identify and characterize the specific amino acids necessary and sufficient to bring about the subgroup switch. The determinants of pathogenicity and subgroup phenotype have been narrowed down to mutations in the N-terminal of the env gene, but specific amino acids that define the FeLV subgroups are not yet known (Brojatsch et al., 1992; Rigby et al., 1992). Several studies have been carried out to identify these amino acid mutations through a sequence analysis between the different FeLV-A and FeLV-C isolates. While FeLV-C sequences are generally more similar to other FeLV-C sequences compared to FeLV-A, no consensus mutations or amino acids have been identified that determine receptor use. The only consistent feature that distinguishes FeLV-A from -C is a lysine to arginine change in the variable region A (VRA) of the receptor binding domain of the envelope glycoprotein although this change is not sufficient to convert the subgroup (Brojatsch et al., 1992). Different clones of FeLV-C have also been shown to carry variable length polymorphsims, as a result of a few amino acid deletions in the VRA (Adema, 2003). Studies that have explored the diversity within the FeLV-C VRA have concluded that VRA peptides can undergo extensive variation and still target a given receptor (Bupp et al., 2005; Bupp and Roth, 2002). It is hypothesized that there might be conserved motifs that determine receptor usage in FeLV-C, although no such conserved motifs have been identified (Brojatsch et al., 1992; Bupp et al., 2005). Another question of interest that arises about the evolution of FeLV-C is whether there are evolutionary intermediates between FeLV-A and FeLV-C, which display intermediate or unique phenotype. FeLV-C evolves from FeLV-A as a result of point mutations due to error prone reverse-transcriptase and many different combinations of mutations are possible in the VRA. Bupp and Roth (2002) simulated this natural evolution by generating synthetic FeLV mutants that have variable sequence in the VRA. Some of these FeLV VRA mutants can target distinct receptors (Sarangi et al., 2007). In a natural setting, while there are evolutionarily constraints, it is possible that several different evolutionary intermediates emerge that have distinct host range and receptor use compared to FeLV-A and FeLV-C. These viruses may have intermediate or dual host range (use both the FeLV-A and FeLV-C receptor), or may use a

42 29 completely different receptor. To better understand the evolution of FeLV in a natural environment, I analyzed envelopes isolated from natural FeLV isolates from infected cats to identify and characterize these evolutionary intermediates. The isolation and initial characterization of these natural variants was carried out by our collaborator Dr. Brian Willett (University of Glasgow)(Adema, 2003). The Willet lab isolated several clones of the envelope gene from primary virus isolates. Some of these clones showed divergent sequence, and viruses carrying these envelopes displayed host range distinct from both FeLV-A and FeLV-C. In this study I further characterized one of the envelope clones, FA Viruses expressing the FA27-53 envelope showed unique host range compared to both FeLV-A and FeLV-C prototype. Before reporting the results from the characterization of FA27-53, it is necessary to summarize how the natural virus variants were isolated Isolation of novel FeLV Env sequences The natural virus variant analyzed in this study, FA27-53, was isolated as a part of a doctoral study in the Willet laboratory (Adema, 2003). Figure 2-1 shows a schematic of how these virus variants were isolated. Eight different primary virus isolates were acquired from infected cats, that had previously been classified as subgroups A/C or A/B/C. FA27-53 was isolated from one of these eight primary isolates, named FA27 (Table 2-1). FA27 was known to contain a mixture of FeLV-A and FeLV-C subgroups (A/C). Feline, FEA cells, that are permissive to all different FeLV subgroups, were infected with the primary isolate FA27, to propagate the different natural virus variants present in the infecting isolate. After 2-3 weeks of culturing, DNA was prepared from these FEA cells and envelope genes were amplified from the cellular DNA by PCR, using env specific primers (Figure 2-1). The PCR products were cloned into a eukaryotic expression vector and the different clones were analyzed by sequence analysis. Four different env gene clones were isolated from the FA27 primary isolate and were named FA27-17, FA27-19, FA27-53 and FA27-55 (Table 2-1). FA27-19 and FA27-53 had identical sequences, and so FA27-19 was not characterized any further. The novel Env sequences were characterized as A-like or C-like based sequence comparison between the variants and the prototype FeLV-A Glasgow (FGA) and FeLV-C Sarma (FCS). Two criteria were used to define an Env clone as C-like; a high degree of

43 30 sequence divergence in the VRA region compared to the FeLV-A, and the presence of length polymorphisms in the VRA of the envelope glycoprotein. Sequences that had no length polymorphism and had comparable VRA sequence to FeLV-A Glasgow were characterized as A-like. By sequence comparison, FA27-17 and FA27-55 were characterized as FeLV-C-like while FA27-53 was characterized as FeLV-A-like. FA27-53 differed from the prototype FeLV- A (FGA) only at five amino acid positions, two of which were in the VRA (Figure 2-2). Table 2-1 Isolation of novel Env sequences from the primary isolate FA27 and their subgroup prediction. Primary Isolate Description/ Classification Novel Env Sequences Subgroup Prediction by Sequence Comparison Further Characterization FA27 Isolated by limiting dilution from an A/C complex obtained from an anaemic cat in Great Britain (Onions et al., 1982) FA27-17 FA27-19 FA27-53 FA27-55 C A A C Yes No Yes Yes

44 Figure 2-1 Schematic showing the isolation of virus envelope clones from natural virus isolates. 31

45 Figure 2-2 Sequence alignment of FA27 Env isolates. Sequence alignment of FA27-17, FA27-19, FA27-53and FA27-55 as well as the prototype FeLV-A (Glasgow) and FeLV-C (Sarma). 32

46 2.2.2 Initial characterization of FA27-53 Pseudotyped viruses carrying the different FA27 env genes were tested for their host range on a panel of different cell lines. The pseudotyped FeLV-A and FeLV-C displayed characteristic host range; FeLV-A with the most restricted host range, and FeLV-C infecting a number of different cell lines including 104C1 guinea pig cells. As predicted, FA27-55 displayed a host range similar to that of FeLV-C. FA27-17 showed very low titers of infection, and while the host range resembled that of FeLV-A, no concrete conclusions could be drawn about the host range of FA FA27-53 displayed a unique host range. While it efficiently infected feline and mink cells (similar to FeLV-A), it also displayed and expanded host range to ST Iowa porcine cells (unlike FeLV-A) (Table 2-2). Table 2-2 Titers for pseudotyped viruses expressing the Envs isolated from FA27, FeLV-A Glasgow, and FeLV-C Sarma on a panel of cell lines from different species.* FA27-17 FA27-53 FA27-55 FeLV-A FeLV-C 33 HO6T1 (Feline) 104C1 (Guinea Pig) Mv1Lu (Mink) HeLa (Human) 9 9.6x x x x x x x x x x x x x10 2 MDCK (Canine) StIowa (Porcine) NIH3T3 (Murine) x *Data in this table was generated in Dr. Willet s laboratory. The initial characterization of FA27-53 showed that while the Env only had five amino acid changes from the FeLV-A prototype, viruses expressing the FA27-53 Env had an expanded host range. In this chapter I report further characterization of FA I report experiments I

47 34 performed to identify the specific amino acids that allow FA27-53 to infect porcine cells, and to determine the receptor that FA27-53 uses to infect porcine cells. Unfortunately, while carrying out some concluding experiments for this project, I discovered that the virus producing cell lines were contaminated with an endogenous virus. In this report I have also included the experiments carried out to discover this problem and identify the source of the contaminating virus. 2.3 Materials and Methods Cell lines TELCeB6, human TE671 cells, feline kidney CCC, murine Mus. dunni tail fibroblast (MD), murine NIH3T3 and porcine ST Iowa cells were maintained in Dulbecco's minimal essential medium with low glucose (1000 mg/ml) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Invitrogen). TELCeB6 cells are retroviral -packaging cells that do not contain retroviral envelope genes but produce non-infectious virus (Cosset et al., 1995). These cells were maintained using 6 μg/ml of blasticidine to ensure selection of gag pol-expressing cells. TELCeB6 cells expressing specific envelopes were maintained in 75 µg/ml phleomycin. Human embryonic kidney (HEK) 293-T cells and HEK-293T-derived Phoenix ampho packaging cells (ATCC: SD3443) were maintained in Dulbecco's minimal essential medium with high glucose (4500 mg/ml) supplemented with 10% FBS. Phoenix ampho packaging cells produce replication-defective virus expressing amphotropic MLV envelope. All cells were maintained at 37 o C in 5% CO 2, unless otherwise stated. Cell lines transfected with the pfbneo or pcdna plasmids were maintained with 1.5 mg/ml of G418. Cell lines expressing the plpcx plasmid were maintained with puromycin (5 µg/ml for MD cells, 2 µg/ml for NIH3T3 cells). Cell lines expressing the pfbsalf plasmid were maintained with phleomycin (75 µg/ml) Generation of receptor expressing cells Plasmid expressing feline THTR1 (fethtr1) was a gift from J. Overbaugh. fethtr1 was amplified using upstream primer (CTO377) 5 -CACCATGGATGTGCCCGGCCCGGTG- 3 and downstream primer (NHO471) 5 - TCAAGCGTAATCTGGTACGTCGTATGGGTACAAAGTGGTTACTCGAGAACTTGAGA

48 35 TTCCTCGTCTTCTTGC-3 which contained sequence encoding a hemagglutinin (HA) epitope. fethtr1 was cloned into a cloning vector psc-a (Stratagene) and subsequently cloned into an Sal1-Not1 digested pfbneo retroviral vector (Stratagene). pfbneo-fethtr1-ha was introduced in Phoenix ampho retroviral packaging cells by transfection using PolyFect reagent (QIAGEN). Two days posttransfection, supernatant was harvested and filtered using a 0.45-µm -pore-size filter. Filtered viral supernatant was used to infect MD cells and NIH3T3 cells to stably introduce the receptor. Infected cells were selected using G418 (1.5 mg/ml). Resistant MD/feTHTR1-HA cells and NIH3T3/feTHTR1-HA cells were pooled and maintained for infection and binding assays. NIH3T3 cells expressing human Pit1 (hpit1) were generated using the plasmid POJ9 (Johann et al., 1992). POJ9 is the expression vector pcdna1 expressing the hpit1. NIH3T3 cells were transfected with POJ9 using PolyFect (QIAGEN) reagent and selected with G418 (1.5 mg/ml). Resistant colonies were pooled and the cells were maintained for infection assays. NIH3T3 cells expressing hasct1 and hasct2 were generated using the plasmids PCDNA3.1V5H hasct1-myc (Marin et al., 2000) and PCDNA3.1V5H-hASCT2-myc (Tailor et al., 1999b). The mammalian expression vector PCDNA3.1V5H expressing either hasct1- myc or hasct2-myc was transfected into NIH3T3 cells using PolyFect (QIAGEN) reagent. Cells were selected using G418 (1.5 mg/ml). Resistant colonies were pooled and maintained for infection studies. MD cells expressing hasct2-myc were generated by introducing hasct2-myc in plpcx retroviral vector into Phoenix ampho retroviral packaging cells by transfection using PolyFect reagent (QIAGEN). Virus from these Phoenix ampho cells was harvested as described above and used to infect MD cells. Infected cells were selected using puromycin (5 µg/ml). Resistant cells were pooled and maintained for infection and binding assays. NIH3T3/hFLVCR1-HA and NIH3T3hFLVCR2-HA cells were generated by introducing pfbneo-hfvlcr1-ha and pfbneo-hflvcr2-ha into Phoenix ampho retroviral packaging cells to generate virus as described above. The Phoenix ampho virus was used to infect NIH3T3 cells to introduce hflvcr1-ha and hflvcr2-ha into these cells. Infected cells were selected using G418 (1.5 mg/ml). Resistant cells and were pooled and maintained for infection and binding assays.

49 2.3.3 Generation of FGA mutant envelopes Plasmid VR1012 containing the envelopes FGA-NN, FGA-ND, FGA-DD were a gift from Dr. Brian Willet (University of Glasgow). The envelopes were digested out of VR1012 using a Not1-Sal1 digest and treated with Klenow fragment to blunt the ends. FGA-NN was cloned into pksbluescript(+) that had been digested with EcorV. The FGA-NN was digested out of KS(+) using Xba1-Cla1 and cloned into Xba1-Cla1digested pfbsalf. FGA-DD and FGA-ND were cloned into psc-b blunt end cloning vector (Stratagene). The envelopes were digested out of psc-b by digesting with Xba1-Cla1 and cloned into Xba1- Cla-1 digested pfbsalf retroviral vector. FGA-ND amplified from the plasmid provided by Dr. Brian willet carried an V210A mutation. To generate FGA-ND without V210A mutation, 3 prime region containing the V210A mutation was removed from pscb-fga-nd+v210a by digesting with HindIII. The correct sequence of the 3 region (containing V210) from pscb-fga-dd was digested using a HindIII digest and this correct sequence was ligated in the HindIII digested psc-b FGA-ND to generate psc-b FGA-ND without any extra mutations. FGA-ND was digested from PSC-B using an Xba1-Cla1 digest and cloned into pfbsalf digested with Xba1-Cla Viruses and infection studies Viruses encoding β-galactosidase and expressing the specified envelope were generated by transfection of TELCeB6 cells with the respective pfbsalf Env expression constructs. Transfectants were selected using phleomycin (75 μg/ml). Resistant colonies were pooled, virus supernatant harvested, filtered using a 0.45-μm filter and then subsequently used for infection studies. Target cells were seeded in a 24-well plate at cells/well (except MD or MD/Receptor expressing cells seeded at 1 x 10 4 ) one day prior to the infection study. The following day, target cells were incubated with 1 ml of serially diluted lacz pseudotyped virus supernatant for 4 h in the presence of polybrene (8 μg/ml). The virus supernatant was then replaced with fresh growth medium, and cells were allowed to incubate for a further 2 days before X-gal (5-bromo-4-chloro-3-indoyl-β-d43 galactopyranoside) (Sigma-Aldrich, Canada) staining. Infected cells were stained by treating cells with 0.25% glutaraldehyde and assayed for β-galactosidase activity with X-gal as a substrate. LacZ pseudotyped titers were determined by counting the number of blue colony-forming units (CFU's), and titers were expressed as the 36

50 37 number of CFUs obtained per milliliter of undiluted virus supernatant. Virus titer results reported are an average of three independent experiments SU binding assay For binding assay the surface units for FA27-53, FGA, FGA-NN, FGA-ND and FGA- DD were amplified using upstream primer (CTO432) 5 - TAGCTCAGACGATCCATCAAGATGGAAAGTCCAACGCACCCA-3 and a downstream primer (CTO415) 5 -GGGGGAGCTCGTAAATATATTCGGGTTGATG-3. The downstream primer encodes a Sac1 site. A 200 base pair region was amplified using the upstream primer (CTO418) 5 -GGACGTCGGAGGAAGCTTGAT-3 and downstream (CTO433) 5 - TGGGTCGGTTGGACTTTCCATCTTGATGGATCGTCTGAGCTA-3 and added to the amplified SU by stitching the two PCR products together using the upstream primer (CTO418) 5 -GGACGTCGGAGGAAGCTTGAT-3 and downstream primer (CTO415) 5 - GGGGGAGCTCGTAAATATATTCGGGTTGATG-3. The PCR product was digested with Sac1 and ligated into Sac1 digested pcs vector that codes for a double hemaglutinin tag in frame with the SUs. Soluble HA-tagged SUs were generated by transfection of HEK293T cells with the respective pcs expression constructs using PolyFect (QIAGEN). Culture medium containing the SUs was harvested 48 h post transfection, filtered using a μm filter and subsequently used for SU binding assay or stored at 80 C for later use. Binding of soluble SUs to target cells was carried out as previously described (Brown et al., 2006). Briefly, target cells were dislodged from culture flask using a cell dissociation buffer (Invitrogen) and approximately cells were incubated with 1 ml of SU containing medium in the presence of polybrene (8 μg/ml) for 30 min at 37 C. Cells were then centrifuged at 4000 rpm for 3 min and then washed twice with wash buffer (PBS containing 2% FBS, (PFBS). Cells were incubated with a 100 µl of PFBS containing anti HA.11 antibody (1 in 200 dilution) (Covance, Berkley, CA) for 30 min at 4 C with gentle agitation every 10 min. Cells were then subsequently washed twice with wash buffer and then incubated for 30 min at 4 C with 100ul of PFBS containing donkey anti-mouse antibody, conjugated to fluorescein isothiocyanate (1 mg/ml, 1 in 50 dilution) (Sigma) The cells were then subsequently washed twice with PFBS, fixed with 1% paraformaldehyde, and subsequently analyzed by flow cytometry.

51 2.3.6 Interference assay Porcine ST Iowa cells were infected with replication competent RD114 virus. Replication competent RD114 virus was a gift from Dr. D. Kabat. ST Iowa cells were seeded in a 24 well plate at 3x10 4 cells/well, one day prior to infection. ST IOWA cells were infected with replication competent RD114 in the presence of polybrene (8 μg/ml). Infected ST IOWA cells were expanded to a T-25 culture flask and the cells were allowed to propagate for 1-2 weeks to generate ST IOWA cells chronically infected with RD114 virus (ST IowaRD). To test for interference, uninfected ST Iowa cells and ST Iowa/RD cells were seeded in a 24-well plate at cells/well one day prior to the infection study. The following day cells were incubated with 1 ml of serially diluted lacz pseudotyped virus supernatant for 4 h in the presence of polybrene (8 μg/ml). The virus supernatant was then replaced with fresh growth medium, and cells were allowed to incubate for a further 2 days before X -gal (5-bromo-4- chloro-3-indoyl-β-d43 galactopyranoside) (Sigma-Aldrich, Canada) staining. LacZ pseudotyped titers were determined by counting the number of blue colony-forming units (CFU's), and titers were expressed as the number of CFUs obtained per milliliter of undiluted virus supernatant. Virus titer results reported are an average of three independent experiments Isolation of porcine ASCT2 Porcine ASCT2 was isolated from porcine ST IOWA cells (stasct2). cdna was prepared from ST IOWA cells using a the Thermoscript RT PCR System (Invitrogen). Porcine ASCT2 was amplified from the cdna using upstream primer (NHO564) 5 - GTCATGGTGGCCGAGACGC-3 and the downstream primer (NHO566) 5 - TCAAGCGTAGTCTGGGACGTCGTATGGGTACATGACTGATTCCTTCTCAC-3. The downstream primer encodes a hemaglutinin tag (HA) in frame with the stasct2 sequence. The stasct2 was cloned into an intermediate cloning vector pcr2.1topo (Invtirogen), and was subsequently cloned into Ecor1 digested retroviral expression vector pfbneo (Stratagene). To generate cell lines expressing stasct2, pfbneo-stasct2-ha was introduced in Phoenix ampho retroviral packaging cells by transfection using PolyFect reagent (QIAGEN). Two days posttransfection, supernatant was harvested and filtered using a 0.45-µm -pore-size filter and was used to infect MD cells and NIH3T3 cells. Infected cells were selected using 38

52 G418 (1.5 mg/ml). Resistant MD/stASCT2-HA cells and NIH3T3/stASCT2-HA cells were pooled and maintained Results Characterization of FA27-53 Env In this section, I have reported results for the characterization of the FA27-53 Env. Experiments were carried out to confirm the expanded host range of FA27-53, identify the specific amino acids that allow the FA27-53 Env to expand its host range to porcine cells, and to identify the receptor the virus uses to infect porcine cells. All the results reported in this section were generated before the detection of contamination of packaging cell lines (Section 2.4.2). Thus, while the results reported here are presented as the characterization of FA27-53, in light of the packaging cell line contamination, the data for FA27-53 is an artefact of RD114 contamination. Figure 2-3 Infection of FA27-53 on porcine cells. Infection of pseudotyped lacz viruses expressing FeLV-A or FA27-53 env and MLV gag/pol on feline (CCC), porcine (STIowa) and human (TE671) cells. Results are an average of three independent experiments. Error bars represent standard deviation.

53 FA27-53 Env expressing viruses infect porcine and human cells To investigate how viruses expressing the FA27-53 envelope infect porcine cells, we cloned the FA27-53 env gene into a retrovirus expression vector, pfbsalf (pfbfa2753salf). β- galactosidase encoding viruses bearing the FA27-53 Env (lacz FA27-53) were generated and infection studies were carried out to determine the host range of FA27-53 (Figure 2-3). FA27-53 infected feline CCC cells, as well as porcine ST Iowa cells efficiently. Furthermore, FA27-53 could also infect TE671 human cells. FeLV-A prototype, FGA showed no infection on porcine ST Iowa cells and weak infection on human TE671 cells (Figure 2-3). These results suggested that FA27-53 has an expanded host range compared to the FeLV-A prototype FGA Viruses expressing FeLV-A mutant Envs with a single aspartic acid mutation in VRA have an expanded host range to porcine cells As depicted in Figure 2-2, the Env sequence of FA27-53 differs from FGA Env sequence by five amino acid residues. Two of the residues N51 and D59 are located in VRA of the receptor-binding domain. The corresponding residues in FGA Env are D51 and N59. The N59D mutation removes a potential glycosylation site from the envelope glycoprotein. To ascertain whether the FA27-53 N51 and D59 Env residues were responsible for the expansion of its host range to porcine and human cells, I cloned FeLV-A envelope mutants carrying all possible combinations of aspartic acid (D) and asparagine (N) at position 51 and 59; FGA-NN, FGA-DD and the double mutant Env FGA-ND (Figure 2-4a). FGA-ND had an extra mutation V210A. The implications of this extra mutation will be discussed further in section I tested the ability of pseudotyped viruses bearing these Envs to infect porcine ST Iowa cells. As a control, I also tested the susceptibility of feline kidney CCC cells, which are highly sensitive to FGA. As shown in Figure 2-4b, FGA-DD, FGA-NN, and parental FGA efficiently infected feline CCC cells, but FGA-ND showed very low titers of infection on CCC cells. I hypothesized that this might be a result of the extra V210A mutation in the FGA-ND envelope. Further studies to investigate this extra mutation are reported in section Interestingly, only mutants that carried a N59D mutation in FGA infected porcine cells. FGA-DD infected porcine cells weakly, while the mutants with an additional D51N mutation, FGA-ND, infected porcine cells efficiently (Figure 2-4b). This data suggested that D59 in FA27-53 FeLV Env is critical for expansion the expansion of host range to porcine cells.

54 Surface units of FeLV-A mutant Envs do not bind to porcine cells Virus envelope surface unit (SU) binds to the cell surface receptor for infection. To test if the SUs of FA27-53, FGA-ND and FGA-DD bind to porcine cells, I carried out a binding assay for the FGA-mutant Envs on porcine ST Iowa cells. Interestingly, none of the SUs showed any significant binding on ST Iowa cells (Figure 2-4 c), even though FA27-53 and FGA-ND showed efficient infection on these cells. Figure 2-4 Sequence alignment, infection studies and binding assays for FeLV-A (FGA) mutants. a. Sequence alignment of the VRA of FGA and FGA mutants. D51 and N59 were individually mutated in an FGA backbone to create the single and double mutant envelopes, FGA-NN, FGA-ND and FGA-DD. Dots represent identical amino acids. B. Infection of pseudotyped lacz viruses expressing FGA and FGA mutant Envs on feline and porcine cells. Titers are average of three independent experiments Error bars represent standard deviation. C. Surface envelope (SU) binding of FGA and FGA mutants on porcine StIowa cells and MD cells expressing the FeLV-A receptor THTR1. Cells were incubated with (white histogram) or without (black histogram) surface envelope protein tagged with a double-ha epitope. Bound SU protein was detected using mouse anti-ha antibody (HA.11) and fluorescein-conjugated donkey anti-mouse. An increase in fluorescence (white histogram) denotes SU binding.

55 Viruses expressing FA27-53 Env infect cells expressing the FeLV-A receptor THTR1 and the RD114 receptor ASCT2 for infection To further characterize the expanded host range of FA27-53, I investigated the host cell surface receptor used by FA Infection studies showed that FA27-53 infects porcine and human cells. FeLV-C has an expanded host range to infect human cells, and also infects porcine cells weakly. Furthermore, FA27-53 had been isolated from the primary isolate FA27 which contained a mixture of FeLV-A and FeLV-C. This led me to hypothesize that the expanded host range of FA27-53 could be attributed to the use of the FeLV-C receptor FLVCR1. Thus, I tested the ability of FA27-53 to use FLVCR1 when expressed in murine NIH3T3 cells, which are naturally resistant to all FeLV subgroups. As a control, I also tested the ability of FA27-53 to use the FeLV-A receptor THTR1. As shown in Figure 2-5, expression of THTR1 in NIH3T3 (NIH3T3/THTR1) cells rendered the cells sensitive to FA27-53 and to FGA infection suggesting that FA27-53 uses the FeLV-A receptor. However, NIH3T3/FLVCR1 cells were resistant to FA27-53 suggesting that FLVCR1 does not function as a receptor for FA I next tested a panel of human gammaretroviral receptors for their ability to mediate FA27-53 infection. The human receptors tested included the homolog for FLVCR1, termed FLVCR2, which we have shown to be a receptor for an FeLV variant (Shalev, et al, In preparation), the FeLV-B receptor Pit1, and the feline endogenous virus RD114 receptor ASCT2 and its paralog ASCT1. ASCT2 is a promiscuous receptor for several retroviruses including baboon endogenous virus, type D simian retroviruses and the type W human endogenous virus. As shown in Figure 2-5a, FLVCR2 expressing NIH3T3 cells were also resistant to FA27-53 infection suggesting that the human FeLV-C receptors do not function as receptors for FA Surprisingly, I found that NIH3T3 cells expressing ASCT2 were sensitive to FA27-53 infection. This finding suggested that in addition to using the FeLV-A receptor, FA27-53 also uses the RD114 receptor for infection. Although, NIH3T3/ASCT1 cells were resistant to FA27-53, suggesting that hasct1 does not function as a receptor for FA I next tested the ability of the FGA mutant envelopes, FGA-NN, FGA-DD, and FGA- ND to infect cells overexpressing THTR1 and ASCT2. All of the FGA-mutants could infect NIH3T3/THTR1 cells but NIH3T3/ASCT2 cells were susceptible only to FGA-ND, the mutant that efficiently infects porcine cells. (Figure 2-5b) Taken together, these findings indicate that FA27-53 and FGA-ND use the FeLV-A and RD114 receptors for infection. It also suggested

56 that the host range expansion of FA27-53 to porcine and human cells may be attributed to the use of ASCT2 as a receptor. 43 Figure 2-5 Infection assays and binding studies on cells expressing human γ-retrovirus receptors. A. Susceptibility of Feline (CCC), Human (TE671), Porcine (StIowa) and Murine (NIH3T3) cells as well as NIH3T3 cells overexpressing fethtr1, hflvcr1, hflvcr2, hpit1, hasct2 and hasct1 to lacz FA Titers are average of three independent experiments Error bars represent standard deviation. B. Susceptibility of porcine (StIowa) and NIH3T3 cells expressing hasct2 to FeLV-A, A-NN, A-ND and A-DD. Results are average of three independent experiments Error bars represent standard deviation. C. Surface envelope (SU) binding of FA27-53 on MD cells expressing the FeLV-A receptor fethtr1 and NIH3T3cells overexpressing hasct2 1. Cells were incubated with (white histogram) or without (black histogram) SU protein tagged with a double HA epitope. Bound SU protein was detected using mouse anti-ha antibody (HA.11) and fluorescein-conjugated donkey anti-mouse. An increase in fluorescence (white histogram) denotes SU binding.

57 44 Interestingly, similar to what was observed with porcine cells, FA27-53 SU-HA showed no significant binding to cells over expressing hasct2. On the other hand, binding was observed on cells overexpressing THTR1 (Figure 2-4c and 2-5c) RD114 virus interferes with FA27-53 infection To ascertain whether FA27-53 infection of porcine cells is mediated by the ASCT2, I tested the susceptibility of porcine ST Iowa cells productively infected with replication competent RD114 virus (ST Iowa/RD). Cells infected with RD114 produce the RD114 envelope that blocks any available receptor ASCT2, and interferes with subsequent infection by any virus that uses ASCT2 as a receptor. As expected, ST Iowa/RD cells were resistant to subsequent lacz (RD114). Interestingly, we found that infection of FA27-53 as well as FGA/ND on ST Iowa/RD cells was reduced by 1,000-fold when compared to infection on parental porcine cells. These findings suggested that the FA27-53 infection of porcine and human cells is mediated by the porcine ASCT2 receptor Figure 2-6 Figure 2-6 Interference between RD114 and FA Porcine (StIowa) cells (white) and porcine (StIowa) cells infected with replication competent RD114 (black) were challenged with lacz RD114, lacz FA27-53, lacz FGA, LacZ FGA-ND and lacz FeLV-B. Results are an average of three independent experiments. Error bars represent standard deviation.

58 Cells overexpressing the porcine ASCT2 are infected by FA27-53 pseudotyped virus To confirm the results of the interference assay, and test if FA27-53 uses porcine ASCT2, I isolated porcine homologue of ASCT2 (stasct2) and tested the sensitivity of MD cells overexpressing porcine ASCT2 (MD/stASCT2) to FA27-53 infection. The porcine ASCT2 cdna encodes a protein of 555 amino acids, shares 86% amino acid identity to human ASCT2, and has a conserved extracellular loop 2, which has previously been shown to be critical for RD114 receptor function (Marin et al., 2003)(Figure 2-7). As shown in Figure 2-8, cells overexpressing porcine ASCT2 showed increased infection by RD114 and FA This data indicated that porcine ASCT2 functions as a receptor for FA Figure 2-7 Amino acid sequence comparison of porcine and human neutral-amino-acid transporter, ASCT2. The porcine and human ASCT2 have 86% sequence identity and 94% sequence similarity. Identical amino acids are shaded, and transmembrane (TM) sequences are shown as lines over the amino acid sequence.

59 46 Figure 2-8 Mediation of infection by porcine ASCT2. Feline (CCC), Porcine (STIowa), Murine (MD) and MD cells overexpressing the porcine ASCT2 (MD/stASCT2) were challenged with lacz FA27-53 and lacz RD114. Expression of stasct2 increased the infection titers of both FA27-53 and RD114 on MD cells. Results are an average of three independent experiments. Error bars represent standard deviation Detection of cell line contamination While carrying out some concluding experiments for the characterization of the FA27-53 Env, I found that the packaging cell line producing the FA27-53 and FGA-ND Env bearing viruses were contaminated with RD114 virus. In this section I have described how I detected the contamination, and identified the contaminating virus as RD114. In light of the data presented in this section, the results reported for FA27-53 (Section 2.4.1) are no longer a characteristic of the FA27-53 Env but an artefact of RD114 contamination Packaging cell lines producing FA27-53 and FGA-ND expressing virus were contaminated with a replication competent virus with an RD114 like host range During the characterization of FGA-ND mutant carrying the additional V210A mutant, I discovered that the packaging cell lines producing some of the viruses were contaminated.

60 47 Sequence analysis of the envelope sequence of FGA-ND Env revealed that the clone not only carried the intended N51 and D59 mutations in the FGA backbone, but also a V210A mutation near the PRR (Figure 2-9). Pseudotyped FGA-ND V210 A viruses showed very low titers of infection on CCC cells, but efficiently infected porcine cells, as well as cells overexpressing hasct2 (Figure 2-4). To address this low infection on CCC cells, I re-cloned FGA-ND, carrying no additional mutation (Figure 2-9). Figure 2-9 Sequence alignment between FGA, FGA-ND (V210A) and FGA-ND. Sequence alignment between the first 350 amino acids of FeLV-A (FGA), the FGA-ND mutant with an extra V210A mutation, and the re-cloned FGA-ND mutant.env clones. Dots represent identical amino acids. The lacz FGA-ND efficiently infected feline cells. Surprisingly, this virus did not infect porcine cells. As a control I had also pseudotyped FA27-53 virus. Surprisingly, lacz FA27-53 also did not infect porcine cells or cells overexpressing hasct2, while it could efficiently infect feline CCC cells (Table 2-3). This finding was in disagreement with my earlier observations (see Figure 2-3), as well as the results from the Willet lab (see section 2.2.2). The new stocks of lacz FGA-ND and FA27-53 virus showed no infection on porcine cells, while the older stocks of virus (that were used to generate the data reported in section

61 ) could infect both feline CCC cells as well as porcine ST Iowa cells. Therefore, I carried out experiments to address this discrepancy in virus infection pattern. Table 2-3 Titers for pseudotyped virus expressing the recloned FGA-ND and FA Feline Porcine FGA-ND 5x FA x One possible explanation for this discrepancy was that the earlier data, showing FA27-53 and FGA-ND (V210A) infecting porcine cells and cells overexpressing ASCT2, were a result of a contamination. But before carrying out experiments to explore this possibility, I repeated the infection studies to confirm these results and check if there was an error in virus production or a specific block in infection of ST Iowa cells that was resulting in a loss of infection of porcine cells. I re-sequenced the env clones, and then generated, for a third time pseudotyped viruses expressing MLV gag/pol and either the FA27-53 env, or FGA (V210) env. While these viruses efficiently infected feline cells, there was no infection on porcine ST Iowa cells (Data not shown). As controls, I also pseudotyped FeLV-C, RD114 and FGA virus and tested their host range (Table 2-4). Table 2-4 Infection data for pseudotyped re-pseudotyped FeLV-C, FGA, RD114, FGA- NDV210A, FGA-ND and FA27-53.* Feline Porcine Human Murine NIH3T3/ NIH3T3/ NIH3T3/ (CCC) (STIowa) (TE671) (NIH3T3) FLVCR1 THTR1 ASCT2 RD114 _ + + _ + FeLV-C + _ + _ + FGA + + _ FA _ FGA-ND V210A + + _ FGA-ND + + _ * Infections are reported as + (infected) and - (no infection)

62 49 All the control viruses displayed their characteristic host range (Table 2-4). This indicated that there was no flaw in the pseudotyping process, and infectious virus was being produced (Data not shown). Through these studies, I concluded that there was no error in the envelope clone, the virus packaging cell line, virus production or the cell culture system, and yet the new stocks of FA27-53 and FGA-ND showed no infection on porcine cells. I therefore carried out experiments to investigate whether the old stocks of FA27-53 and FGA-ND (V210A) virus were able to infect porcine cells as a result of a contamination. I tested the virus producing cell lines that were used to generate the lacz FA27-53 (old) and the FGA- ND V210A (old) virus. I designed an assay, which took advantage of the replication incompetency of pseudotyped viruses, to investigate whether the cell lines were contaminated. The assay is described in Figure As a control I also tested cell lines used to generate the FGA (old), FGA-NN (old), and FGA-DD (old) as well as the newly generated FA27-53 (new) and FGA-ND (new). I used them as a control because these viruses did not infect porcine cells. For this assay, I harvested the virus from the packaging cell lines and used the virus to infect TELCeb6 cells. TELCeB6 cell line expresses the MLV gag/pol but no env gene, and therefore produce non-infectious virus. If the packaging cells were uncontaminated, the viruses produced from them would be replication incompetent and would not transfer any genetic material to the TElCeB6 cells. These infected TelCeB6 cells would continue to produce noninfectious virus. If the cell lines were contaminated, then the contaminating virus would transfer its genome into the TELCeB6 cells. These infected TELCeb6 cells would produce infectious virus expressing the envelope of the contaminating virus. Thus contamination would be detected during the second round of infection as blue, lacz positive colonies (Figure 2-10). The result of the infection assay showed that the virus producing cell lines that were used to generate the old batches of FA27-53 and FGA-ND (V210A) virus were both contaminated with a replication competent virus (Table 2-5). The second round of infection showed that virus from both these cell lines produced a contaminating replication competent virus. The host range of this contaminating virus resembled that of feline endogenous virus RD114 (Table 2-4).

63 Figure 2-10 Schematic showing the outcomes of the troubleshooting assay: a. Uncontaminated cell line. The cell line produces replication incompetent virus that cannot transfer genetic material to the packaging cell line during first round of infection. The virus harvested from this cell line does not express the envelope and is therefore non-infectious. b. Contaminated cell line: The cell line produces replication competent contaminating virus along with replication incompetent virus. The genome of the contaminating virus is transferred to the packaging cell line during the first round of infection. The virus harvested for the second round of infection is infectious expressing the envelope of the contaminating virus. 50

64 51 Table 2-5 Infection data for the second round of infection from troubleshooting assay. Cell Line Tested Feline (CCC) Porcine (STIowa) Human (TE671) Murine (NIH3T3) NIH3T3/ THTR1 NIH3T3/ ASCT2 FA27-53 (old) FGA- ND (old) FGA- NN (old) FGA- DD (old) FGA (old) FA27-53 (new) Feline (CCC) _ _ _ * Infections are reported as + (infected) and - (no infection) Contaminated packaging cell lines and feline CCC cells express replication competent RD114 virus To identify the contaminating virus, I carried out PCR on the cdna from virus producing cell lines that were used to generate the old stocks of FA27-53, FGA, FGA-ND (V210A), FGA-NN and FGA-DD using PCR primers designed specifically to amplify RD114 virus envelope. The results of the PCR matched perfectly with the results of the infection assay. The FA27-53 (od) and FGA-ND (V210A) (old) producing cell lines tested positive for RD114 virus envelope, while the other cell lines did not (Figure 2-11).

65 52 Figure 2-11 Amplification of RD114 envelope from packaging cell lines. cdna from packaging cell lines producing FA27-53 (old), FGA ND (old), FGA-DD (old), FGA-NN (old) and FGA (old) as well as FA27-53 (new) and feline CCC cells, was used as PCR template for amplifying RD114 Env using envelope specific primers. A plasmid encoding RD114 envelop was used as a positive control. The PCR products were run on a 1% agarose gel. While results of the infection assay and PCR confirmed the presence of contamination, the source of this contamination was unclear. Previous studies had reported the presence of RD114-like virus in feline CCC cells (Fischinger et al., 1973), so I tested the CCC cells for the production of a replication competent virus. Feline CCC cells tested positive for the production of a replication competent virus, with a host range identical to RD114 virus (Table 2-5). Furthermore cdna from CCC cells tested positive for RD114 envelope (Figure 2-11). These assays confirm that feline CCC cells produce a replication competent virus that may be the source of contamination of the virus producing cell lines. Cell lines producing viruses expressing the FA27-53 and FGA-ND (V210A) Env were contaminated with a replication competent RD114 virus. In light of this new evidence, the data suggesting that FA27-53 has an expanded host range to porcine cells have to be disregarded as an artefact of RD114 contamination.

66 2.5 Discussion In this study, I further characterized the virus envelope clone FA27-53 that was isolated from a primary FeLV isolate. Results reported in the first part of this study suggested that FA27-53 had an expanded host range to porcine and human cells, and that it used the RD114 receptor ASCT2 as well as the FeLV-A receptor THTR1 for infection. Unfortunately, concluding experiments showed that this data was an artefact of RD114 contamination of the packaging cell lines. As a consequence of this discovery, none of the data generated as a part of this study, can be considered novel. The results reported in this study, also emphasize the grave danger of retroviral contamination in a cell culture system and stress the need for containment and quality controls when reporting retroviral infection studies Why was the RD114 contamination not detected earlier in the study? It is essential to address why this contamination was not detected and contained earlier in the study. The first reason is that the phenotype that was a result of the contamination was observed in two independent laboratories. FA27-53 was one of many different Envs isolated and characterized by Dr Willet s lab (University of Glasgow). Other Env clones, isolated and pseudotyped along with FA27-53 did not have an expanded host range to porcine cells. In further experiments carried out in the Willet lab they observed that viruses expressing the FA27-53, FGA-ND Envs seemed to infect human cells more efficiently compared to the FGA prototype. Initial infection studies carried out in our lab were in agreement with these observations. FA27-53 and FGA-ND expressing viruses infected porcine and human cells efficiently while the prototype FGA did not. As similar observations were made independently in our laboratory and in the Willet lab, using two different packaging cell lines, we did not suspect contamination. The second reason why contamination of RD114 virus was not detected earlier in this study was because the contamination was restricted to only some of the virus packaging cell lines. What made this more complicated was that the cell lines that were contaminated produced FA27-53 and FGA-ND bearing viruses. Based on the initial observations that FA27-53 has an expanded host range to porcine and human cells, I had hypothesized that this phenotype was a result of the amino acid changes in the FA27-53 Env compared to the FeLV-A Env (Figure 2-2). Thus when viruses bearing the FGA-ND Env, which is FA27-53 like in its amino acid sequence, 53

67 54 also infected porcine cells, the infection did not raise any concerns and fit the hypothesis perfectly. I had made this hypothesis based on the critical role of amino acids in the VRA. It has previously been shown that small changes in the VRA can alter host range and receptor specificity of the FeLVs (Brojatsch et al., 1992) (Bupp et al., 2002). Bupp et al. generated a library of FeLV Env clones in an FeLV-A backbone that have random amino acids in the VRA region (Bupp et al., 2002). These clones represent possible evolutionary intermediates between FeLV-A and FeLV-C. Interestingly, they found several envelopes through this screen that had small variation in the VRA sequence compared to the parental FeLV-A or FeLV-C virus, but displayed phenotypes distinct from both FeLV-A and FeLV-C. Some of these synthetic envelopes showed distinct host range, and others showed alternate receptor use (Bupp et al., 2005; Bupp and Roth, 2003; Bupp et al., 2002; Sarangi et al., 2007). These studies raised the possibility that virus variants, with alternate host range and receptor use may arise as a result of mutations in the VRA during the natural evolutionary process in an infected cat. FA27-53 fit the profile of such an evolutionary intermediate. It had few mutations in the VRA, and displayed an expanded host range. In light of these studies I had hypothesized that FA27-53 is a natural evolutionary intermediate and amino acid changes in the VRA, D51N and the N59D, were critical for the expanded host range displayed by FA Thus when viruses bearing the FA27-53 and the FA27-53-like Env FGA-ND Envs showed an expanded host range to porcine cells, the data fit the hypothesis. Viruses bearing the FGA and FGA-NN did not infect porcine cells which further strengthened the hypothesis. This differential infection pattern, suggested that the results were authentic, as the probability of contamination in only two of the cell lines was very low. The second part of characterizing FA27-53 was identifying the receptor FA27-53 Env used to infect porcine cells. I had hypothesized that FA27-53 must use a receptor in porcine cells, that cannot function efficiently as a receptor for FeLV-A. There were several possible explanations for this phenotype. The first explanation was that FA27-53 Env had acquired the ability to use the porcine ortholog THTR1, which does not function as a receptor for FeLV-A. Small changes in the receptor sequence between orthologous species affect their receptor function. For example, E-MLV can only use mouse CAT-1 as a receptor for infection, but not its human ortholog hcat1, which is 87% identical (Albritton et al., 1993; Yoshimoto et al.,

68 ). Another explanation was that FA27-53 had acquired the ability to use a receptor other than THTR1. Several γ-retroviruses have been shown to use two closely related receptors. For example FeLV-B uses both Pit1 its paralog Pit2 as a receptor (Boomer et al., 1997; Sugai et al., 2001). It was possible that FA27-53 used other paralogs of THTR1, like THTR2, as receptors in porcine cells. Finally, because FA27-53 was isolated from a primary virus isolate, known to be a mixture of FeLV-A/C, it was possible that FA27-53 was an evolutionary intermediate between FeLV-A and FeLV-C and was dual tropic in its receptor use. In this case, FA27-53 would use both the FeLV-A receptor, THTR1, and the FeLV-C receptor, FLVCR1. Something similar is observed in HIV, where some viruses use the chemokine receptor CCR5 as a co-receptor, some use CXCR4 as a co-receptor and other variants are dual tropic and use both CCR5 and CXCR4 as a receptor [Reviewed in (Regoes et al., 2005)]. While testing FA27-53 receptor use, I observed that cells overexpressing hasct2 were susceptible to infection. While this observation was surprising, it was not unexplainable. ASCT2 is a promiscuous receptor, used by several different viruses including, feline endogenous virus RD114, Baboon Ape Endogenous virus (BAEV), Human Endogenous Retrovirus-W (HERV- W) as well as many other avian retroviruses (Sommerfelt et al., 1990). ASCT2 is also highly expressed in many different tissues. Therefore, when I observed infection of FA27-53 on cells overexpressing ASCT2, I hypothesized that ASCT2 might serve as a default receptor for many different retroviruses. FA27-53 could use ASCT2 to expand its host range and infect cell types that then provide an optimal environment for further evolution to FeLV-C. In hindsight, this hypothesis was inaccurate, and the use of ASCT2 as a receptor by FA27-53 expressing viruses was a result of RD114 contamination. There were two observations that led to the detection of RD114 contamination. The first observation was that FA27-53, as well as FGA-ND, Env surface units (SUs) did not bind porcine cells or cells overxpressing ASCT2, even though both viruses efficiently infected these cells. Several studies have reported similar observations. Some viruses may infect cells expressing particular receptors, even when no detectable binding is observed between that receptor and the virus envelope SU (Brown et al., 2006). It has been suggested that this is so because the technique used to detect envelope-receptor binding is not sensitive enough to detect this interaction for all envelopes and receptors, especially if the interactions are transient. Thus I

69 56 initially thought that the inability to detect FA27-53 and FGA-ND envelope binding was just an example of the limitations of the binding assay. The second observation that ultimately led to the discovery of contamination was the V210A mutation in the FGA-ND Env (FGA-ND V210A). While viruses expressing the FGA- ND V210A Env infected porcine and ASCT2-expressing cells efficiently, feline CCC cells were weakly susceptible. To understand why these viruses infected feline cells weakly I decided to re-clone FGA-ND without a V210A mutation. Experiments leading from the re-cloning of FGA-ND revealed the contamination of packaging cell lines (see Section 2.4.2). While the discovery of RD114 contamination puts an end to studying FA27-53, the V210A mutation might be of interest. The FGA-ND Env is a functional protein that is FeLV-A like in its host range as well as receptor use. Introducing just one V210A mutation renders this envelope defective. This V210 residue is conserved between all the FeLVs and is in the PRR, a region critical for fusion. Very little is known about the exact mechanism of viral fusion after envelope-receptor binding, and further characterization of V210 residue in different FeLVs may shed some light on the role of PRR in fusion. Initial studies have shown that the FGA-ND envelope carrying this V210A mutation can efficiently bind the receptor THTR1 (Figure 2-4), but is defective in infection. Furthermore, this fusion defect cannot be rescued by providing a correct copy of PRR in trans (Data not shown) How did the packaging cells get contaminated with RD114 virus? Packaging cell lines expressing the FA27-53 Env and FGA-ND Env tested positive for contamination with a replication competent retrovirus (Section 2.4.2). Contamination of cell lines with retroviruses has been reported by several groups. Frequently the contaminants have been identified as γ-retroviruses, including MLV, GALV and RD114 (McAllister et al., 1969; Asikainen et al., 1993; Burtonboy et al., 1993; De Boer et al., 2000; Kotler et al., 1977; Middleton et al., 1992; Oda et al., 1983; Raisch et al., 1998; Yaniv et al., 1980; Takeuchi et al., 2008). Three main sources of γ-retrovirus contamination have been identified in cell lines. The most common source of contamination is endogenous retroviruses. Several established cell lines have been passaged through animals that express retroviruses endogenously. Contamination of

70 57 some human cell lines with X-MLV, for example, was traced back to implantation of the human cells in mice where the cells acquired X-MLV (Kotler et al., 1977; Takeuchi et al., 2008). Another possible source of γ-retrovirus contamination is retroviral based vectors. Many cell lines have been established by introducing constructs using retroviral vectors (Takeuchi et al., 2008; Chenine et al., 2000; Platt et al., 1998b). Replication competent helper viruses can arise as a result of recombination events between the retroviral vector and the packaging construct. These replication competent retroviruses are thought to be the source of contamination for some of the cell lines (Takeuchi et al., 2008). The third source of γ- retroviruses is laboratory based contamination (Parent et al., 1998; Okabe et al., 1976; Chan et al., 1976; Takeuchi et al., 2008). I suspect that in this study, because only two of the packaging cell lines tested positive for contamination while other cell lines did not, laboratory based contamination is the most plausible source of RD114 in my packaging cell lines. I identified the virus contaminating the packaging cell lines as the feline endogenous virus, RD114. The genus Felis expresses two endogenous retroviruses; endogenous feline leukemia virus (enfelv) and RD114 virus (Benveniste and Todaro, 1974; Benveniste et al., 1975; Reeves et al., 1984). RD114 was initially isolated from a rhabdomyosarcoma cell line (McAllister et al., 1969). These rhabdomyosarcoma cells were inoculated in fetal kittens in utero to generate tumours where they acquired the endogenous feline virus (McAllister et al., 1969). RD114 shows high degree of homology to baboon endogenous virus and it has been speculated that it entered the cat genome as a result of cross-species transmission. Feline genomic DNA contains about twenty copies of RD114 like sequence (Neiman, 1973; Okabe et al., 1973). Most of them have lost their env gene and it was assumed that RD114 was replication incompetent (Reeves et al., 1984). But, replication competent RD114 virus was isolated from feline CCC cell line, showing that RD114 could be activated (Fischinger et al., 1973). Endogenous viruses may become activated during normal culturing of cell lines, or as a result of exposure to chemicals, specifically halogenated pyramidines (Aaronson et al., 1971; Aaronson, 1971; Aaronson et al., 1969). RD114, became activated spontaneously in the CCC cell line, after several passages of continual culturing (Fischinger et al., 1973).

71 58 The feline CCC cells used in my studies have tested positive for the expression of activated, replication competent RD114 virus (Figure 2-11). While the contamination was detected in TELCeB6 packaging cell line, CCC cells were probably the source of contamination. While all cells are cultured in individual flasks, and great precaution is taken to contain each cell line, even a drop of media containing replication competent RD114 would have been sufficient to contaminate FA27-53 and FGA-ND Env expressing cell lines. However, I cannot explain how only two virus producing cell lines (FA27-53 and FGA-ND) got contaminated, while others (FGA, FGA-NN and FeLV-C) remained uncontaminated. Furthermore, I also cannot explain the results from the Willet lab, who also reported that FA27-53 infects porcine cells. One possible explanation for the specific contamination of FA27-53 and the FA like FGA-ND is that these viruses specifically activated RD114-like virus in the packaging cell line. The virus packaging cell line TELCeb6 is derived from human TE671 cells. They do not usually produce any replication competent virus, and there have been no reports of any endogenous RD114-like viruses in these cells. To further confirm this, I have carried out PCR on the genomic DNA from these cell lines using RD114 specific primers, and I have not been able to detect any RD114-like viral elements (Data not shown). Furthermore I have not observed this specific activation in any of the subsequent attempts to generate FA27-53 and FGA-ND Env bearing viruses. While the discovery of this contamination has rendered the data collected for FA27-53 unpublishable, it has highlighted the importance of containment and vigilant testing of cell culture system. Several different assays can be used to routinely screen for retrovirus contamination. One of the assays to determine if a cell lines is contaminated with a replication competent virus is the troubleshooting assay reported in section (Figure 2-10). While this assay effectively detected the presence of RD114 for this study, there are several downsides to this assay that may not make it the most effective technique to screen for contamination routinely. The first problem is that this assay is time consuming. For the assay, supernatant from a contaminated cell line is used to infect a packaging cell line that does not express the Env (Figure 2-10). The cell line is maintained with the contaminated supernatant for 7-10 days to allow virus propagation. After 7-10 days the supernatant from the packaging cell line is used to test for infectious particles. Thus the assay takes between 2-3 weeks to test each cell line. The

72 59 other disadvantage of using this assay is that it depends on the ability of the contaminating virus to infect the packaging cell line. If the contaminating virus has a restricted host range, it will not be able to infect the packaging cell line, and the assay will result in a false negative result. This assay is probably a good technique to confirm retrovirus contamination, but not routinely screen for it. A more efficient method to check for retrovirus contamination is testing for RT activity. This technique is probably the best way to routinely test cell lines for contamination, as it is a quick assay and is not dependant on the type of retrovirus or the host range of contaminating retrovirus. RT activity can be detected using a quick real-time-pcr-based assay which uses brome mosaic virus RNA as the template and SYBR Green as a fluorescent dye (Arnold et al., 1998). This assay has been used to detect the presence of RT, as well as retrovirus contamination in cell culture system (Arnold et al., 1998; Takeuchi et al., 2008). Many cell lines have the potential to produce infectious retroviruses. Retroviruses can emerge naturally in cell lines from endogenous elements, recombination events or crosscontamination and thus testing of cell lines that may previously have tested negative for retroviruses is required. Not only can retrovirus contamination be detrimental to the outcomes of an experiment, emergence of replication competent retroviruses, especially those that have the potential to infect human cells, pose a biohazard and a risk to the investigator.

73 60 3 POTENTIAL USE OF CO-FACTORS/CO-RECEPTORS BY FELINE LEUKEMIA VIRUSES 3.1 Abstract The entry of FeLVs into host cells is mediated by interaction of the viral envelope protein with specific host cell surface receptors. Studies have suggested that this receptor provides all the necessary determinants for FeLV infection. I have now obtained evidence that suggests that in addition to using their cognate receptor, FeLVs may also use a co-receptors/cofactors for infection. In this study, I have shown that FeLVs inefficiently infect murine NIH3T3 cells even when the primary FeLV receptors are over-expressed (NIH3T3/Receptor), whereas FeLVs efficiently infect murine Mus dunni (MD) cells expressing FeLV receptors (MD/Receptor). I have found that the low level of FeLV infection on receptor expressing NIH3T3 cells is not due to low receptor expression, glycosylation of the receptor, a block in virus binding nor a block at post-entry stage of FeLV infection. Fusion of the FeLV receptor expressing NIH3T3 cells with murine MD cells significantly enhances FeLV infection. These findings suggest that FeLVs may require a co-factor/co-receptor for infection that is missing (or expressed at low levels) in NIH3T3 cells. Future studies will include identifying and characterizing the FeLV co-receptor/co-factor. The identification of co-factors/co-receptors used by FeLV will not only help better understand FeLV entry and pathogenesis, it will also aid in developing more efficient specific cell targeting FeLV vectors for gene therapy. Furthermore, the use of a co-receptor by FeLVs shows striking analogy to HIV entry, which uses the primary receptor CD4 and the co-receptors CCR5 and CXCR4 for infection. This raises the possibility of an important common relationship between FeLV and HIV. 3.2 Introduction Understanding of the mechanism of virus-cell interaction is essential for understanding retrovirus entry and pathogenesis, as well as for developing efficient specific cell targeting retrovirus vectors for gene therapy. The most common retrovirus vectors used for human gene therapy are based on γ-retroviruses. Unlike the currently used γ-retroviral vectors, Feline leukemia virus subgroup C (FeLV-C) has been shown to efficiently transduce hematopoietic

74 61 stem cells (HSC). Gene therapy of HSCs provides appealing prospect for gene therapy of hematopoietic disorders (Lucas et al., 2005), and has thereby peaked interest in further understanding the mechanism of FeLV infection. The current model for the virus cell interaction for FeLV, as well as for other γ- retroviruses, is based on studies carried out on murine leukemia virus (MLV). The interaction of γ-retroviruses with the cell involves multiple steps. The first step for infection is the adsorption of the retrovirus to the surface of the cells. Adsorption is receptor independent and relies on other factors expressed on the cell surface including heparan sulfates, integrins and lectins to name a few (Pizzato et al., 1999; Pizzato et al., 2001; Tailor et al., 2003). These accessory attachment factors or capture complexes form weak reversible bonds with the virus and allow it to graze over the cell surface until it makes contact with the receptor. Accessory binding factors are not sufficient for viral infection, and for γ-retroviruses Env-receptor binding is a pre-requisite to viral membrane fusion. Binding of the virus envelope glycoprotein to a cell surface receptor leads to irreversible conformational changes in the viral Env that ultimately bring the viral membrane in close proximity to the cell membrane for fusion [Reviewed in (Tailor et al., 2003)]. The exact details of the conformational changes in the virus envelope that ultimately leads to fusion are not clear and may be unique to different virus envelopes. Several lines of evidence have suggested that the envelope glycoprotein trimerizes and interacts with complexes of receptor molecules. The number of receptors available for virus infection correlates with the efficiency of viral infection (Kurre et al., 1999; Macdonald et al., 2000; Relander et al., 2002; Tailor et al., 2003). It has actually been suggested that expression of viral receptor on target cells is the major determinant for virus infection. While this model is generally accepted, there is evidence that suggests that receptor expression may not be sufficient to explain the efficiency of γ-retrovirus infection. Several studies, including data presented in this chapter, suggest that the presence of an accessory protein may act as the limiting factor in γ-retrovirus infection. Wang et al. showed that infection of E-MLV did not correlate with receptor expression, and some cell lines did not support efficient virus infection even when the receptor, CAT1, was expressed. They concluded that another cellular component facilitated virus infection post envelope-receptor binding (Wang

75 62 et al., 1991). Similar results have been observed for GALV (Eiden, M. Personal Communication). Cells expressing different levels of GALV receptor, Pit1, are equally susceptible to GALV infection. Studies with both E-MLV and GALV propose that γ- retroviruses may require multi-component receptors; primary binding receptor and a fusion coreceptor. A prominent precedent for multi-component receptor exists in lentiviruses, like HIV. HIV-1 enters cells by binding to two key molecules on the cell surface. The primary biding receptor CD4 was the first to be indentified in 1984 (Klatzmann et al., 1984). It was observed that while CD4 mediated HIV-1 infection in human cells, the expression of CD4 in non-primate cell lines was not sufficient for HIV-1 infection (Maddon et al., 1986; Ashorn et al., 1990). Furthermore, fusion of these non-primate cell lines to human cells rendered the non-primate cell lines susceptible to HIV infection. These observation led to the conclusion that cell type specific surface co-receptors/co-factors are required in addition to CD4 for HIV-1 entry that are not expressed by non-primate cells. The first co-receptor identified was the chemokine receptor CXCR4 (Feng et al., 1996). With the discovery of other co-receptors, the model of HIV infection evolved whereby binding of the HIV Env glycoprotein to the primary receptor CD4 induces a conformational change in the Env and exposes sites for association with the co-receptor. Interaction with the co-receptor results in further conformational changes that allow fusion (Chan and Kim, 1998). While the current model for γ-retroviruses does not involve the use of a co-receptor, it has been demonstrated that γ-retrovirus infections are more complex than just envelope-receptor binding triggering envelope fusion. It has been shown that additional factors are required for efficient E-MLV infection post binding. Kumar et al. have observed that the cellular protease cathepsin B acts at an envelope dependent step to aid infection of ecotropic Moloney MLV. Cathepsin B was shown to cleave the surface unit of the envelope glycoprotein, to allow conformational changes leading to virus fusion (Kumar et al., 2007). In this chapter, I report preliminary data suggesting that FeLVs may require additional co-factors/co-receptors for infection. Evidence suggests that this co-factor/co-receptor is likely involved in a step post binding. Identification of this co-factor/co-receptor will be critical for further understanding the key stages between viral envelope binding to its receptor and viral

76 63 envelope fusion with the cellular membrane. This will not only help better understand the FeLV entry and pathogenesis, it will also aid in developing more efficient specific cell targeting FeLV vectors for gene therapy. 3.3 Materials and Methods Cell lines Murine Mus. dunni tail fibroblast (MD), murine NIH3T3 cells and human TE671 derived TELCeb6 cells were maintained in Dulbecco's minimal essential medium with low glucose (1000 mg/ml) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Invitrogen). TELCeB6 cells are retroviral -packaging cells that do not express retroviral envelope genes and produce non-infectious virus (Cosset et al., 1995). These cells were maintained using 6 μg/ml of blasticidine to ensure selection of gag pol-expressing cells. Human embryonic kidney (HEK) 293-T cells and HEK-293T-derived Phoenix ampho packaging cells (ATCC: SD3443) were maintained in Dulbecco's minimal essential medium with high glucose (4500 mg/ml) supplemented with 10% FBS. Phoenix ampho packaging cells produce replication-defective virus expressing amphotropic MLV envelope. Hamster kidney, BHK cells were maintained in Apha-minimal essential media supplemented with 10% heat-inactivated FBS. NIH3T3/FLVCR1, MD/FLVCR1, NIH3T3/THTR1, MD/THTR1 and MD/ASCT2 cells were generated using pfbneo-hfvlcr1-ha, pfbneofethtr1-ha and plpcx-hasct2-myc retroviral expression vectors respectively. The plasmids were introduced in Phoenix ampho retroviral packaging cells by transfection using PolyFect reagent (QIAGEN). Two days posttransfection, supernatant was harvested and filtered using a 0.45-µm -pore-size filter. Filtered viral supernatant was used to infect MD cells and NIH3T3 cells to stably introduce the receptor. Infected cells were selected using either G418 (1.5 mg/ml) (for cells transfected with pfbneohfvlcr1-ha, pfbneofethtr1-ha) or puromycin (5µg/ml) (for cells transfected with plpcx-hasct2-myc). Resistant colonies pooled and maintained for infection and binding assays. NIH3T3 and MD cells overexpressing Pit1 were generated by introducing POJ9 (pcdna1 expression vector expressing hpit1) (Johann et al., 1992) using PolyFect transfection

77 64 reagent (QIAGEN). Cells were selected with G418 (1.5 mg/ml) and resistant colonies were pooled and maintained. NIH3T3/ASCT2 cells were generated using PCDNA3.1V5H-hASCT2-myc (Tailor et al., 1999b). The mammalian expression vector PCDNA3.1V5H expressing hasct2-myc was transfected into NIH3T3 cells using PolyFect (QIAGEN) reagent. Cells were selected using G418 (1.5 mg/ml). Resistant colonies were pooled and maintained for infection studies. BHK/FLVCR1 and BHK/THTR1 cells were generated by introducing pfbneohflvcr1-ha and pfbneofethtr1-ha into BHK cells respectively using PolyFect transfection reagent. All cells were maintained at 37 o C in 5% CO 2, unless otherwise stated Viruses and infection studies Viruses encoding β-galactosidase and expressing the specified envelope were generated by transfection of TELCeB6 cells with the respective pfbsalf Env expression constructs. Transfectants were selected using phleomycin (75 μg/ml), resistant colonies were pooled, virus supernatant harvested, filtered using a 0.45-μm filter and then subsequently used for infection studies. Target cells were seeded in a 24-well plate; BHK and MD cells seeded at 1x10 4 cells/well and NIH3T3 cells at cells/well, one day prior to the infection study. The following day, target cells were incubated with 1 ml of serially diluted lacz pseudotyped virus supernatant for 4h in the presence of polybrene (8 μg/ml). The virus supernatant was then replaced with fresh growth medium, and cells were allowed to incubate for a further 2 days before X -gal (5-bromo-4-chloro-3-indoyl-β-d43 galactopyranoside) (Sigma-Aldrich, Canada) staining. Infected cells were stained by treating cells with 0.25% glutaraldehyde and assayed for β-galactosidase activity with X-gal as a substrate. LacZ pseudotyped titers were determined by counting the number of blue colony-forming units (CFU's), and titers were expressed as the number of CFUs obtained per milliliter of undiluted virus supernatant SU binding assay The surface units for FeLV-C and FeLV-A were amplified using upstream primer (CTO432) 5 -TAGCTCAGACGATCCATCAAGATGGAAAGTCCAACGCACCCA-3 and a downstream primer (CTO415) 5 -GGGGGAGCTCGTAAATATATTCGGGTTGATG-3. The

78 65 downstream primer encodes a Sac1 site. A 200 base pair region was amplified using the upstream primer (CTO418) 5 -GGACGTCGGAGGAAGCTTGAT-3 and downstream (CTO433) 5 -TGGGTCGGTTGGACTTTCCATCTTGATGGATCGTCTGAGCTA-3 and added to the amplified SU by stitching the two PCR products together using the upstream primer (CTO418) 5 -GGACGTCGGAGGAAGCTTGAT-3 and downstream primer (CTO415) 5 -GGGGGAGCTCGTAAATATATTCGGGTTGATG-3. The PCR product was digested with Sac1 and ligated into Sac1 digested pcs vector that codes for a double hemaglutinin tag in frame with the SUs. Soluble HA-tagged SUs were generated by transfection of HEK293T cells with the respective pcs expression constructs using PolyFect (QIAGEN). Culture medium containing the SUs was harvested 48 h post transfection, filtered using a μm filter and subsequently used for SU binding assay or stored at 80 C for later use. Binding of soluble SUs to target cells was carried out as previously described (Brown et al., 2006). Briefly, target cells were dislodged from culture flask using a cell dissociation buffer (Invitrogen) and approximately cells were incubated with 1 ml of SU containing medium in the presence of polybrene (8 μg/ml) for 30 min at 37 C. Cells were then centrifuged at 4000 rpm for 3 min and then washed twice with wash buffer (PBS containing 2% FBS, (PFBS). Cells were incubated with a 100ul of PFBS containing monoclonal anti HA.11 antibody at a dilution of 1:200 (Covance, Berkley, CA) for 30 min at 4 C with gentle agitation every 10 min. Cells were subsequently washed twice with wash buffer and then incubated for 30 min at 4 C with 100ul of PFBS containing donkey anti-mouse antibody, at a dilution of 1:50, conjugated to fluorescein isothiocyanate (1 mg/ml) (Sigma) The cells were subsequently washed twice, fixed with 1% paraformaldehyde, and subsequently analyzed by flow cytometry Analysis of receptor expression Cell surface expression of receptors was analyzed by Western blot analysis. Cell membrane samples were prepared from cells grown to confluence in 150-mm diameter tissue culture plates. Cells were initially washed with PBS and then resuspended in 3 ml of cold membrane lysis buffer (20 mm Tris [ph 7.4], 5 mm EGTA, 1 mm phenylmethylsulfonyl fluoride, 20 mm aprotinin). Cells were scraped from the tissue culture dish using a cell scraper and then homogenized using a Dounce homogenizer. The nuclear fraction was pelleted by centrifugation at 1,000 x g for 20 min at 4 C. Membrane fractions were pelleted by centrifugation of the nucleus-free supernatant at 30,000 rpm for 1 h at 4 C in a Beckman SW41

79 66 rotor. The membrane pellet was resuspended in 40 µl of PBS. Twenty microliters of membrane sample was run on a 10% SDS-polyacrylamide gel. Proteins were transferred to a nitrocellulose membrane (Pall, Pensacola, FL). For detection of receptor expression, the membrane was analyzed using a 1:1000 diluted anti HA-HRP antibody (Sigma Aldrich). For loading control, the remaining 20 µl of membrane sample was run on another 10% gel and transferred to a nitrocellulose membrane, which was subsequently incubated with a monoclonal antibody against the α-subunit of the sodium potassium ATPase membrane protein (Na + /K + ATPase) (Sigma-Aldrich), followed by goat anti-mouse antibody conjugated to HRP (1 in 5,000 dilution) (Sigma-Aldrich). Signals were detected using chemiluminescence reagent (Perkin Elmer, Boston, MA), followed by exposure to Kodak Biomax MR film Testing receptor glycosylation Cells were grown with or without tunicamycin to test for receptor glycosylation as described previously (Miller and Miller, 1992; Tailor et al., 2000b). Briefly, for infections in the presence of tunicamycin, cells were seeded in a 24 well plate at 3 x 10 4 cells/well. After cells adhered to the plate (approximately four hours), media was replaced with 1ml of media containing 250 ng/ml of tunicamycin (Sigma-Aldrich). Cells were allowed to grow in media containing tunicamycin over night. For infections in the absence of tunicamycin, cells were seeded in a 24 well plate at 3 x 10 4 cells/well and the media was not changed after the cells adhered to the plate. The following day, cells treated with (+) or without (-) tunicamycin were incubated with 1 ml of serially diluted lacz pseudotyped virus supernatant for 4 h in the presence of polybrene (8 μg/ml). The virus supernatant was then replaced with fresh growth medium, and cells were allowed to incubate for a further 2 days before X -gal (5-bromo-4-chloro-3-indoyl-β-Dgalactopyranoside) (Sigma-Aldrich, Canada) staining. Titers were determined by counting the number of blue colony-forming units (CFU's), and titers were expressed as the number of CFUs obtained per milliliter of undiluted virus supernatant Generation of hybrid cell lines MD cells resistant to puromycin (MD-puro) were generated by infecting Mus dunni cells with Phoenix ampho virus expressing the retroviral expression vector pbabe-puro. MD-puro

80 67 cells were selected using puromycin (5mg/ml) and resistant colonies were pooled and used to generate hybrid cells. To make hybrids between NIH3T3/Receptor cells and MD-puro cells, 5x10 5 NIH3T3 cells expressing either fethtr1 (NIH3T3/feTHTR1) or hflvcr1 (NIH3T3/hFLVCR1) and 2x10 5 MD-puro cells were seeded in a 60mm culture dish. The cells were incubated at 37 o C in 5% CO 2 over night. For fusion, the culture media was removed, and the cells were washed 1x with PBS and over laid with 1.5 ml of PEG1500 (ROCHE) and incubated at room temperature for exactly 1 minute. After 1 minute, the PEG was aspirated and the cells were washed three times with minimal essential medium with low glucose (1000 mg/ml) containing no FBS. After PEG treatment the cells were maintained low FBS media (minimal essential medium with low glucose (1000 mg/ml) supplemented with 2% heat-inactivated bovine serum (FBS) (Invitrogen). The cells were allowed to recover from PEG treatment for 4-6 hours, after which they were trypsinized and transferred to a 100 mm culture dish. They hybrid cells were selected with a dual antibiotic selection (1.5 mg/ml and 5 µg/ml puromycin). Clones resistant to both G418 and puromycin appeared in 5-6 days, were pooled and used for infection studies. To make hybrids between BHK/Receptor cells and MD cells 2 x 10 5 BHK NIH3T3 cells expressing either THTR1 (BHK/THTR1) or hflvcr1 (BHK/FLVCR1) and 2 x 10 5 MD-puro cells were seeded in a 60 mm culture dish. The fusion protocol described above was used to create hybrids, with the exception that the media used to maintain MD-BHK/Receptor cells was Alpha-minimal essential media supplemented with 2% heat-inactivated fetal bovine serum (FBS) (Invitrogen). 3.4 Results FeLVs infect NIH3T3 cells expressing specific FeLV receptors inefficiently compared to Mus dunni (MD) cells expressing specific FeLV receptors Mouse cells are generally resistant to FeLV infection, unless the specific receptor for FeLV is overexpressed. Infection studies using the FeLV-A showed that Mus dunni (MD) tail fibroblast cells, are resistant to FeLV-A infection unless the FeLV-A receptor THTR1 is overexpressed (MD/THTR1). Interestingly, a different mouse cell line, NIH3T3 cells, are only

81 68 weakly susceptible to FeLV-A infection, when the same receptor THTR1 is overexpressed (NIH3T3/THTR1) (Figure 3-1). This phenomenon is not unique to FeLV-A. NIH3T3 cells overexpressing the FeLV-C receptor FLVCR1 are only weakly susceptible to FeLV-C infection compared to MD/FLVCR1 cells (Figure 3-1). Similarly NIH3T3/Pit1 cells show lower titers of infection compared to MD/Pit1 cells when infected with FeLV-B virus (Figure 3-1). Figure 3-1 Infection study on murine NIH3T3 and MD cells expressing different γ-retrovirus receptors. lacz pseudotyped FA27-53, FeLV-A, FeLV-B, FeLV-C, and RD114 were used to infect NIH3T3 cells and MD cells expressing their respective receptors. LacZ A-MLV was used to infect NIH3T3 cells and MD cells not expressing any receptor. Titers are from one representative infection study Low titer on NIH3T3/Receptor cells is not a result of a defect in virus infection post entry To test if differential susceptibilities of NIH3T3 and MD cells were specific to FeLVs, I tested the infection titers of other viruses. A-MLV, that naturally infects mouse cells, showed comparable infection on both NIH3T3 and MD cells (Figure 3-1). Furthermore, feline endogenous virus RD114 infected both NIH3T3 cells and MD cells overexpressing its cognate

82 69 receptor ASCT2 equally well. These studies suggest that NIH3T3/Receptor cells are weakly susceptible specifically to FeLVs. All viruses used for infection were pseudotyped viruses, expressing the MLV gag/pol, a lacz marker gene and the envelope of the indicated virus. Because the viruses differ only in the envelope glycoprotein expressed, the block in infection observed on NIH3T3 cells is specific to the FeLV envelope-receptor interaction. If the block was post entry, MLV and RD114 would also show lower titers of infection on NIH3T3 cells. These studies indicate that the there is no post entry block in retrovirus infection of NIH3T3 cells Inefficient FeLV infection on NIH3T3/Receptor cells are not due to low receptor expression One possible explanation for low titers of FeLV infection on NIH3T3/Receptor cells is low receptor expression. To determine the levels of receptor expression on NIH3T3/Receptor and MD/Receptor cells, crude membrane preparations from NIH3T3/THTR1 cells and MD/THTR1 cells were analyzed for protein expression (Figure 3-2a). The expression of THTR1 was normalized against the expression of a commonly expressed cell surface protein, Na + /K + ATPase. Densitometry analysis revealed that NIH3T3/THTR1 cells and MD/THTR1 cells showed comparable expression of the receptor (Figure 3-2a). Similar results were obtained for protein expression analysis for cells overexpressing the FeLV-C receptor, NIH3T3/FLVCR1 and MD/FLVCR1 (Data not shown). This expression analysis indicates that the NIH3T3 cells overexpress the FeLV receptors at levels comparable to MD/receptor cells and the low titres of infection cannot be attributed to the cell surface expression of the FeLV receptor FeLV SU binds efficiently to both NIH3T3/Receptor and MD/Receptor cells Another possible explanation for low FeLV titers on NIH3T3/Receptor cells, compared to MD/Receptor cells is that FeLV Env protein does not bind to its cognate receptor efficiently on NIH3T3 cells. The binding of FeLV-A envelope surface unit (SU) was tested on NIH3T3/THTR1 cells and compared to binding of FeLV-A SU on MD/THTR1 cells. Efficient binding of was observed on both cell lines (Figure 3-2b ).Similar efficient binding was seen for

83 70 Figure 3-2 Receptor expression, receptor binding and receptor glycosylation on NIH3T3 cells. A. Western blot analysis of fethtr1 expression on NIH3T3 and MD cells. Crude membrane preparations from NIH3T3 cells and MD cells overexpressing fethtr1 were analyzed for protein expression. fethtr1 was tagged with HA and detected using a conjugated anti HA-HRP antibody. The loading control for Na + /K + ATPase is shown. Densitometry analysis was performed to compare relative expression of fethtr1 on NIH3T3 and MD cells. B. Surface envelope (SU) binding of FeLV-A on NIH3T3 and MD cells expressing fethtr1. Cells were incubated with (white) or without (black) surface envelope protein tagged with a double HA epitope. Bound SU protein was detected using mouse anti-ha antibody (HA.11) and fluorescein-conjugated donkey anti-mouse antibody. An increase in fluorescence (white histogram) denotes SU binding. C. Infection study to analyze the role of glycosylation of fethtr1. NIH3T3/feTHTR1 cells treated with or without tunicamycin were challenged with lacz FeLV-A (white), and RD114 (black). Titers are from one representative infection study.

84 71 FeLV-C on NIH3T3/FLVCR1 cells (Data not shown), suggesting that there is no block in SU binding for NIH3T3/Receptor cells. The low titers are possibly due to a post- binding block Inefficient FeLV infection on NIH3T3/Receptor cells cannot be attributed to glycosylation of cell surface receptor Glycosylation of cell surface receptors can cause a block in virus infection. NIH3T3 cells are resistant to infection by RD114 virus but when the cell line is treated with tunicamycin, an inhibitor of N-linked glycosylation, the cell line becomes susceptible to RD114 (Marin et al., 2000; Marin et al., 2003). To test whether the block in FeLV infection observed on NIH3T3 cells is due to glycosylation of the overexpressed FeLV receptors, NIH3T3/THTR1 cells were treated with or without tunicamycin and challenged with FeLV-A (Figure 3-2c). No enhancement of infection by FeLV-A was observed on cells treated with tunicamycin compared to cells that were untreated, suggesting that N-linked glycosylation does not block infection on NIH3T3/THTR1 cells. The control RD114 virus showed increased infection on cells treated with tunicamycin (Figure 3-2c) Fusion of NIH3T3/Receptor cells to MD cells rescues FeLV infection The low titers of FeLV infection on NIH3T3/Receptor cells cannot be attributed to low receptor expression, receptor glycosylation or a block in envelope receptor binding (Figure 3-2). I hypothesized that NIH3T3 cells are either missing a factor that is required for efficient FeLV infection or are expressing a specific inhibitor to FeLV infection compared to MD cells. It has been suggested that factors other than the receptor may be required for γ-retrovirus infection (Wang et al., 1991; Sommerfelt, 1999). Similarly, many cell lines secrete factors that can block infection of particular viruses (Hofmann et al., 1999; Cullen, 2006). To investigate if NIH3T3 cells are either missing a factor required for FeLV infection or secreting a specific inhibitor to FeLV infection, I created hybrid cell lines between NIH3T3/Receptor cells (expressing either THTR1 or FLVCR1) and MD cells (not overexpressing any receptor). Figure 3-3 outlines the process of creating the MD- NIH3T3/Receptor hybrids.

85 Figure 3-3 Generation of hybrid cell lines. A schematic illustrating the process of creating MD-NIH3T3/Receptor hybrid cell line. MD cells expressing a puromycin resistant marker gene were fused to NIH3T3/Receptor cells that were resistant to neomycin by incubating with PEG1500. The cells were cultured in low FBS media and selected with both puromycin and neomycin to select hybrid cells. The cells were challenged with lacz FeLV-A or FeLV-C. 72

86 73 The hybrid cell line MD-NIH3T3/THTR1 was highly susceptible to FeLV-A (10 6 cfu/ml) (Figure 3-4). Similarly, the hybrid cell line MD-NIH3T3/FLVCR1 was highly susceptible to FeLV-C (10 5 cfu/ml) (Figure 3-4). FeLV-A could not infect MD- NIH3T3/FLVCR1 neither could FeLV-C infect MD-NIH3T3/THTR1 cells, suggesting that the high titers of infection on these hybrid cell lines was specific and not a result of the hybridization process. Furthermore, hybrids created between NIH3T3/Receptor cells and NIH3T3 cells did not show a significant increase in virus infection titres, further confirming that the increase in infection were not a result of the hybridization process (Data not shown). Results from the infection studies on the hybrid cell lines suggest that NIH3T3 cells may be missing a factor required for efficient infection of FeLVs that is expressed by MD cells. Figure 3-4 Infection study on MD-NIH3T3/Receptor hybrid cells. To create the hybrid cell lines, MD cells were co-cultured with either NIH3T3/THTR1 cell or with NIH3T3/FLVCR1 cells. The co-cultured cells were treated with PEG Hybrid cells were challenged with lacz FeLV-A (white) and FeLV-C (black). Titers are from one representative infection study.

87 3.4.7 FeLVs infect BHK/Receptor cells inefficiently and this inefficient infection can be rescued when BHK/Receptor cells are fused to MD cells To confirm that the low titres of FeLV infection were not an anomaly specific to NIH3T3 cells, I screened a number of different cell lines to identify other cell lines that may also be missing the factor required for efficient infection of FeLVs. BHK hamster cells are naturally resistant to FeLV infections. BHK hamster cells overexpressing the specific FeLV receptor (BHK/Receptor; either BHK/THTR1 or BHK/FLVCR1) showed similar low titres of infection with lacz FeLV-A (~10 2 cfu/ml) and FeLV-C (<10 2 cfu/ml) (Figure 3-5). Through initial characterization, BHK/THTR1 cells displayed efficient binding to FeLV-A envelope protein suggesting that the low tires of infection were not a result of a bock in binding (Data not shown). Similar to the results observed with MD-NIH3T3/Receptor hybrid cells, the hybrid cell line MD-BHK/THTR1 was highly susceptible to FeLV-A (~10 4 cfu/ml), and the hybrid cell line MD-BHK/FLVCR1 was highly susceptible to FeLV-C (10 4 cfu/ml) (Figure 3-5). 74 Figure 3-5 Infection study on MD-BHK/Receptor hybrid cells. To create the hybrid cell lines, MD cells were co-cultured with either BHK/THTR1 cell or with BHK/FLVCR1 cells. The co-cultured cells were treated with PEG Hybrid cells were challenged with lacz FeLV-A (white) and FeLV-C (black). Titers are from one representative infection study.

88 3.4.8 The co-factor required for efficient FeLV infection on MD cells is not a secreted factor While the results of the hybrid studies suggest that NIH3T3 cells are missing a factor that is required for the efficient FeLV infection, no conclusions can be made about the nature of this factor. To determine if the missing factor is secreted by the MD cells, I carried out infection assays using FeLV-A and FeLV-C in the absence and presence of media that had been exposed to MD cells. MD cells were seeded with fresh media and after 24 hours of exposure, the MDconditioned media was removed. FeLV-A or FeLV-C virus were then used to infect NIH3T3/THTR1 or NIH3T3/FLVCR1 cells in the presence of absence of MD-conditioned media. Results showed that there was no significant change in infection titers of FeLVs in the presence or absence of the MD conditioned media on NIH3T3/Receptor cells (Data not shown). This study suggests that the factor required for efficient infection by FeLVs is not secreted by the MD cells and is either intracellular or is membrane bound Discussion In this study I have presented data that suggests that FeLVs may require a co-factor/coreceptor for infection. The different subgroups of FeLV show weak infection on NIH3T3 cells overexpressing specific FeLV receptors compared to MD/Receptor cells. This weak infection cannot be attributed to cell surface expression of the receptor, receptor glycosylation or weak virus binding. Because all viruses used for infection are pseudotyped viruses, the weak infection cannot be attributed to any defect post entry. Furthermore, this weak infection can be complemented when NIH3T3/Receptor cells are fused with MD cells. It suggests that NIH3T3 cells are missing a factor/s required for efficient FeLV infection. No conclusions can be made about the nature of this factor. Furthermore it is not clear whether there is a common factor involved in the infection of all FeLVs or if each of them has unique infection requirements. HIV is the best example of a retrovirus that uses a multi-component receptor. Initially it was thought that the primary receptor CD4 was sufficient for HIV infection but observations similar to those reported in this chapter led to the conclusion that HIV uses co-receptors in addition to the receptor CD4. Several non-primate cell lines are resistant to HIV infection even when the receptor CD4 is overexpressed (Clapham et al., 1991). HIV Env can efficiently bind to

89 76 CD4+ cells derived from mouse, rat, hamster, mink, cat, and rabbit even though these CD4+ cells are resistant to HIV infection (Clapham et al., 1991). These initial observations led to the conclusion that additional factors that are missing from non-primate CD4+ cell lines are required for HIV infection. The most conclusive evidence for the requirement of a co-receptor came as a result of complementation experiments. While CD4+ NIH3T3 cells were resistant to HIV-1 infection, hybrid cell lines between NIH3T3 cells overexpressing CD4, and human HeLa cells were highly susceptible to HIV infection (Dragic et al., 1992). This conclusively showed that NIH3T3 cells were missing the functional co-receptor for HIV infection. While FeLVs do not show a complete block in infection on NIH3T3/Receptor cells, the significant enhancement in infection when NIH3T3/Receptor cells are fused with MD cells suggest that these cells are missing (or weakly expressing) a factor required for efficient infection of FeLVs. The next logical step would be to identify and characterize this missing cofactor/co-receptor. The first HIV co-receptor CXCR4 was identified using a cdna library from a permissive human cell line (HeLa cells) and screening for the clone that allowed efficient infection in murine NIH3T3 cells overexpressing the CD4 (Feng et al., 1996). Screening cdna libraries from permissible cell lines has been used successfully for identifying many γ-retrovirus receptors as well (Tailor et al., 1999c; Tailor et al., 1999b; Tailor et al., 1999a). This screening process has been further simplified by the use of retroviral vector libraries. The initial screens using cdna libraries utilized mammalian expression vectors stably transfected into nonpermissive cells. Transfected cells that showed efficient infection usually expressed several clones from the library and iterative procedures had to be used to isolate the specific clone. Several rounds of screening were required before the single cdna clone expressing the receptor could be identified (Feng et al., 1996). Using retroviral vector libraries has eliminated many of these obstacles (Deng et al., 1997). Identification of the clone encoding the receptor does not require further screening and the whole screen usually takes between 6-8 weeks. Using this technique, a library from permissive cells is cloned into a retroviral vector. The library is then transfected into a packaging cell line to generate pseudotyped viruses carrying the clones in place of the viral genome. These pseudotyped viruses are then used to infect resistant cells at a low MOI so that each cell receives one clone from the cdna library. These transduced cells are then challenged with a replication defective virus of interest (the one

90 77 whose receptor/co-receptor has to be identified) carrying a specific selectable marker (for example, HIV-neo or FeLV-puro). Resistant clones are isolated and the cdna clone is identified by isolating genomic DNA and amplifying the clone using primers specific to the retroviral vector. To identify the co-receptor for FeLVs, I could use a retroviral cdna library from the permissive MD cells (or another permissive cell line) to transduce the weakly susceptible NIH3T3/Receptor cells. These transduced NIH3T3 cells will then be infected with FeLV carrying a selectable maker (for example FeLV-C puro virus) and resistant colonies will be selected and screened for the co-factor/co-receptor. Unlike the screens that have previously been done using retroviral libraries, I would have to carry out an additional step to screen for the cofactor/co-receptor. This additional step will be required because this technique is designed for cell lines that are completely resistant to infection by the virus of interest. NIH3T3/Receptor cells are weakly susceptible to FeLV infection, so there will be some resistant colonies that do not express the co-factor/co-receptor. I would have to screen for cells that are highly susceptible to FeLV infection and express the co-factor/co-receptor, from the weakly susceptible, resistant colonies. I have carried out some initial experiments which have shown that identifying one clone expressing the co-factor/co-receptor will require screening through one thousand colonies. I have looked at various strategies to overcome this high false background. One strategy is to revert to the older screening technique where each cell expresses several clones from the library (instead of one clone per cell). These cells can then be infected with diluted FeLV virus. This will ensure that fewer cells will be infected, thereby reducing the background. The resistant cells will then be further tested for efficient FeLV infection and several rounds of screening will be required to isolate and identify the single clone that allows efficient FeLV infection. Another, more indirect approach to identifying the co-factor/co-receptor required for FeLV infection would be an sirna based screen. A screen was used to identify host proteins required for HIV-1 infection using an sirna library of 21,000 sirna pools against human genes (Brass et al., 2008). Data from this screen not only confirmed the role of 36 host factors that have previously been implicated in HIV pathogenesis, but also led to the identification of 237 new factors that affect HIV infection. In this screen, cells transfected with specific sirnas were infected with HIV-1 and were then screened for HIV-related gene expression. Specific

91 78 cells with affected HIV-related gene expression indicated knockdown of host genes involved in HIV infection (Brass et al., 2008). This sirna based screen can be used to detect factors affecting infection of FeLVs. Because of the nature of this screen, it may help identify several other factors involved in FeLV infection in addition to the co-factor/co-receptor. I can carry out this screen in a cell line that is highly susceptible to FeLV infection. Human cells might be a good candidate as they are highly susceptible to FeLV-C and most sirna libraries available are specifically designed for human genes. One drawback of using human cells is that I will not be able to use FeLV-A because it cannot infect human cells efficiently. As I am specifically interested in identifying factors affecting viral entry, I can modify this screen to identify factors involved specifically in FeLV-C entry. I can use replication incompetent, pseudotyped FeLV-C virus expressing MLV gag/pol and lacz marker gene. sirna expressing cells can be infected with pseudotyped FeLV-C and the cells can then be assayed for β-gal activity. As a control, I would use another γ-retrovirus like A-MLV (that infects NIH3T3 cells efficiently), and compare the results of the two screens to identify factors specific for FeLV-C infection. Like the cdna screen, this sirna screen would require successive rounds of confirmation. sirnas that affect FeLV-C infection will have to be validated before any conclusions about their role in FeLV-C infection can be drawn. Furthermore, because this system has not been tested with any other γ-retrovirus, it will also lead to the identification of factors that are required for infection by all γ-retroviruses. While the identification of these factors will be interesting, several controls would have to be in place to identify the specific cofactor/co-receptor for FeLV-C infection. A major concern for any screen resulting from this project is that while the data suggests that additional factors might be involved in FeLV infection, it is not sufficient to speculate on the nature of the factor. It is of concern that this missing factor might not be an expressed protein. Different cell lines have unique cell biology and differ in their membrane composition, cell surface lipid rafts, glycosylation patterns and other non-protein components. It is worth noting that if the factor involved in the efficient infection by FeLVs is a non-protein factor, a cdna or sirna based screen may not lead to the identification of this factor.

92 79 It is therefore important to view the data presented in this study as preliminary observations. The data seems to indicate that FeLVs require additional factor/s for efficient infection of NIH3T3/Receptor cells. Based on the HIV model I have suggested that this factor may be a cell surface protein that acts as a co-receptor for FeLV infection, although this suggestion is only speculative. The identification of a co-factor/co-receptor for FeLV infection would undoubtedly change the model for γ-retrovirus infection.

93 80 4 GENERAL DISCUSSION AND FUTURE DIRECTIONS 4.1 Evolution of pathogenic FeLVs One possible explanation for the emergence of pathogenic viruses from transmitted viruses in an infected host is the transmission-mutation hypothesis. This hypothesis is best characterized for HIV where the highly pathogenic strain of HIV that uses CXCR4 as a coreceptor (X4 HIV) arises from the transmitted HIV that uses CCR5 as a co-receptor (R5 HIV). Several mathematical models have been developed to predict the emergence of X4 HIV from the transmitted R5 HIV in an infected host [Reviewed in (Regoes et al., 2005)]. According to this hypothesis the transmission of the R5 HIV is favoured in a mixed viral load. Once transmitted the virus population evolves as a result of subsequent infections, leading to mutations in the virus genome. The transmitted HIV has to acquire a specific number of mutations in the co-receptor binding site to eventually result in a virus that can switch its coreceptor from CCR5 to CXCR4. Through this process, intermediate viruses arise that have not fully acquired the ability to use CXCR4 as a receptor and may be dual tropic in their receptor usage. Analogous to HIV, we had hypothesized that the transmitted FeLV-A accumulates a certain number of mutations in its env gene for the emergence of pathogenic FeLV-C in an infected host. These mutations in the env gene would also result in evolutionary intermediates between FeLV-A and FeLV-C. To identify and characterize these evolutionary intermediates, our lab had collaborated with Dr. Brian Willet (University of Glasgow) who had isolated envelope sequences from primary virus isolates from anaemic cats (refer to section 2.2). Several of these isolates displayed intriguing phenotypes, and I had chosen to further characterize the isolate FA Unfortunately, as reported in section 2.4, the phenotype observed for FA27-53 was an artefact of an endogenous retrovirus contamination. While the study to further characterize FA27-53 was suspended, the idea of characterizing natural evolutionary intermediates from a primary virus isolate provides a powerful tool to understand FeLV evolution in vivo. Fortunately, there are several other Env clones that were isolated by Dr. Willet s lab that show phenotypes indicating that they may be evolutionary intermediates between FeLV-A and FeLV-C. One of those clones FY has

94 81 been characterized in our laboratory by another graduate student. FY Env is a hybrid between FeLV-A and FeLV-C Envs. It is FeLV-A like in its amino acid sequence, except for the VRA which is FeLV-C-like. Our lab has shown that this clone is tri-tropic in its receptor use, utilizing the FeLV-A receptor THTR1, the FeLV-C receptor FLVCR1 as well as a paralog of FLVCR1, FLVCR2 for infection (Shalev et al., manuscript in preparation). Of the other Env clones isolated in Dr. Willet s lab, the clones isolated from the primary isolate FS246 also display interesting phenotypes. FS246-4 (FS-4), FS (FS-37) and FS (FS-40) were isolated from an anaemic cat known to contain a mixture of FeLV-A and FeLV-C. These FeLV Envs are highly related to each other in amino acid sequence with variation in only the VRA (Figure 4-1). Determinants of subgroup specificity for FeLV-C have been mapped to the amino acids in the VRA. The VRA sequence of FS-40 is identical to that from FeLV-A suggesting that FS-40 is FeLV- A like. The VRA sequence of FS-37 Env shows strong sequence identity to a previously isolated virus with a subgroup C phenotype (Onions et al., 1982). Consistent with this, FS-37 infects guinea pig cells (data not shown) identifying this clone as subgroup C. Interestingly, the VRA sequence of FS-4 is an intermediate between FS-37 and FS-40 (Figure 4-1). FS-4 may be an evolutionary intermediate between A-like FS-40 and the C-like FS-37 and may use both the FeLV-A receptor THTR1 and FeLV-C receptor FLVCR1. Figure 4-1 Alignment of the VRA sequence for FeLV-A and the novel Envs FS-40, FS-4 and FS-37. The VRA sequence is shown for the prototypical FeLV-A (FGA) and the Envs isolated from the primary isolate FS246; FS (FS40), FS246-4 (FS-4) and FS (FS-37). Dots represent identical residues. It would be interesting to comprehensively characterize the receptor use of these FeLV Envs, and map VRA residues that govern receptor and subgroup specificity. This characterization would involve identifying the receptor used by these Envs. If FS-4 is indeed an evolutionary intermediate and is dual tropic in its receptor use, then it would be interesting to map the critical residues in FS-4 that allow the virus to use both FLVCR1 and THTR1 as