ORIGINAL ARTICLE. Journal of Investigative Dermatology (2009) 129, ; doi: /jid ; published online 16 July 2009

Transcription

1 ORIGINAL ARTICLE Enhanced Proliferation and Activation of Peripheral Blood Mononuclear Cells in with Psoriasis Vulgaris Mediated by Streptococcal Antigen with Bacterial DNA Yi-Hua Cai 1, Zhi-Yong Lu 1, Ruo-Fei Shi 1, Feng Xue 1, Xiao-Ying Chen 1, Meng Pan 1, Wei-Ru Yuan 1, Han Xu 1, Wei-Ping Li 1 and Jie Zheng 1 Streptococcal infection is believed to have an intimate relationship with psoriasis, although the pathogenic role of streptococcal DNA is not fully understood. To gain a clearer understanding of these dynamics, we investigated the effect of streptococcal DNA on lymphocyte proliferation and activation as well as cytokine secretion in psoriasis. Peripheral blood mononuclear cells (PBMCs) from psoriatic patients had higher proliferative responses upon stimulation by streptococcal antigen () when compared with those from healthy individuals. Strikingly, this enhanced proliferation of PBMCs was attenuated after administration of treated with DNase-I. In addition, CD69 expression levels on T cells, including skin-homing lymphocyte cutaneous lymphocyte-associated antigen positive T cells, and IFN-a secretion by PBMCs were also attenuated in patients after stimulation with without nucleic acid (non nucleic acid, non-na) compared with stimulation with untreated. However, activation marker CD86 expression levels on B cells as well as the secretion of IFN-g and tumor necrosis factor (TNF)-a following stimulation with or non-na were not significantly altered. Interestingly, the attenuated T-cell activation and IFN-a secretion in psoriatic patients could be reconstituted when stimulated by non-na combined with synthetic CpG-A, but not when combined with synthetic CpG-B. This study demonstrates the integral function of, particularly streptococcal DNA, in the pathogenesis of psoriasis. Journal of Investigative Dermatology (29) 129, ; doi:1.138/jid ; published online 16 July 29 INTRODUCTION Psoriasis is conventionally considered to be a T-cell-mediated T helper 1 (Th1)-type inflammatory skin disease characterized by hyperproliferative keratinocytes and infiltration of prominent T cells, dendritic cells (DCs), and neutrophils (Griffiths and Barker, 27). Intralesional T cells expressing the unique skin-homing determinant cutaneous lymphocyte-associated antigen (CLA) (Fuhlbrigge et al., 1997), along with other immune cells such as DCs and neutrophils, induce the proliferation and abnormal differentiate of keratinocytes (Prinz, 23; Bowcock and Krueger, 25; Gaspari, 26). Recent studies have also shown that Th17 cells have an essential function during psoriatic pathogenesis (Wilson et al., 27; Zheng et al., 27). Th1 and IL-17 þ T cells 1 Department of Dermatology, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China Correspondence: Dr Jie Zheng, Department of Dermatology, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 225, China. jie-zheng21@126.com Abbreviations: non-na, non nucleic acid streptococcal antigen PBMC, peripheral blood mononuclear cell;, streptococcal antigen Received 22 February 28; revised 6 February 29; accepted 22 April 29; published online 16 July 29 may collaboratively contribute to psoriasis development (Kryczek et al., 28). Although the pathogenesis of psoriasis is not fully understood, longtime clinical observation substantiates microbial infection s intimate relationship with onset. Group A streptococci (GAS) are a well-recognized trigger for acute guttate psoriasis and are involved in the exacerbation of chronic plaque psoriasis (Gudjonsson et al., 23). Increased peripheral blood mononuclear cell (PBMC) responses to the cell walls and membranes of GAS have been reported in both guttate and chronic plaque psoriasis cases as compared with control patients (Gross et al., 1977; Baker et al., 1991). Furthermore, GAS-reactive T cells in skin lesions of chronic plaque psoriasis can proliferate in response to streptococcal antigens (s), producing IFN-g (Baker et al., 1999; Brown et al., 2). Recently, identical TCR rearrangements have also been found in streptococcal angina and skin lesions of patients with psoriasis vulgaris (Diluvio et al., 26). Therefore, infection, especially streptococcal infection, has been regarded as an initial factor in the activation of pathogenic T cells in psoriasis. Thus far, most of the studies concerning the trigger mechanisms for streptococcal infection-related psoriasis have focused mainly on its protein antigens. Unfortunately, the & 29 The Society for Investigative Dermatology

2 identities of the s recognized by pathogenic T cells have yet to be determined. In addition to the bacterial proteins, the role of streptococcal DNA in psoriatic pathogenesis has also not been fully elucidated. Bacterial DNA containing unmethylated nucleotides with the particular sequence motif CG has been recognized as an immune-stimulatory molecule triggering Th1-type responses and producing proinflammatory cytokines and chemokines via innate Toll-like receptor 9 (TLR-9) (Hemmi et al., 2; Bauer et al., 21; Bauer and Wagner, 22; Krieg, 22). It has been reported that streptococcal DNA contains such stimulatory motifs, thereby inducing a strong immune reaction (Chatellier and Kotb, 2; Oshikawa et al., 26). Recent studies also suggest that CpG DNA may contribute to the development and/or progression of some autoimmune and inflammatory diseases. For example, the anti-dna autoantibodies in systemic lupus erythematosus patients cross-react with bacterial and mammalian DNA (Pisetsky et al., 1999). Mice immunized with CpG DNA plus a chlamydia-derived antigen that cross-reacts with a cardiac antigen develop an autoimmune myocarditis (Bachmaier et al., 1999). CpG DNA has also been shown to be important for establishing experimental autoimmune encephalomyelitis, an animal disease model of multiple sclerosis (Ichikawa et al., 22; Prinz et al., 26). For this study, we hypothesized that streptococcal CpG DNA may be critical in the pathogenesis of psoriasis. We examined the effects of streptococcal DNA on the proliferation, activation, and cytokine secretion of PBMCs in patients with psoriasis. The levels of PBMCs and T-cell proliferation and the activation of T cells, including CLA þ T cells, as well as the production of IFN-a in response to stimulation were found to decrease significantly when bacterial DNA was devoid of whole. However, B-cell activation was not influenced. These results suggest that streptococcal CpG DNA may function in the activation of pathogenic T cells, thus leading to the development of psoriasis. This provides new insights into the pathogenesis of psoriasis. Δ 8, 7, Healthy individuals 2 µg ml 1 25 µg ml 1 concentration Healthy individuals Healthy individuals 2 μg ml 1 25 μg ml 1 Non-NA concentration 2 μg ml 1 25 μg ml 1 Ag concentration RESULTS Proliferation of PBMCs in psoriatic patients is significantly higher than in healthy individuals on whole stimulation, but this increased proliferation is attenuated after administration of whole treated with DNase-I It has been shown that patients with guttate or chronic plaques show increased PBMC responses to GAS antigens (Gross et al., 1977; Baker et al., 1991). We therefore examined the proliferative levels of PBMCs in psoriatic patients and healthy individuals in response to. As shown in Figure 1a, patient PBMCs indeed showed higher levels of proliferation in response to as compared with those from healthy individuals, and a significant difference occurred at a dose of 25 mgml 1 (P ¼.32, Figure 1a). By contrast, the proliferative responses to non nucleic acid streptococcal antigen (non-na) at any dose did not show significant differences between the patients and the controls (P4.5, Figure 1b). To examine the net contribution of streptococcal DNA in PBMC proliferation, the number of counts per minute Figure 1. Peripheral blood mononuclear cells (PBMCs) from psoriatic patients have a higher proliferative response to streptococcal antigen () than cells from healthy individuals. PBMCs from psoriatic patients (n ¼ 15) and healthy individuals (n ¼ 1) were stimulated with (a) or non nucleic acid (non-na) (b). After 72 hours of culture, cellular proliferation was determined by thymidine incorporation. Panel c shows the net contribution of streptococcal DNA stimulation (D). The value from non-nastimulated PBMCs was subtracted from the value from whole stimulated PBMCs. Data represent mean±sd of tested individuals. Po.5 compared with healthy individuals., counts per minutes;, no significance. () of PBMCs stimulated with whole treated with DNase-I was subtracted from the of PBMCs stimulated with whole. As indicated in Figure 1c, proliferation of PBMCs from psoriatic patients was significantly higher than that of those from healthy individuals at the dose of 25 mgml 1 (P ¼.22). These results affirm that streptococcal infection may be critical in the pathogenesis of psoriasis Journal of Investigative Dermatology (29), Volume 129

3 To further assess the role of streptococcal DNA in the pathogenesis of psoriasis, we assessed PBMC proliferation when stimulated with whole or non-na. We found that the proliferation of PBMCs from psoriatic patients upon stimulation with any dose of non-na was significantly attenuated as compared with that stimulated by (Po.1, Figure 2a), whereas in PBMCs from healthy individuals, only lower doses of non-na induced significantly lower responses as compared with whole (P ¼.2 and.16, respectively, Figure 2b). Similar levels of proliferation were observed between the responses to non-na and at the dose of 25 mgml 1 (P ¼.51, Figure 2b). The decreased proliferation is not due to DNase-I treatment as the addition of DNase-I-treated or untreated phytohemagglutinin induced similar levels of PBMC proliferation in cells from both patients and healthy individuals (P ¼.165 and.99, respectively). These results suggest that streptococcal DNA may indeed participate in the process of immune response triggered by streptococcus in psoriasis. 8, 7, Non-NA 2 μg ml 1 1 μg ml 1 25 μg ml 1 Ag concentration Non-NA 2 μg ml 1 1 μg ml 1 25 μg ml 1 Ag concentration Figure 2. DNase-I treatment significantly attenuates the enhanced peripheral blood mononuclear cell (PBMC) proliferation mediated by streptococcal antigen (). PBMCs from psoriatic patients (n ¼ 15, panel a) and healthy individuals (n ¼ 1, panel b) were stimulated with DNase-Itreated or untreated. Phytohemagglutinin was used as positive control to stimulate T-cell proliferation. After 72 hours of culture, cellular proliferation was determined by thymidine incorporation. Data represent mean±sd of tested individuals. Po.5, Po.1., no significance. Decreased T-cell proliferation, expression of CD69 on both whole T cells and CLA þ T cells, and IFN-a production upon stimulation with devoid of bacterial DNA in psoriatic patients PBMCs Next, we examined the effect of streptococcal DNA on T-cell proliferation and activation, including the skin-homing CLA þ T-cell activation in psoriatic patients. We found that the proliferation of T cells from patients upon stimulation with non-na was significantly reduced as compared with that stimulated by (P ¼.41, Figure 3a). Furthermore, both and non-na induced the activation of whole T cells and CLA þ T cells as measured by CD69 expression (Figure 3b and c). However, stimulation of PBMCs from patients with resulted in upregulation of CD69 at 1.44% of whole T cells and.5% of CLA þ T cells compared with 9.24% of whole T cells and.35% of CLA þ T cells activated by devoid of bacterial DNA (P ¼.12 and.42, respectively, Figure 3b and c). By contrast, there was no significant difference in CD69 expression on whole T cells from healthy individuals when stimulated with or non-na (7.8 vs 6.28%, P ¼.181, Figure 3b). Consistent with the result for whole T cells, similar levels of CD69 expression on CLA þ T cells were observed on stimulation with or non-na in healthy PBMCs (.35 vs.32%, P ¼.67, Figure 3c). It has been shown that bacterial DNA can activate B cells to proliferate, secrete IgM and cytokine IL-1, and upregulate surface molecule expression such as with HLA-DR and costimulatory molecules (Decker et al., 2). We examined the effects of streptococcal DNA on B cells regarding the expression of the co-stimulatory molecule CD86 in patient cells. No significant difference was found in the expression of CD86 on B cells induced by and by non-na (39.42 vs 4.27%, P ¼.668, Figure 4a) at 2 mgml 1 stimulation. The cytokines IFN-a, IFN-g, and TNF-a have been shown to be important in psoriasis. Therefore, we examined the cytokine secretion produced by PBMCs from patients. Both and non-na induced significant levels of IFN-a, IFN-g, and TNF-a (Figure 4b). The stimulation of PBMCs with resulted in a significant amount of IFN-a production as compared with stimulation with non-na (P ¼.3, Figure 4b). However, the levels of IFN-g and TNF-a were similar when PBMCs were stimulated with or non-na (P4.5, Figure 4b). Furthermore, we found that IFN-g was secreted mainly by T cells, and not plasmacytoid DCs (pdcs), in response to and non-na (Supplementary Figure S1a). However, there was no significant difference between and non-na (2.7 vs. 1.71%, P ¼.263, Supplementary Figure S1b). This is not very surprising given that pdcs are predominately type I IFN producers. Taken together, these results indicate that streptococcal DNA may aid in the activation of pathogenic T cells through IFN-a secretion, leading to the development of psoriasis. Combining non-na with CpG-A, but not with CpG-B, induces enhanced T-cell activation in psoriatic patients CpG-A and CpG-B are synthetic oligodeoxynucleotides (ODNs) containing CpG motifs. CpG-B preferentially activates B cells, whereas CpG-A predominately activates

4 15, 5, Non-NA Patient FL3-H FL3-H Non-NA Patient FL1-H FL1-H Non-NA CD69 CD3 + cd69 + (%) Healthy individual FL3-H CD FL3-H Non-NA non-na CD69 CLA + CD3 + CD69 + (%) Healthy individual FL1-H FL1-H Non-NA. Healthy individual Healthy individual CLA Non-NA Figure 3. Streptococcal antigen () induces higher levels of T-cell proliferation and CD69 expression in peripheral blood mononuclear cells (PBMCs) from psoriatic patients. (a) Peripheral T cells from psoriatic patients (n ¼ 5) were sorted and stimulated with (2 mgml 1 ), non nucleic acid (non-na) (2 mgml 1 ), or medium as a control in the presence of mitomycin-treated antigen-presenting cells. After 72 hours of culture, cellular proliferation was determined by thymidine incorporation. Data represent mean±sd of tested individuals. Po.5. (b and c) PBMCs from psoriatic patients (n ¼ 2) and healthy volunteers (n ¼ 12) were stimulated with (2 mgml 1 ), non-na (2 mgml 1 ),or medium as a control. After 24 hours of culture, cells were harvested, stained with appropriate antibodies, and analyzed for the expression of CD69 on CD3 þ T cells (b) or CLA þ CD3 þ T cells (c). One representative dot plot from a patient or healthy individual is shown in each panel. Data represent mean±sd of tested individuals and are presented as a percentage of CD3 þ T cells and CLA þ CD3 þ T cells expressing CD69. Po.5., no significance. pdcs. To determine which type of CpG could be integrated with streptococcal protein antigens to induce T-cell activation, CpG-A or CpG-B was mixed with non-na in PBMC culture. As shown in Figure 5a and b, a combination of non-na with CpG-A resulted in significantly enhanced T-cell activation in psoriatic patients cells. In addition, CLA þ T cells were also upregulated after stimulation with CpG-A plus non-na. By contrast, CD69 expression on whole T cells or CLA þ T cells was not significantly changed upon stimulation with the combination of non-na and CpG-B Journal of Investigative Dermatology (29), Volume 129

5 pg ml 1 CD19 + CD86 + / CD19 + (%) , 5, 4, 3, 2, 1, Non-NA Non-NA Neither CpG-A nor CpG-B alone appeared to activate whole T cells or CLA þ T cells as compared with the medium. In addition, non-na combined with CpG-A, but not with CpG-B, induced significantly higher levels of IFN-a production than did non-na stimulation alone (P ¼.14, Figure 5c). Because CpG-A mainly activates pdcs, we assume that streptococcal DNA may enhance the activation of pathogenic T cells through pdc activation and IFN-a production. To further investigate this hypothesis, we compared T-cell proliferation levels with in the presence or absence of pdcs in the patient cells. The proliferative responses to by T cells in the absence of pdcs were lower than those with the whole antigen-presenting cells. However, T cells still proliferated in the absence of pdcs (data not shown). In addition, it has been reported that pdcs in the peripheral blood of psoriatic patients significantly decreased compared with those in the blood of healthy individuals (Nestle et al., 25). In our study, we also observed a significantly lower frequency of pdcs in the peripheral blood from patients (.58 vs.23%, P ¼.14, Supplementary Figure S2a). However, the levels of IFN-a secreted by PBMCs upon stimulation with were similar between cells from patients and cells from IFN-γ TNF-α IFN-α Figure 4. Streptococcal antigen () induces higher levels of IFN-a production in psoriatic patients but has no effect on B-cell activation and IFN-c and TNF-a production. (a) Peripheral blood mononuclear cells from 2 psoriatic patients were stimulated with (2 mgml 1 ), non nucleic acid (non-na) (2 mgml 1 ), or medium as a control. After 24 hours of culture, cells were harvested, stained with appropriate antibodies, and analyzed for the expression of CD86 on CD19 þ B cells. Data represent mean±sd of tested individuals and are presented as a percentage of CD19 þ B cells expressing CD86., no significance. (b) Cytokine levels were measured with cell-free supernatants by ELI. Data represent mean±sd of tested individuals. Po.1., no significance. CLA + CD3 + CD69 + (%) IFN-α (pg ml 1 ) CD3 + CD69 + (%) ,4 1,2 1, Non-NA Non-NA+CpG-A Non-NA+CpG-B CpG-A CpG-B Non-NA Non-NA+CpG-A Non-NA+CpG-B CpG-A CpG-B Non-NA Non-NA+CpG-A Non-NA+CpG-B CpG-A CpG-B Figure 5. Combined stimulation with non nucleic acid (non-na) and CpG-A induces enhanced activation of T cells and IFN-a production in peripheral blood mononuclear cells (PBMCs) from 12 psoriatic patients. PBMCs from 12 psoriatic patients were stimulated with non-na (2 mgml 1 ), non-na (2 mgml 1 ) plus CpG-A or plus CpG-B (5 mgml 1 ), or CpG-A or CpG-B (5 mgml 1 ) alone, or medium as a control. After 24 hours of culture, cells were harvested, stained with appropriate antibodies, and analyzed for the expression of CD69 on CD3 þ T cells (a) and CLA þ CD3 þ T cells (b). Data represent mean±sd of tested individuals and are presented as a percentage of CD3 þ T cells or CLA þ CD3 þ T cells expressing CD69, respectively. Also, IFN-a level was measured with cell-free supernatants by ELI (c). Data represent mean±sd of tested individuals. Po

6 healthy individuals (P4.5, Supplementary Figure S2b). These results suggest that pdcs from psoriatic patients may have been activated, thus secreting large amounts of IFN-a. DISCUSSION In this study, we showed that PBMCs from psoriatic patients had significantly higher proliferation and T-cell activation upon stimulation. However, the enhanced proliferation and T-cell activation as well as IFN-a secretion were attenuated after stimulation with devoid of bacterial DNA. Strikingly, the decreased T-cell activation and IFN-a secretion could be reconstituted by stimulation with non- NA combined with CpG-A but not when combined with CpG-B. These data suggest that streptococcal DNA indeed participates in the progress of pathogenic immune reaction triggered by streptococcus in psoriasis. We found that blood from psoriatic patients had significantly higher PBMC proliferation in response to stimulation than did that from healthy volunteers. In addition, psoriatic patients cells showed pronounced response to streptococcal DNA stimulation, which may be related to increased expression of TLR-9 in patients (unpublished observation). This may also explain why we did not see any significant difference when PBMCs from either patients or healthy individuals were stimulated with non-na. Furthermore, we examined the effect of streptococcal DNA on T-cell proliferation and activation, including the skin-homing CLA þ T-cell activation. In patients, T-cell proliferation upon stimulation with non-na was significantly attenuated as compared with that stimulated by. Also, stimulation of PBMCs from patients resulted in significant upregulation of CD69 on whole T cells and CLA þ T cells compared with non-na stimulation. This is consistent with a previous report showing persistent CD69 expression on the local infiltrating T cells in psoriatic patients (Torres-Alvarez et al., 27). However, among healthy controls there was no significant difference in expression of CD69 on whole T cells and CLA þ T cells induced by and non-na. In addition, in contrast to psoriatic patients, neither nor non- NA could activate CLA þ T cells in the blood from healthy volunteers. These results suggest that T cells from patients have a higher sensitivity to stimulation by streptococcal DNA. The increased T-cell proliferation and activation may correspond with disease development, as implicated by a previous report describing psoriatic patients as having a higher frequency of circulation CLA þ T cells, and they closely correlate with the severity of their disease (Sigmundsdottir et al., 21). Taken together, our findings show that streptococcal CpG DNA may participate in the development of psoriasis by increasing the activation of pathogenic T cells. Interestingly, we found that the decreased activation of T cells stimulated by non-na alone could be reconstituted by the combined stimulation of non-na plus CpG-A, but not by combination with CpG-B. This result is not associated with the direct contribution of CpG-A because neither of them is able to trigger the activation of T cells directly. It has been shown that CpG-A predominantly activates pdcs and induces high levels of IFN-a production, whereas CpG-B is superior in activating B cells (Krieg, 22; Vollmer et al., 24). Therefore, we speculate that streptococcal DNA may increase the activation of pathogenic T cells through the activation of pdcs and production of IFN-a. This notion is supported by a recent finding that IFN-a derived from pdcs activates and expands pathogenic T cells, causing the development of skin lesions such as psoriasis (Nestle et al., 25). In addition, IFN-a therapy has been reported to exacerbate psoriasis in a patient with chronic hepatitis C infection (Yurci et al., 27). Our data also showed that PBMCs stimulated with, but not non-na, produced a significant amount of IFN-a. Furthermore, the decreased IFN-a secretion could be reconstituted by the combined stimulation of non-na with CpG-A. In addition, consistent with the previous report (Nestle et al., 25), we observed a decreased pdc frequency in the peripheral blood from psoriatic patients. However, there was no significant difference in IFN-a production by PBMCs stimulated with between patients and healthy controls. Our data suggest that pdcs from psoriatic patients may have been activated, thus secreting large amounts of IFN-a. Indeed, it has been shown that the aberrant activation of pdcs triggers IFN-associated autoimmunity in psoriasis (Lande et al., 27; Gilliet and Lande, 28). We also noticed a lower T-cell proliferative response in the absence of pdcs compared with the whole antigenpresenting cells. However, T cells still proliferate in the absence of pdcs. Escherichia coli DNA has been shown to upregulate CD4 expression on human myeloid DCs, pdcs, and monocytes (Pichyangkul et al., 21). Therefore, it is possible that when PBMCs are stimulated with, myeloid DCs or monocytes may inducibly express TLR-9 and costimulatory molecules to complement pdcs for T-cell proliferation. Further investigation is under way to confirm this result by enlarging sample sizes. In addition, we did not observe any significant differences in IFN-g and TNF-a production by PBMCs from patients stimulated with and non-na. This may be attributable to other immunostimulatory components of streptococcus, such as peptidoglycan, which alternatively induce secretion of these cytokines (Takeda et al., 23). We also found effects of streptococcal DNA on B-cell activation in cells from patients. However, no significant difference was found for the expression of CD86 on B cells stimulated with or non-na. In contrast to the enhanced T-cell activation mediated by non-na and CpG-A, the combined stimulation of non-na with CpG-B resulted in a significant upregulation of CD86 on B cells as compared with the non-na stimulation alone (data not shown). This result is perhaps due to the direct activation induced by CpG-B when B cells are stimulated with CpG-A or CpG-B, respectively. On the basis of the current findings, we conclude that streptococcal DNA has a similar effect on activating T cells as CpG-A, which may explain the role of streptococcal DNA in the development of psoriasis. In conclusion, our study shows that without nucleic acid decreases the proliferation of PBMCs and activation of T cells, suggesting that streptococcal DNA may be complicit 2658 Journal of Investigative Dermatology (29), Volume 129

7 in the activation of pathogenic T cells, thus leading to the development of psoriasis. MATERIALS AND METHODS with psoriasis vulgaris were diagnosed on the basis of clinical and histopathologic criteria (Schon and Boehncke, 25). PBMCs from 15 patients aged 1 7 years (mean 38±21) were used to assess the proliferation induced by various stimuli. In addition, PBMCs from a second set of 2 patients with similar characteristics (ages ranging from 1 to 77 years, mean 45±19) were used for flow cytometry analysis and ELI. The patients had not been treated with systemic therapy for at least 4 weeks before study entry and were using only topical emollients. As controls, blood samples from 1 or 12 age-matched healthy volunteers were used. The study was approved by the Shanghai Jiao Tong University School of Medicine Research Ethics Committee and conducted according to the Declaration of Helsinki Principles. All the participants in this study gave their written informed consent. Preparation of was prepared from group A b-hemolytic streptococcus serotype M6 (catalog no. CMCC (B) 32175, China Centre for Type Culture Collection, Wuhan, Hubei, China). The bacteria were cultured on blood agar and incubated in Todd-Hewitt broth (Oxoid, Hampshire, UK) at 371C for hours. After centrifugation, the pellets were washed twice in phosphate-buffered saline and then resuspended and sonicated. To prepare DNA-free (non-na), the was mixed with DNase-I (Roche Applied Science, Mannheim, Germany) to a final concentration of 1 mgml 1 and incubated at 371C for 3 minutes. Complete digestion of bacterial DNA was confirmed by agarose gel electrophoresis. In some experiments, DNA-free was prepared by anion exchange chromatography (Q Sepharose XL; GE Healthcare, formerly Amersham Biosciences, Piscataway, NJ). CpG ODNs CpG ODNs were synthesized by Sigma-Genosys (St Louis, MO). All of the following sequences are 5 3 ; lowercase letters are 5 of phosphothiorate linkages and uppercase letters are 5 of phosphodiester linkages. The sequences of the ODNs were CpG-A, ggtgcatcgatgcagggggg, and CpG-B, tcgtcgttttgtcgttttgtcgtt. Isolation of PBMCs Human PBMCs were isolated from heparinized blood by density gradient centrifugation over Ficoll-Hypaque and resuspended in RPMI 164 medium (GIBCO/Invitrogen, Life Technologies, Carlsbad, CA), supplemented with 1% fetal bovine serum, penicillin/streptomycin, 2 mm glutamine, and 25 mm HEPES (GIBCO/Invitrogen). Isolation of peripheral T cells PBMCs isolated from heparinized blood were suspended in sterile cell sorting medium containing 1 Hanks balanced salt solution (GIBCO/ Invitrogen), 2% heat-inactivated fetal bovine serum (GIBCO/Invitrogen), 1 mm HEPES buffer (GIBCO/Invitrogen), and 3 mgml 1 of gentamicin (GIBCO/Invitrogen). Cells were incubated with saturating concentrations of directly labeled anti-human CD3-PE-Cy5.5 (clone S4.1, Caltag/Invitrogen, Carlsbad, CA) mab for 3 minutes on ice, washed twice in cell sorting medium, and resuspended in cell sorting medium. CD3 þ T cells were isolated from PBMCs by live sterile cell sorting (FACSVantage SE, Becton Dickinson, Mountain View, CA). CD3 cells were treated with mitomycin (Alexis Biochemicals, San Diego, CA) as antigen-presenting cells for T-cell proliferation assay. In some experiments, cells were incubated with anti-human CD3 PE-Cy5.5 and anti-human BDCA-2-FITC (clone AC144, Miltenyi Biotec, Bergisch Gladbach, Germany) mabs. CD3 BDCA-2 þ cells and CD3 BDCA-2 cells were sorted for study. Proliferation assay Fresh PBMCs, or peripheral T cells in the presence of mitomycintreated antigen-presenting cells, were cultured in 96-well plates for 3 days with or non-na in a total volume of 2 ml. As a control, the maximal amount of DNase-I used in non-na was added to cultures of PBMCs with phytohemagglutinin (1 mgml 1 ). Cultured cells were pulsed with 3 H-thymidine (1 mci per well, Shanghai Institute of Applied Physics, Chinese Academy of Science, Shanghai, China) 16 hours before cell harvest. Proliferation was determined by thymidine incorporation measured in a b-scintillation counter and expressed as the mean of three replicates. Flow cytometry analysis Fresh PBMCs from patients and healthy volunteers were cultured in 24-well plates for 24 hours with optimal concentrations of or non-na. PBMCs from patients were further stimulated with non- NA plus CpG ODNs (5 mgml 1 ) or CpG ODNs alone (5 mgml 1 ). To analyze CD69 expression on whole T cells or CLA þ T cells and CD86 on B cells from patients, PBMCs were stained with antihuman CD3-PE-Cy5 (clone UCHT1), anti-human CLA-FITC (clone HECA-452), and anti-human CD69-PE (clone FN5) or antihuman CD19-FITC (clone HIB19) and anti-human CD86-PE (clone 2331(FUN-1)) (all antibodies from BD Pharmingen, San Diego, CA) for 3 minutes on ice. Cells were washed twice with phosphatebuffered saline containing 3% fetal bovine serum, resuspended in 1% paraformaldehyde, and analyzed. A total of events were analyzed per sample with the FACS Calibur (Becton Dickinson, San Jose, CA). Detection of cytokines Fresh PBMCs from patients were cultured in 24-well plates for 24 hours with optimal concentrations of and non-na. The culture supernatants were harvested and tested for the presence of cytokines IFN-a (Adlitteram Diagnostic Laboratories, San Diego, CA), IFN-g, and TNF-a (Diaclone, Stamford, CT) by ELI. Statistical analysis Data were expressed as mean±sd of tested individuals. Statistical significance was determined using a paired t-test among patients or healthy individuals and the Student s t-test or non-parametric twotailed tests between patients and healthy individuals. Po.5 was considered significant. CONFLICT OF INTEREST The authors state no conflict of interest. ACKNOWLEDGMENTS This research was supported by a grant from the National Natural Science Foundation of China ( ) and by a doctoral fellowship grant from Shanghai Jiao Tong University (BXJ317)

8 SUPPLEMENTARY MATERIAL Supplementary material is linked to the online version of the paper at REFERENCES Bachmaier K, Neu N, de la Maza LM, Pal S, Hessel A, Penninger JM (1999) Chlamydia infections and heart disease linked through antigenic mimicry. Science 283: Baker BS, Brown D, Porter W, Hardman C, Garioch JJ, Powles A et al. (1999) T lymphocytes reactive for group A streptococcal antigens in chronic plaque psoriatic lesions. Arch Dermatol Res 291:564 6 Baker BS, Powles AV, Malkani AK, Lewis H, Valdimarsson H, Fry L (1991) Altered cell-mediated immunity to group A haemolytic streptococcal antigens in chronic plaque psoriasis. Br J Dermatol 125:38 42 Bauer S, Kirschning CJ, Hacker H, Redecke V, Hausmann S, Akira S et al. (21) Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. Proc Natl Acad Sci U 98: Bauer S, Wagner H (22) Bacterial CpG-DNA licenses TLR9. Curr Top Microbiol Immunol 27: Bowcock AM, Krueger JG (25) Getting under the skin: the immunogenetics of psoriasis. Nat Rev Immunol 5: Brown DW, Baker BS, Ovigne JM, Hardman C, Powles AV, Fry L (2) Skin CD4+ T cells produce interferon-gamma in vitro in response to streptococcal antigens in chronic plaque psoriasis. J Invest Dermatol 114:576 8 Chatellier S, Kotb M (2) Preferential stimulation of human lymphocytes by oligodeoxynucleotides that copy DNA CpG motifs present in virulent genes of group A streptococci. Eur J Immunol 3: Decker T, Schneller F, Sparwasser T, Tretter T, Lipford GB, Wagner H et al. (2) Immunostimulatory CpG-oligonucleotides cause proliferation, cytokine production, and an immunogenic phenotype in chronic lymphocytic leukemia B cells. Blood 95: Diluvio L, Vollmer S, Besgen P, Ellwart JW, Chimenti S, Prinz JC (26) Identical TCR beta-chain rearrangements in streptococcal angina and skin lesions of patients with psoriasis vulgaris. J Immunol 176: Fuhlbrigge RC, Kieffer JD, Armerding D, Kupper TS (1997) Cutaneous lymphocyte antigen is a specialized form of PSGL-1 expressed on skinhoming T cells. Nature 389: Gaspari AA (26) Innate and adaptive immunity and the pathophysiology of psoriasis. J Am Acad Dermatol 54:S67 8 Gilliet M, Lande R (28) Antimicrobial peptides and self-dna in autoimmune skin inflammation. Curr Opin Immunol 2:41 7 Griffiths CE, Barker JN (27) Pathogenesis and clinical features of psoriasis. Lancet 37: Gross WL, Packhauser U, Hahn G, Westphal E, Christophers E, Schlaak M (1977) Lymphocyte activation by streptococcal antigens in psoriasis. Br J Dermatol 97: Gudjonsson JE, Thorarinsson AM, Sigurgeirsson B, Kristinsson KG, Valdimarsson H (23) Streptococcal throat infections and exacerbation of chronic plaque psoriasis: a prospective study. Br J Dermatol 149:53 4 Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H et al. (2) A Toll-like receptor recognizes bacterial DNA. Nature 48:74 5 Ichikawa HT, Williams LP, Segal BM (22) Activation of APCs through CD4 or Toll-like receptor 9 overcomes tolerance and precipitates autoimmune disease. J Immunol 169: Krieg AM (22) CpG motifs in bacterial DNA and their immune effects. Annu Rev Immunol 2:79 6 Kryczek I, Bruce AT, Gudjonsson JE, Johnston A, Aphale A, Vatan L et al. (28) Induction of IL-17+ T cell trafficking and development by IFNgamma: mechanism and pathological relevance in psoriasis. J Immunol 181: Lande R, Gregorio J, Facchinetti V, Chatterjee B, Wang YH, Homey B et al. (27) Plasmacytoid dendritic cells sense self-dna coupled with antimicrobial peptide. Nature 449:564 9 Nestle FO, Conrad C, Tun-Kyi A, Homey B, Gombert M, Boyman O et al. (25) Plasmacytoid predendritic cells initiate psoriasis through interferon-alpha production. J Exp Med 22: Oshikawa T, Okamoto M, Tano T, Sasai A, Kan S, Moriya Y et al. (26) Antitumor effect of OK-432-derived DNA: one of the active constituents of OK-432, a streptococcal immunotherapeutic agent. J Immunother (1997) 29:143 5 Pichyangkul S, Yongvanitchit K, Kum-arb U, Krieg AM, Heppner DG, Walsh DS (21) Whole blood cultures to assess the immunostimulatory activities of CpG oligodeoxynucleotides. J Immunol Methods 247:83 94 Pisetsky D, Drayton D, Wu ZQ (1999) Specificity of antibodies to bacterial DNA in the sera of healthy human subjects and patients with systemic lupus erythematosus. J Rheumatol 26: Prinz JC (23) The role of T cells in psoriasis. J Eur Acad Dermatol Venereol 17:257 7 Prinz M, Garbe F, Schmidt H, Mildner A, Gutcher I, Wolter K et al. (26) Innate immunity mediated by TLR9 modulates pathogenicity in an animal model of multiple sclerosis. J Clin Invest 116: Schon MP, Boehncke WH (25) Psoriasis. N Engl J Med 352: Sigmundsdottir H, Gudjonsson JE, Jonsdottir I, Ludviksson BR, Valdimarsson H (21) The frequency of CLA+ CD8+ T cells in the blood of psoriasis patients correlates closely with the severity of their disease. Clin Exp Immunol 126:365 9 Takeda K, Kaisho T, Akira S (23) Toll-like receptors. Annu Rev Immunol 21: Torres-Alvarez B, Castanedo-Cazares JP, Fuentes-Ahumada C, Moncada B (27) The effect of methotrexate on the expression of cell adhesion molecules and activation molecule CD69 in psoriasis. J Eur Acad Dermatol Venereol 21:334 9 Vollmer J, Weeratna R, Payette P, Jurk M, Schetter C, Laucht M et al. (24) Characterization of three CpG oligodeoxynucleotide classes with distinct immunostimulatory activities. Eur J Immunol 34: Wilson NJ, Boniface K, Chan JR, McKenzie BS, Blumenschein WM, Mattson JD et al. (27) Development, cytokine profile and function of human interleukin 17-producing helper T cells. Nat Immunol 8:95 7 Yurci A, Guven K, Torun E, Gursoy S, Baskol M, Akgun H et al. (27) Pyoderma gangrenosum and exacerbation of psoriasis resulting from pegylated interferon alpha and ribavirin treatment of chronic hepatitis C. Eur J Gastroenterol Hepatol 19:811 5 Zheng Y, Danilenko DM, Valdez P, Kasman I, Eastham-Anderson J, Wu J et al. (27) Interleukin-22, a T(H)17 cytokine, mediates IL-23-induced dermal inflammation and acanthosis. Nature 445: Journal of Investigative Dermatology (29), Volume 129