Recombinant Phenotyping of Cytomegalovirus UL54 Mutations that. Emerged During Cell Passages in the Presence of Either Ganciclovir or. Foscarnet.

Transcription

1 AAC Accepts, published online ahead of print on 27 June 2011 Antimicrob. Agents Chemother. doi: /aac Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. Recombinant Phenotyping of Cytomegalovirus UL54 Mutations that Emerged During Cell Passages in the Presence of Either Ganciclovir or Foscarnet. Running title: Human Cytomegalovirus DNA polymerase mutations Christian Gilbert 1,3, Arezki Azzi 2,4, Nathalie Goyette 1, Sheng-Xiang Lin 2 and Guy Boivin 1 *. 1 Research Center in Infectious Diseases, Centre Hospitalier Universitaire de Québec and Laval University, Québec City, Québec, Canada. 2 Research Center in Molecular Endocrinology, Centre Hospitalier Universitaire de Québec and Laval University, Québec City, Québec, Canada. 3 Department of Anesthesiology, Centre Hospitalier Universitaire de Sherbrooke and University of Sherbrooke, Sherbrooke, Québec, Canada. 4 Research unit, College of Medicine, and Al imam Muhammad Ibn Saudi Islamic University, Riyadh, Kingdom of Saudi Arabia. Abstract word count : 243 Text word count :

2 - Address correspondence to : Dr Guy Boivin CHUQ-CHUL, room RC blvd Laurier, Sainte-Foy, Québec, Canada G1V 4G2 Tel : (418) Fax : (418) Guy.Boivin@crchul.ulaval.ca 2

3 ABSTRACT Selection of human cytomegalovirus variants in presence of ganciclovir or foscarnet led to 18 DNA polymerase mutations, 14 of which had not been previously studied. Using bacterial artificial chromosome technology, each of these mutations was individually 5 transferred into the genome of a reference strain. Following reconstitution of infectious viral stocks, each mutant was assessed for its drug susceptibility and growth kinetics in cell culture. Computer-assisted 3D-modeling of the polymerase was also used to position each of the mutations in one of four proposed structural domains and to predict their influence on structural stability of the protein. Among the 10 DNA polymerase mutations 10 selected with ganciclovir, seven (P488R, C539R, L545S, V787L, V812L, P829S, L862F) were associated with ganciclovir resistance whereas two (F595I and V946L) only conferred foscarnet resistance. Among the eight mutations selected with foscarnet, only two (T552N and S585A) conferred foscarnet resistance whereas four (N408D, K500N, L802V and L957F) had an impact on ganciclovir susceptibility. Surprisingly, the 15 combination of mutations, some of which not associated with resistance for a specific antiviral, resulted in increasing resistance effects. 3D-modeling suggested that none of the mutated residues were directly involved in the polymerase catalytic site but rather had an influence on drug susceptibility by modifying the structural flexibility of the protein. Our study significantly adds to the number of DNA polymerase mutations conferring in vitro 20 drug resistance and emphasizes the point that evaluation of individual mutations may not accurately reflect the phenotype conferred by multiple mutations. 3

4 INTRODUCTION Human cytomegalovirus (HCMV) is an important opportunistic pathogen that causes serious morbidity and mortality in immunocompromised patients (28). Despite recent 25 efforts to develop new anti-hcmv agents with different viral targets, ganciclovir (GCV) and its prodrug valganciclovir (VGCV) remain first-line agents for the prevention and treatment of HCMV systemic infections. Cidofovir (CDV) and foscarnet (FOS) are used as second-line agents due to significant toxicities and lack of oral formulations. Ultimately, all three antivirals target the HCMV viral DNA polymerase (pul54) (28, 38). 30 Because HCMV results in lifelong infections, immunosuppressed patients often require extended courses of antiviral agents. This clinical context could lead to the emergence of drug-resistant HCMV mutants that can be associated with treatment failures (8, 18, 27, 31, 34, 35, 50, 51, 54). To exert its antiviral activity, GCV must first be activated by the sequential addition of three phosphate groups to the molecule (3). In HCMV-infected 35 cells, addition of the first phosphate group is carried out by the viral kinase UL97 protein (36, 52). In the clinic, GCV resistance usually arises first from UL97 mutations, resulting in decreased accumulation of the activated form of the antiviral, whereas subsequent UL54 mutations can confer high levels of GCV resistance and variable degree of cross resistance (38). CDV activation relies exclusively on cellular proteins (21) whereas FOS 40 requires no activation steps. Thus, only mutations in UL54 gene are expected to account for resistance to the latter antivirals. Due to the time required to grow clinical isolates and perform standard susceptibility testing, phenotypic assessment of these isolates is often impractical and cannot be used to 4

5 45 guide clinical decisions (38). To circumvent this problem, genotypic analyses and virtual phenotypes have become the standard in clinical practice (4, 7, 8, 11, 13, 14, 17, 40, 42). However, the use of virtual phenotypes requires a good knowledge of HCMV mutations leading to drug resistance and those occuring as a consequence of natural variations (11, 13, 14, 16, 17, 22, 38, 40, 41). In this view, bacterial artificial chromosome (BAC) 50 technology has become the method of choice for the generation of recombinant HCMVs in order to study antiviral drug resistance (11, 12, 14, 17, 40-42). In addition, an effect between UL54 mutations and specific genetic backgrounds on antiviral resistance has been reported by a few groups (11, 15, 17, 43, 48). 55 In the present study, we report the impact of individual or multiple UL54 mutations that emerged during serial in vitro passages of a laboratory (29) and a clinical HCMV strains. Also, to provide an insight into the mechanisms leading to drug resistance, computerassisted 3D modeling studies and structural enzyme flexibility analyses of the HCMV DNA polymerase were conducted. 60 MATERIALS AND METHODS Cells and viruses. Human foreskin fibroblasts (HFFs) were grown and maintained in Eagle s minimal essential medium (MEM) supplemented with 10% fetal bovine serum (FBS). The reporter cell line U373/proUL54, derived from the astrocytoma cells 65 U373MG (29), was grown and maintained in Dulbecco s modified Eagle medium (DMEM) supplemented with 10% FBS. Drug-resistant viruses selected from the laboratory strain AD169 have been previously described (29). In addition, a set of 5

6 sequential mutant viruses was obtained by serial passages of a pre-therapy susceptible clinical isolate (5) in the presence of ganciclovir (GCV) as previously described (29). In 70 brief, an aliquot of the pre-therapy clinical isolate was passaged in the presence of increasing concentrations of GCV (1.5 to 1000 µm). GCV concentration was kept at the same level until good viral growth was noticed (usually one to three passages). Two plaque-purified viruses were isolated and characterized at 10, 25, 50, 300 and 1000 µm of GCV. Plaque-purification was accomplished in the presence of the corresponding 75 concentration of GCV. Of note, further exposition to GCV was performed using viruses that had not been plaque-purified. DNA constructs. The AD169 genome cloned as an infectious BAC (BAC-pHB5) was obtained from Dr. Martin Messerle (Max von Pettenkofer-Institut, Munich, Germany) 80 (9). The Escherichia coli K12 derivative BW25141 (reca1), along with plasmids pkd13, pkd46 and pcp20 were provided by Dr. Barry Wanner (Purdue University, West Lafayette, Indiana) (25). The EcoRI-StuI fragment from pgpol (22), corresponding to nucleotides -818 to 4949 relative to the start codon of AD169 UL54, was cloned into the SspI-EcoRI sites of psp72 (Promega). The resulting plasmid, pspoll, contained the 85 entire HCMV UL54 coding sequence (nt 1 to 3726) with unique SspI (nt -109) and RsrII (nt -4) sites in the 5 untranslated region. Plasmid pspoldel was obtained by cloning the tetracycline resistance cassette (Tet R ) from pbr322 (New England Biolabs) into the RsrII (nt -4)-BspEI (nt 3321) sites of pspoll, therefore deleting the 5 end along with the catalytic subdomain (nt 903 to 2964) of UL54. The transfer plasmid pspoll-kan was 90 obtained by subcloning the BstBI fragment from pkd13 (25), and filling-in the 6

7 extremities to preserve the integrity of the FRT sites into the RsrII site of pspoll. The resulting transfer plasmid then contained the entire coding sequence of UL54 preceeded (at position -4) by a selectable marker (kanamycin resistance) flanked by two FRT sites allowing subsequent excision of the marker (25). HCMV UL54 mutations were first 95 introduced into pspoll using the Quick-Change PCR-based site-directed mutagenesis kit (Stratagene). DNA fragments containing the desired mutations were then subcloned into the transfer plasmid pspoll-kan using different combinations of the various unique restriction sites found within the UL54 coding sequence. Double mutant plasmids were constructed by subcloning different mutated DNA fragments into pspoll-kan. The 100 chloramphenicol resistance (Cm R ) gene found in pcp20 (10, 25) was disrupted by collapsing of the NcoI and XhoI sites. The resulting plasmid, pcp20ap, therefore only harbored ampicilline resistance (Amp R ). Finally, the expression of the HCMV pp71 (pul82) protein in eukaryotic cells have been shown to enhance infectivity of HCMV DNA (2). Such a plasmid, pbk-cmv82, was obtained by cloning the PCR-amplified 105 coding sequence of UL82 into the HinDIII-BamHI sites of pbk-cmv (Stratagene). Construction of recombinant phb5 and reconstitution of recombinant viruses. The detailed approach used to substitute UL54 alleles in phb5 is illustrated in Figure 1. In brief, BW25141 bacteria containing both pkd46 and the HCMV/BAC phb5 were made 110 electrocompetent in the presence of 1 mm of L-arabinose to induce the expression of the phage λ Red Recombinase elements (Gam, Bet and Exo) from pkd46 (25). To ensure that subsequent recombination steps would lead to the introduction of the desired mutation into the HCMV/BAC sequence, a preliminary step consisting in the deletion of 7

8 all UL54 conserved regions from phb5 was performed. This was done by electroporation 115 of the SspI-ScaI fragment of pspoldel, consisting of Tet R flanked by regions homologous to the HCMV UL54 (at -109 to -5 and 3321 to 3565 nt) (Figure 1, B). Tet R -clones were then identified and proper integration of the Tet R gene as well as the absence of rearrangement within the HCMV/BAC sequence were verified by PCR and EcoRI digestion, respectively. The recombinant phbul54del BAC was then used in all 120 subsequent recombination steps. SspI-ScaI (nt -109 to 3565 of the original UL54 + the excisable Kan R inserted at position -4) DNA fragments excised from wild-type (WT) or mutated pspoll-kan transfer plasmids were used to reintroduce full-length UL54 genes into the sequence of phbul54del using the same approach (with Kan R selection instead of Tet R ) (Figure 1, D). The Kan R -gene was then excised from the resulting WT (phbwt- 125 Kan) or mutated (phbmut-kan) BACs by electroporation of pcp20ap expressing the FLP recombinase that mediates site-specific homologous recombination between FRT sites flanking Kan R (Figure 1, F) (25). The resulting recombinant BACs then contained full-lenght WT (phbwt) or mutated (phbmut) UL54 genes preceeded at position -4 by a short 31 nt residual FRT motif. Phenotypic characterization of bacterial clones was 130 performed at every step of the process to identify clones in which the desired sequence of events has occurred. Mutations associated with natural polymorphism (655L, 685S, 885T and 898D) present in all viruses selected from the clinical strain were not included in recombinant viruses. For the purpose of PCR, sequencing and restriction digestion analyses, BAC DNA was prepared by alkaline lysis followed by acetate/isopropanol 135 precipitation. 8

9 For the purpose of electroporation into mammalian cells, BAC DNA was prepared using the QIAGEN s Plasmid Maxi Kit (QIAGEN, Toronto, Canada) following the manufacturer s recommandations for very low-copy plasmid/cosmid purification. 140 HCMV/BAC DNAs were electroporated into subconfluent HFFs along with plasmid pbk-cmv82 as previously described (39). Viruses reconstituted from recombinant HCMV/BACs (RvHBWT or RvHBmut) were then allowed to grow until sufficient stocks could be frozen, usually after 14 to 21 days. Given the clonal nature of the DNA used for reconstitution of recombinant viruses, no additional plaque-purification steps were 145 performed. Viral DNA was extracted from infected HFFs. PCR primers BW1-BW4 (1) were used the amplify a 4.28 Kb (nt -343 to 3937) DNA fragment encompassing both regions of homology used in the recombination steps, the residual FRT motif and the entire UL54 coding sequence. Both PCR primers, along with six other internal primers were then used to sequence the entire DNA fragment. In addition, the catalytic domain of 150 the HCMV UL97 gene, also involved in GCV resistance, was sequenced in selected recombinant viruses as previously described (4). Susceptibility testing. All plaque-purified variants derived from the pre-therapy clinical isolate were assessed for their susceptibility profiles using a standardized plaque 155 reduction assay (PRA) (33). The luciferase reduction assay (LRA) previously-reported by our group (29) was used to assess drug susceptibilities of all recombinant viruses reported in this study. In brief, recombinant HCMVs were grown on confluent HFF monolayers in 96-well plates in the presence of serial dilutions of the antivirals. On day 5, aliquots of cell-free viruses found in culture supernatants were transferred onto freshly confluent 9

10 160 U373/proUL54 cell monolayers that were further incubated for 48 h. In U373/proUL54 cells, HCMV replication triggers the expression of the firefly luciferase gene under the control of a specific HCMV promoter. After the cells were lysed using a luciferasecompatible lysis buffer, addition of luciferine resulted in photon emission that was measured using a standard luminometer. Emission of light (expressed in relative light 165 units-rlu) was then plotted against antiviral concentrations and EC50 values were calculated using bestfit curves (29). In its current format (i.e. tranfer of cell-free viruses found in supernatants), the LRA is of limited use with clinical isolates that are typically associated with very low production of cell-free viruses. We considered an EC50 ratio (concentration of the antiviral that inhibits expression of luciferase by 50% compared to 170 the WT recombinant virus) of 1.7 with confirmation by statistical analysis (i.e. no overlap between EC50 95% confidence intervals of mutant and WT viruses) to represent a significant change in drug susceptibility. Viral growth kinetics analyses. Viral growth kinetics of each recombinant virus were 175 evaluated using real-time PCR quantification of cell-free virus collected at different time points following infection with a standardized inoculum. In brief, cell-free viruses were inoculated onto HFFs in 12-well plates to obtain PFU per well. Supernatants were collected on a daily basis, centrifuged at low speed to clear cellular debris (850 x g, 5 min at 4 o C) and then frozen until DNA was extracted using the MagNA Pure LC Total 180 Nucleic Acid Isolation Kit (Roche Applied Science). A portion of the glycoprotein B gene (gpb) was amplified using PCR primers gpbup (tcaccctatcgcgtgtgttc) and gpblo (ataggaggcgccacgtattc). Internal probes used for melting curve analyses were CMVgB- 10

11 fluo (ttaaaggtgtgcgccacgatgttgcg-fl) and CMVgB-red (LCRed640- ttgtagaccaccatgatgccct-ph). Each 20 µl-reaction contained 5 µl of sample DNA, 5% 185 DMSO, 1 mm of MgCl2, 400 nm of each PCR primer, 300 nm of CMVgB-fluo, 600 nm of CMVgB-red and 2 µl of LC Faststart DNA Master Hybridization Probes mix (Roche Applied Science). Cycling conditions were as follows: initial denaturation (95 o C, 10 min) followed by 50 cycles of DNA amplification (95 o C, 15 sec; 56 o C, 10 sec; 72 o C, 15 sec) and then final melting curve (95 o C, 0 sec; 48 o C, 30 sec; 0.10 o C/sec up to 95 o C with 190 continuous fluorescence assessment). Each PCR run included the appropriate negative controls as well as an internal standard control (1000 copies of plasmid HCMV DNA) in order to fit the results into a pre-established standard curve (10 1 to 10 9 copies of plasmid DNA). Using these conditions, 10 copies of the plasmid CMV DNA could be systematically detected and the intra- and inter-assay variabilities were 15.8% and 17.7% 195 for 10 2 copies as well as 5.6% and 13.9% for 10 5 copies of plasmid DNA. Results were reported as HCMV genome copies per ml of supernatant. To minimize inter-assay variability, all viruses were evaluated in a single experiment. To confirm the initial inoculum, parallel 12-well plates were inoculated with the same virus dilution and overlaid with a semi-solid medium consisting of MEM supplemented with 5% FBS and % agarose (all final concentrations). After 10 days of incubation, the plates were stained with crystal violet and the number of viral plaques was determined under light microscopy. 3D modeling and conformation analyses. Our previous 3D model of the HCMV DNA 205 polymerase in editing mode (49) was refined using the crystal structure of the herpes 11

12 simplex virus type 1 (HSV-1) DNA polymerase (37). Briefly, conserved amino acid side chains in our model were placed in the same orientation as their analogues in the HSV1- DNA polymerase structure to preserve non bonded interactions. To evaluate the flexibility of the WT enzyme and the predicted influence of the various mutations, a 210 translation-libration-screw (TLS) analysis was performed using the TLSMD program (44). The atomics temperature factors from the HSV-1 DNA polymerase structure (37) were included in our homology model for homologue residues to generate our working HCMV DNA polymerase model for TLS simulation. The proposed impact of various mutations on protein stability was evaluated using the program CUPSAT which predict 215 the difference in the free energy of unfolding ( G) between a WT protein and its mutant (45). Change in protein stability as measured from computed G indicates a stabilizing mutation in case of a positive value and a destabilizing mutation for a negative value. RESULTS 220 Sequential emergence of UL54 mutations following antiviral selection. The emergence of UL54 mutations L545S, V812L, P829S and D879G after selection with GCV and of UL54 mutations N408D, K500N, T552N, S585A, N757K, L802V, L926V and L957F following exposure to FOS has been previously described (29). The sequential emergence of UL54 and UL97 mutations from a pre-therapy clinical strain following 225 exposure to increasing concentrations of GCV is presented in Table 1 along with drug susceptibilities of selected plaque-purified viruses. Initially, two different UL54 mutants were detected (P488R and C539R). Eventually, however, one of the mutants (C539R) overgrew the other one and was detected in all subsequent plaque-purified viruses. A 12

13 total of two UL97 mutations (H520Q and G598D) and six UL54 mutations (P488R, 230 C539R, F595I, V787L, L862F and V946L) were observed in different plaque-purified viruses. Reconstitution of recombinant HCMV viruses based on UL54 allele exchange in phb5. All reported UL54 mutations (present study and (29)) were individually 235 introduced into the genome of recombinant viruses. Mutation L802M, previously studied by other groups (18, 22), was also introduced as a comparison for mutation L802V. Five double-mutants were also generated. In all cases, structural integrity of the recombinant BACs was confirmed by EcoRI digest prior to reconstitution of live viral stocks in HFF (not shown). Sequence analyses of the BW1-BW4 PCR-amplified DNA fragment (nt relative to the start codon of UL54, including regions of homology used in homologous recombination steps) from all recombinant viruses confirmed the presence of the 31 nt residual FRT motif at position -4, the presence of the expected UL54 mutations, and the absence of unintended UL54 mutations. In addition, the catalytic portion of UL97 was sequenced for all recombinant viruses harboring an EC50 ratio 1.5 for GCV. No 245 UL97 mutations could be detected from our recombinant viruses. Susceptibility profiles of recombinant HCMVs. All recombinant viruses generated in the present study were assessed for their susceptibility to GCV, CDV and FOS using the LRA (Table 2). Of the 10 UL54 mutations selected with GCV, seven were found to 250 induce a significant decrease in GCV susceptibility whereas two other mutations were associated with in vitro FOS resistance only (F595I and V946L). Among the eight UL54 13

14 mutations selected with FOS, only two (T552N and S585A) were associated with in vitro FOS resistance. Four of the other six mutations were either associated with GCV and CDV in vitro resistance (N408D and K500N) or GCV in vitro resistance alone (L802V 255 and L957F). The combination of mutations we studied showed various effects on drug- susceptibility profiles. Most notably, the combination of mutations not individually affecting FOS susceptibility (L545S/P829S or N408D/L957F) resulted in some level of in vitro resistance to this antiviral. Mutation L957F was also apparently able to modulate the level of FOS susceptibility conferred by mutation T552N alone (Table 2). 260 Viral growth kinetics. All of our recombinant viruses were assessed for their growth properties over multiple cycles of replication using a low MOI (Figure 2). In the first panel, the growth of the reference laboratory strain AD169 could not be distinguished from the growth curves generated using viruses reconstituted from either the original 265 HCMV/BAC phb5 (9) or our recombinant WT BAC containing the residual FRT motif (phbwt). Among single mutations selected with either GCV or FOS, mutation L862F was associated with the greatest decrease in virus yield (between 0.3 to 0.9 log 10 from day 6 to 12 as compared to WT) whereas other mutations had no or only a minor impact on virus yield production. However some of the double mutants (L545S/P829S, 270 N408D/T552N and T552N/L957F) consistently showed a decreased virus yield (0.3 to 1.2 log 10, from day 6-12 compared to WT) whereas others (N408D/L957F and K500N/S585A) remained relatively unaffected. 14

15 3D modeling and conformation analyses. Our previous models of the HCMV DNA 275 polymerase contained 602 residues (open conformation) and 604 residues (closed conformation) and were based primarily on the bacteriophage RB69 DNA polymerase (another member of the polymerase α family to which the HCMV DNA polymerase also belongs) crystal structures with whom pul54 shares 26% residues identity (49). Refinement of our model based on the HSV-1 DNA polymerase crystal structure (37) led 280 to a 826-residue model (residues , , , , , , , , and ) in the open conformation (model available upon request). The residues identity between the HSV-1 and HCMV DNA polymerases is 36.4% (46.1% similarity) whereas it is 42.5% (53.1% similarity) when only conserved regions (residues 295 to 988 of the HCMV DNA polymerase) are 285 considered. The TLS determination generated a backbone displacement model with four TLS groups including the following residues: Group 1: , group 2: , group 3: and group 4: (Figure 3A). These groups correspond to the 4 regions of the DNA polymerase, namely group1 to N-terminal region, group 2 to NH2-domain, group 3 to the polymerase domains and group 4 to the exonuclease domain. This suggests 290 that these domains have different states of flexibility moving independently one from another as illustrated in figure 3A. Predicted impact of HCMV DNA polymerase mutations on structure stability. Single residue mutations can cause reduction in hydrophobic area, over-packing, or loss 295 of electrostatic interactions, and thus lead to changes in protein stability. The proposed impact of individual mutations on the stability of the UL54 protein domains is presented 15

16 in Table 2. The position of the residues involved relative to the putative active site in either the editing (mutations selected with GCV) or replicative (mutations selected with FOS) modes is presented in Figures 3B and 3C, respectively. None of the mutations are 300 located directly in the putative enzyme catalytic site. However, some of the interactions, including local modifications in hydrophobicity, steric clashes and the formation of new hydrogen bonds, could be proposed using our model. The mutations appear to have various effects on the structure either stabilizing or destabilizing it. Interestingly, there is a correlation between the location of mutations conferring drug resistance and its 305 proposed effect on the protein structure. In fact, most (7 out of 9) variations appearing in the polymerase domain (residues 569 to 1227) stabilize the protein structure whereas mutations appearing in other domains have either stabilizing or destabilizing effects. DISCUSSION 310 In the present study, we describe recombinant phenotyping for UL54 mutations that emerged following in vitro exposure to either GCV or FOS. Eleven of these mutations represent new additions to the growing number of UL54 mutations with confirmed involvement in in vitro drug resistance (38). To provide an insight into the mechanisms by which those mutations could affect drug susceptibility, computer-assisted 3D 315 modeling of the HCMV pul54 and structural effects analyses were also performed. In addition to the 12 UL54 mutations described in our previous work (29), six additional UL54 mutations were selected from a clinical strain following serial passages in the presence of GCV. In contrast to what was observed in mutants derived from the 16

17 320 laboratory strain AD169, multiple variants were selected from the clinical strain for a 325 given drug concentration. First, two distinct UL54 mutants were initially selected. Both harbored comparable levels of GCV resistance but only one of those could be detected after further exposition to GCV (Table 1). Once again, the sequential emergence of multiple UL54 mutations led not only to a high-level GCV resistance but also to crossresistance to CDV and FOS. The BAC technology has recently emerged as a powerful tool to study the involvement of individual HCMV mutations in drug resistance (11, 12, 14, 17, 40-42). Due to the high number of UL54 mutations to be tested, we opted for a highly efficient selectable marker 330 that can be excised from the viral genome leaving a short 31 nt residual FRT motif in the 5 untranslated region of UL54. The presence of this short residual FRT motif did not have any apparent effects on viral drug-susceptibility profiles (Table 2) or viral growth kinetics (Figure 2). The lack of interference of such short residual FRT motif has also been documented in other studies for UL97 (14, 40) and UL54 (17). Of the 19 individual 335 UL54 mutations studied using our system, five (N408D (22), L545S (22), V787L (54), V812L (23) and L802M (18, 22)) were previously studied using marker transfer experiments. In those cases, our results show excellent correlation with previous results. The only significant difference was seen with mutation V812L that did not confer FOS resistance as reported by others (23). Overall, we have confirmed the role of seven new 340 mutations associated with GCV resistance (P488R, K500N, C539R, L802V, P829S, L862F and L957F) and four new mutations associated with FOS resistance (T552N, S585A, F595I and V946L). 17

18 Surprisingly, however, some of the mutations selected during our study did not confer 345 resistance to the corresponding antiviral but, rather, seemed to confer in vitro resistance to another antiviral (N408D, K500N, F595I, L802V, V946L and L957F) or had no apparent effects on drug resistance (N757K, D879G and L926V). Any of these variations could represent UL54 modifications that favour the subsequent emergence of mutations conferring resistance to the corresponding antiviral or might act in synergy with other 350 UL54 mutations. Similarly, the stepwise emergence of mutations in the HIV-1 protease has been well documented (24, 53). The importance of the genetic background has recently been outlined in a few studies in which three mutations identified in clinical specimens (G698D, Y818C and L845P) could not be transferred in a reference strain or conferred a severe replication defect (17, 20). In the case of mutations G698D and 355 Y818C, other UL54 mutations, not themselves associated with drug resistance, were also present in the clinical specimens (17). In another study, a set of six UL54 mutations not proposed to be involved in drug resistance was not only associated with partial compensation of the fitness loss conferred by mutation D301N, but also significantly influenced its susceptibility to all three antivirals (15). Finally, even though the 360 combination of UL54 mutations was initially reported to have rather additive effects (22), synergism between known resistance mutations was also reported to impact CDV (11, 23) and FOS (11) resistance in vitro. Some of the double mutants we have generated also support those findings. Indeed, two 365 of our double mutants (L545S/P829S and N408D/L957F) exhibited resistance to FOS 18

19 while none of the single mutations were able to confer such a phenotype (Table 2). In addition, mutation L957F was also apparently able to modulate the FOS resistance level conferred by mutation T552N alone. CDV susceptibility was also modulated in some of our double mutants. Due to the large number of mutations presented here, not all possible 370 double mutants were generated. We therefore cannot exclude the possibility that some other combinations might have similar modulating effects that would explain their selection with either GCV or FOS in cell culture. Results from our past (49) and present studies strongly suggest that structural and 375 flexibility changes in the DNA polymerase, rather than direct direct involvement of the catalytic sites, are responsible for the drug resistance phenotypes conferred by specific UL54 mutations. It is therefore plausible that the combined effects of UL54 mutations on the protein may provide structural changes that are compatible with drug resistance. 3D modeling and predicted structural changes have proven to be precious tools in 380 understanding HIV-1 resistance to antiretroviral agents (46). Structural flexibility analyses of our HCMV model suggested four TLS groups with different states of flexibility and corresponding to an exonuclease domain, a polymerase/c-terminal domain, an NH2-domain and the N-terminal region. In the present study, four of the six mutations conferring FOS resistance were located in either the polymerase or N-terminal 385 domains and had a stabilizing effect on structure flexibility whereas five of the six mutations associated with both GCV and CDV resistance were located in the exonuclease domain and exhibited either stabilizing or destabilizing effects on structure stability (Table 2). 19

20 390 Another important observation from our model is that, whether GCV or FOS was used in the selection process, initial UL54 mutations to emerge were located within the proposed exonuclease domain of the protein (Table 2). In one recent study, a recombinant virus with UL54 mutation D413A located in motif Exo II exhibited GCV and CDV resistance but remained susceptible to FOS (19). However, the presence of the mutation was 395 associated with the accelerated development of resistance to maribavir, which is not a polymerase inhibitor. Moreover, after a limited number of passages in the absence of selective pressure, the plating efficiency of the unpurified D413A-recombinant virus under 400 µm of FOS was about 30-fold that of the parental strain passaged under the same conditions (19). Even though the putative FOS-resistant plaque-purified clones 400 were not further characterized, those results strongly suggest that at least some mutations in the exonuclease domain could facilitate the subsequent development of other mutations associated with in vitro drug resistance. This phenomenon has been well studied in HSV- 1 DNA polymerase mutants with mutations involving critical Exo motif residues (30, 32). In our study, three mutations (N408D, C539R and L545S) at strictly conserved residues 405 within motifs Exo II end III (29) emerged early in the selection process and might have facilitated the subsequent emergence of other UL54 mutations. Alternatively, these mutations could have also influenced the protein structure allowing the emergence of additional mutations. 410 Alterations in the HCMV pul54 sequence have been reported to impair replicative capacities of some mutants (1, 11, 15, 17, 19, 20, 23, 26, 51). In our study, no severe 20

21 replication impairment was noted for the single mutants. Only mutation L862F was associated with a moderate decrease in viral yield production. However, some double pul54 mutants were associated with reduced replicative capacities ( 1.2 log 10 ) as 415 compared to the single mutants or the WT recombinant virus (Figure 2). UL54 mutations described in our study were selected in vitro so their potential clinical significance remains to be elucidated. However, some UL54 mutations described in our study such as L545S and V812L were also identified in the clinical setting (38). 420 Mutations N408D and V787L were further identified in clinical specimens from patients failing antiviral therapy (38). By comparison with EC50 ratios published by other groups for previously well-studied mutations (38), EC50 ratios obtained with our LRA tend to be slightlty lower. Nevertheless, UL97 mutations associated with EC50 ratios as low as 1.9 have been described in the clinical setting and can result in clinical or virological failure 425 (38, 47). On the other hand, it must be emphasized that in vitro resistance does not always correlate with clinical failure. For example, our own studies (6, 7) showed that even wellestablished GCV-resistant UL97 mutants were sometimes associated with asymptomatic infections. 430 In conclusion, we have demonstrated the involvement of 11 new UL54 mutations associated with in vitro drug resistance. More importantly, our results indicate that virtual phenotypes based solely on the sum of EC50 values conferred by individual mutations might not always accurately reflect the susceptibility profiles of viruses with multiple UL54 mutations. 21

22 435 ACKNOWLEDGMENTS This study was supported by research grants from the Canadian Institutes of Health Research (CIHR; MOP-62794) to Guy Boivin. Guy Boivin holds a Canada Research Chair on Emerging Viruses and Antiviral Resistance. Christian Gilbert received PhD scholarships from Le Fond de Recherche en Santé du Québec and the CIHR. 440 We thank Dr. Tomas Cihlar (Gilead Science) for many useful discussions at multiple steps of this project. We also thank Dr. Martin Messerle (Max von Pettenkofer-Institut, Munich, Germany) and Dr. Barry Wanner (Purdue University, West Lafayette, Indiana) who kindly provided important materials for our project. 22

23 445 REFERENCES 1. Baldanti, F., M. R. Underwood, S. C. Stanat, K. K. Biron, S. Chou, A. Sarasini, E. Silini, and G. Gerna Single amino acid changes in the DNA polymerase confer foscarnet resistance and slow-growth phenotype, while mutations in the 450 UL97-encoded phosphotransferase confer ganciclovir resistance in three double- resistant human cytomegalovirus strains recovered from patients with AIDS. J Virol 70: Baldick, C. J., Jr., A. Marchini, C. E. Patterson, and T. Shenk Human cytomegalovirus tegument protein pp71 (ppul82) enhances the infectivity of viral 455 DNA and accelerates the infectious cycle. J Virol 71: Biron, K. K., S. C. Stanat, J. B. Sorrell, J. A. Fyfe, P. M. Keller, C. U. Lambe, and D. J. Nelson Metabolic activation of the nucleoside analog 9-[(2- hydroxy-1-(hydroxymethyl)ethoxy]methyl)guanine in human diploid fibroblasts infected with human cytomegalovirus. Proc Natl Acad Sci U S A 82: Boivin, G., C. Gilbert, A. Gaudreau, I. Greenfield, R. Sudlow, and N. A. Roberts Rate of emergence of cytomegalovirus (CMV) mutations in leukocytes of patients with acquired immunodeficiency syndrome who are receiving valganciclovir as induction and maintenance therapy for CMV retinitis. J Infect Dis 184: Boivin, G., C. Gilbert, M. Morissette, J. Handfield, N. Goyette, and M. G. Bergeron A case of ganciclovir-resistant cytomegalovirus (CMV) retinitis in a patient with AIDS: longitudinal molecular analysis of the CMV viral load and viral mutations in blood compartments. AIDS 11:

24 6. Boivin, G., N. Goyette, C. Gilbert, A. Humar, and E. Covington Clinical 470 impact of ganciclovir-resistant cytomegalovirus infections in solid organ transplant 475 patients. Transpl Infect Dis 7: Boivin, G., N. Goyette, C. Gilbert, N. Roberts, K. Macey, C. Paya, M. D. Pescovitz, A. Humar, E. Dominguez, K. Washburn, E. Blumberg, B. Alexander, R. Freeman, N. Heaton, and E. Covington Absence of cytomegalovirusresistance mutations after valganciclovir prophylaxis, in a prospective multicenter study of solid-organ transplant recipients. J Infect Dis 189: Boivin, G., N. Goyette, H. Rollag, A. G. Jardine, M. D. Pescovitz, A. Asberg, J. Ives, A. Hartmann, and A. Humar Cytomegalovirus resistance in solid organ transplant recipients treated with intravenous ganciclovir or oral 480 valganciclovir. Antivir Ther 14: Borst, E. M., G. Hahn, U. H. Koszinowski, and M. Messerle Cloning of the human cytomegalovirus (HCMV) genome as an infectious bacterial artificial chromosome in Escherichia coli: a new approach for construction of HCMV mutants. J Virol 73: Cherepanov, P. P., and W. Wackernagel Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene 158: Chevillotte, M., I. Ersing, T. Mertens, and J. von Einem Differentiation between polymorphisms and resistance-associated mutations in human 490 cytomegalovirus DNA polymerase. Antimicrob Agents Chemother 54:

25 12. Chevillotte, M., A. Schubert, T. Mertens, and J. von Einem Fluorescencebased assay for phenotypic characterization of human cytomegalovirus polymerase mutations regarding drug susceptibility and viral replicative fitness. Antimicrob Agents Chemother 53: Chevillotte, M., J. von Einem, B. M. Meier, F. M. Lin, H. A. Kestler, and T. Mertens A new tool linking human cytomegalovirus drug resistance mutations to resistance phenotypes. Antiviral Res 85: Chou, S Recombinant phenotyping of cytomegalovirus UL97 kinase sequence variants for ganciclovir resistance. Antimicrob Agents Chemother 54: Chou, S., N. S. Lurain, K. D. Thompson, R. C. Miner, and W. L. Drew Viral DNA polymerase mutations associated with drug resistance in human cytomegalovirus. J Infect Dis 188: Chou, S., N. S. Lurain, A. Weinberg, G. Y. Cai, P. L. Sharma, and C. S. Crumpacker Interstrain variation in the human cytomegalovirus DNA 505 polymerase sequence and its effect on genotypic diagnosis of antiviral drug resistance. Antimicrob Agents Chemother 43: Chou, S., G. Marousek, G. Boivin, N. Goyette, M. Farhan, J. A. Ives, and R. Elston Recombinant phenotyping of cytomegalovirus sequence variants detected after 200 or 100 days of valganciclovir prophylaxis. Transplantation : Chou, S., G. Marousek, S. Guentzel, S. E. Follansbee, M. E. Poscher, J. P. Lalezari, R. C. Miner, and W. L. Drew Evolution of mutations conferring 25

26 multidrug resistance during prophylaxis and therapy for cytomegalovirus disease. J Infect Dis 176: Chou, S., and G. I. Marousek Accelerated evolution of maribavir resistance in a cytomegalovirus exonuclease domain II mutant. J Virol 82: Chou, S., G. I. Marousek, L. C. Van Wechel, S. Li, and A. Weinberg Growth and drug resistance phenotypes resulting from cytomegalovirus DNA polymerase region III mutations observed in clinical specimens. Antimicrob Agents 520 Chemother 51: Cihlar, T., and M. S. Chen Identification of enzymes catalyzing two-step phosphorylation of cidofovir and the effect of cytomegalovirus infection on their activities in host cells. Mol Pharmacol 50: Cihlar, T., M. D. Fuller, and J. M. Cherrington Characterization of drug 525 resistance-associated mutations in the human cytomegalovirus DNA polymerase gene by using recombinant mutant viruses generated from overlapping DNA fragments. J Virol 72: Cihlar, T., M. D. Fuller, A. S. Mulato, and J. M. Cherrington A point mutation in the human cytomegalovirus DNA polymerase gene selected in vitro by 530 cidofovir confers a slow replication phenotype in cell culture. Virology 248: Condra, J. H Resistance to HIV protease inhibitors. Haemophilia 4: Datsenko, K. A., and B. L. Wanner One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97:

27 Ducancelle, A., G. Champier, S. Alain, F. Petit, M. J. Le Pors, and M. C. Mazeron A novel mutation in the UL54 gene of human cytomegalovirus isolates that confers resistance to foscarnet. Antivir Ther 11: Erice, A., C. Gil-Roda, J. L. Perez, H. H. Balfour, K. J. Sannerud, M. N. Hanson, G. Boivin, and S. Chou Antiviral susceptibilities and analysis of 540 UL97 and DNA polymerase sequences of clinical cytomegalovirus isolates from immunocompromised patients. J Infect Dis 175: Gilbert, C., and G. Boivin Human cytomegalovirus resistance to antiviral drugs. Antimicrob Agents Chemother 49: Gilbert, C., and G. Boivin New reporter cell line to evaluate the sequential 545 emergence of multiple human cytomegalovirus mutations during in vitro drug exposure. Antimicrob Agents Chemother 49: Hwang, Y. T., B. Y. Liu, D. M. Coen, and C. B. Hwang Effects of mutations in the Exo III motif of the herpes simplex virus DNA polymerase gene on enzyme activities, viral replication, and replication fidelity. J Virol 71: Jabs, D. A., B. K. Martin, M. S. Forman, J. P. Dunn, J. L. Davis, D. V. Weinberg, K. K. Biron, F. Baldanti, and H. Hu Longitudinal observations on mutations conferring ganciclovir resistance in patients with acquired immunodeficiency syndrome and cytomegalovirus retinitis: The Cytomegalovirus and Viral Resistance Study Group Report Number 8. Am J Ophthalmol 132: Kuhn, F. J., and C. W. Knopf Herpes simplex virus type 1 DNA polymerase. Mutational analysis of the 3'-5'-exonuclease domain. J Biol Chem 271:

28 33. Landry, M. L., S. Stanat, K. Biron, D. Brambilla, W. Britt, J. Jokela, S. Chou, W. L. Drew, A. Erice, B. Gilliam, N. Lurain, J. Manischewitz, R. Miner, M. 560 Nokta, P. Reichelderfer, S. Spector, A. Weinberg, B. Yen_Lieberman, and C. Crumpacker A standardized plaque reduction assay for determination of drug susceptibilities of cytomegalovirus clinical isolates. Antimicrob Agents Chemother 44: Limaye, A. P., L. Corey, D. M. Koelle, C. L. Davis, and M. Boeckh Emergence of ganciclovir-resistant cytomegalovirus disease among recipients of solid-organ transplants. Lancet 356: Limaye, A. P., G. Raghu, D. M. Koelle, J. Ferrenberg, M.-L. Huang, and M. Boeckh High incidence of ganciclovir-resistant cytomegalovirus infection among lung transplant recipients receiving preemptive therapy. J Infect Dis 185: Littler, E., A. D. Stuart, and M. S. Chee Human cytomegalovirus UL97 open reading frame encodes a protein that phosphorylates the antiviral nucleoside analogue ganciclovir. Nature 358: Liu, S., J. D. Knafels, J. S. Chang, G. A. Waszak, E. T. Baldwin, M. R. Deibel, 575 Jr., D. R. Thomsen, F. L. Homa, P. A. Wells, M. C. Tory, R. A. Poorman, H. Gao, X. Qiu, and A. P. Seddon Crystal structure of the herpes simplex virus 1 DNA polymerase. J Biol Chem 281: Lurain, N. S., and S. Chou Antiviral drug resistance of human cytomegalovirus. Clin Microbiol Rev 23:

29 Marchini, A., H. Liu, and H. Zhu Human cytomegalovirus with IE-2 (UL122) deleted fails to express early lytic genes. J Virol 75: Martin, M., C. Gilbert, E. Covington, and G. Boivin Characterization of human cytomegalovirus (HCMV) UL97 mutations found in a valganciclovir/oral ganciclovir prophylactic trial by use of a bacterial artificial chromosome containing 585 the HCMV genome. J Infect Dis 194: Martin, M., N. Goyette, and G. Boivin Contrasting effects on ganciclovir susceptibility and replicative capacity of two mutations at codon 466 of the human cytomegalovirus UL97 gene. J Clin Virol 49: Martin, M., N. Goyette, J. Ives, and G. Boivin Incidence and 590 characterization of cytomegalovirus resistance mutations among pediatric solid organ transplant patients who received valganciclovir prophylaxis. J Clin Virol 47: Mousavi-Jazi, M., L. Schloss, W. L. Drew, A. Linde, R. C. Miner, J. Harmenberg, B. Wahren, and M. Brytting Variations in the cytomegalovirus DNA polymerase and phosphotransferase genes in relation to 595 foscarnet and ganciclovir sensitivity. J Clin Virol 23: Painter, J., and E. A. Merritt Optimal description of a protein structure in terms of multiple groups undergoing TLS motion. Acta Crystallogr D Biol Crystallogr 62: Parthiban, V., M. M. Gromiha, and D. Schomburg CUPSAT: prediction of 600 protein stability upon point mutations. Nucleic Acids Res 34:W

30 46. Piana, S., P. Carloni, and U. Rothlisberger Drug resistance in HIV-1 protease: Flexibility-assisted mechanism of compensatory mutations. Protein Sci 11: Schreiber, A., G. Harter, A. Schubert, D. Bunjes, T. Mertens, and D. Michel Antiviral treatment of cytomegalovirus infection and resistant strains. Expert Opin Pharmacother 10: Scott, G. M., A. Weinberg, W. D. Rawlinson, and S. Chou Multidrug resistance conferred by novel DNA polymerase mutations in human cytomegalovirus isolates. Antimicrob Agents Chemother 51: Shi, R., A. Azzi, C. Gilbert, G. Boivin, and S. X. Lin Three-dimensional modeling of cytomegalovirus DNA polymerase and preliminary analysis of drug resistance. Proteins 64: Smith, I. L., J. M. Cherrington, R. E. Jiles, M. D. Fuller, W. R. Freeman, and S. A. Spector High-level resistance of cytomegalovirus to ganciclovir is 615 associated with alterations in both the UL97 and DNA polymerase genes. J Infect Dis 176: Springer, K. L., S. Chou, S. Li, R. H. Giller, R. Quinones, J. E. Shira, and A. Weinberg How evolution of mutations conferring drug resistance affects viral dynamics and clinical outcomes of cytomegalovirus-infected hematopoietic cell 620 transplant recipients. J Clin Microbiol 43: Sullivan, V., C. L. Talarico, S. C. Stanat, M. Davis, D. M. Coen, and K. K. Biron A protein kinase homologue controls phosphorylation of ganciclovir in human cytomegalovirus-infected cells. Nature 358:

31 53. Turner, D., J. M. Schapiro, B. G. Brenner, and M. A. Wainberg The 625 influence of protease inhibitor resistance profiles on selection of HIV therapy in treatment-naive patients. Antivir Ther 9: Weinberg, A., D. A. Jabs, S. Chou, B. K. Martin, N. S. Lurain, M. S. Forman, and C. Crumpacker Mutations conferring foscarnet resistance in a cohort of patients with acquired immunodeficiency syndrome and cytomegalovirus retinitis. J 630 Infect Dis 187:

32 Table 1: Genotypic characterization of plaque-purified variants selected with GCV from a pre-therapy clinical isolate. Variant 1 UL97 genotype UL54 genotype 2 GCV EC50 3 in µm (Ratio 4 ) CDV EC50 3 in µm (Ratio 4 ) FOS EC50 3 in µm (Ratio 4 ) Clinical isolate WT Baseline GCV-1 A WT P488R 14.3 (7.5) 3.9 (7.4) 21.3 (1.0) 10 GCV-1 B WT C539R 12.0 (6.3) NA NA 25 GCV-1 A H520Q C539R, F595I 113 (59) 3.8 (7.4) NA 25 GCV-1 B G598D C539R, F595I 52.5 (28) NA NA 50 GCV-1 A, B 5 H520Q C539R, F595I 150 (79) 6.9 (13) 137 (6.3) 300 GCV-1 A H520Q C539R, F595I NA NA NA 300 GCV-1 B H520Q C539R NA NA NA 1000 GCV-1 A H520Q C539R, V787L, L862F, V946L NA NA NA 1000 GCV-1 B H520Q C539R, V787L, V946L NA NA NA Note: 1, Numbers indicate GCV concentration at which at least two different clones (A and B) were plaque-purified. 2, Only variations from the baseline UL54 sequence are shown. 3, EC50 values were obtained using a standardized plaque reduction assay (PRA) (33). 4, Ratios express the EC50 for the plaque-purified variant / EC50 for the pre-therapy clinical isolate. 5, The two different clones analyzed (A and B) had identical genotypes. NA, not available. The unpurified virus obtained at 1000 µm had a GCV EC50 value of 512 µm. 32

33 Table 2: Phenotypic characterization of recombinant HCMV pul54 mutants and predicted enzyme structural changes. Recombinant Mutant (Selection 1 ) UL54 conserved region EC50 2 (95%CI) (µm) GCV CDV FOS Protein stability analyses Ratio 3 EC50 2 (95%CI) Ratio 3 EC50 2 (95%CI) Ratio 3 Domain (µm) (µm) involved Predicted G kcal/mol 4 (effect on structure 5 ) AD ( ) ( ) ( ) 0.9 RvHB ( ) ( ) ( ) 0.7 RvHBWT ( ) ( ) ( ) -- Mutations selected with GCV-1 (from a clinical strain) 488R (10) IV-δC 2.84 ( ) ( ) ( ) (S) Exo 539R (10) δc (Exo III) 2.60 ( ) ( ) ( ) (D) Exo 595I (25) δc-ii 1.10 ( ) ( ) ( ) (S) N-terminal 787L (1000) VI 1.50 ( ) ( ) ( ) (S) Pol 862F (1000) III-I 1.40 ( ) ( ) ( ) 1.1 Not included in the 3D model 946L (1000) I-VII 0.93 ( ) ( ) ( ) (S) Pol Mutations selected with GCV-2 (from the laboratory strain AD169) 545S (10) δc (Exo III) 4.13 ( ) ( ) ( ) (S) Exo 812L (1000) III 2.14 ( ) ( ) ( ) (S) Pol 829S (300) III 1.68 ( ) ( ) ( ) (S) Pol 879G (1000) III-I 1.02 ( ) ( ) ( ) 0.9 Not included in the 3D model 545S+829S 5.98 ( ) ( ) ( ) Mutations selected with FOS-1 (from the laboratory strain AD169) 408D (800) IV (Exo II) 3.33 ( ) ( ) ( ) (S) Exo 552N (300) δc 1.53 ( ) ( ) ( ) (D) Exo 957F (3000) I-VII 2.20 ( ) ( ) ( ) (D) Pol 408D+552N 3.45 ( ) ( ) ( ) D+957F 4.05 ( ) ( ) ( ) N+957F 1.30 ( ) ( ) ( ) Mutations selected with FOS-2 (from the laboratory strain AD169) 500N (300) δc 2.61 ( ) ( ) ( ) (D) Exo 585A (300) δc 1.24 ( ) ( ) ( ) (D) Exo 757K (3000) II-VI 0.92 ( ) ( ) ( ) (S) Pol 802M 8 VI-III 1.39 ( ) ( ) ( ) (S) Pol 802V (800) VI-III 1.46 ( ) ( ) ( ) (D) Pol 926V (3000) I-VII 1.11 ( ) ( ) ( ) (S) Pol 500N+585A 1.95 ( ) ( ) ( )

34 Note: 1, Selection refers to the concentration (in µm) of the of the selection agent at which the mutation was first detected. 2, Drug concentration that inhibits 50% of viral growth (EC50) were determined using the LRA previously described (29). Results represent mean values of at least 3 independent experiments. 3, Ratios express the EC50 for the recombinant mutant / EC50 for the wild-type recombinant. Ratios indicated in bold-face type indicate a significant (i.e. ratio of at least 1.7 combined with statistical significance) change. 4, Predicted effect on domain stability was evaluated using the program CUPSAT (45). 5, Mutations were either classified as having a stabilizing (S) or destabilizing (D) effect on the domain structure (see materials and methods). 6, RvHB5 is the virus reconstituted from the original (unmodified) HCMV/BAC phb5 (9). 7, RvHBWT is the wild-type virus reconstituted using our system (i.e. with the residual FRT motif). 8, Mutation L802M was included as a comparison for mutation L802V identified in our studies. 34

35 Figure Legends Figure 1: UL54 allele exchange within the HCMV/BAC phb5. The AD169 genome cloned as a bacterial artificial chromosome is represented in A with a magnified view of the DNA polymerase (UL54) locus. In B, the pspoldel insert was used to delete UL54 conserved regions from the HCMV/BAC sequence using Phage λ red recombinaseenhanced homologous recombination. The result is an HCMV/BAC (phbul54del, represented in C) in which nucleotides -4 to 3321 of the UL54 gene have been replaced by the Tet r gene. In D, full-length UL54 genes, either wild-type (WT) or mutated (mut), are re-introduced into the HCMV/BAC sequence using pspoll-kan inserts. The latter consist of nucleotides -109 to 3565 from WT or mutated UL54 sequences with the insertion of a kanamycine resistance (Kan r ) gene flanked by FRT sites ( ). These clones (phbwt-kan or phbmut-kan, represented in E) contain full-length UL54 genes preceeded, at position -4, by Kan r and the two FRT sites. Expression of the FLP recombinase, in F, catalizes the site-specific recombination between FRT sites therefore resulting in the excision of Kan r, leaving a short 31-nt residual FRT motif ( ) at position -4. Additional note: All steps were carried-out in BW25141 (reca1) bacteria (25). Figure 2: Growth curves of selected recombinant mutants. Values presented for the inoculum were determined using a standard plaque assay. Values presented are the mean of two PCR-determined titers of virus yield in supernatant. Mutants not represented, including the double mutant N408D/L957F, had growth curves similar to the one presented for the WT recombinant virus (RvHBWT). 35

36 Figure 3: Structural analysis of HCMV DNA polymerase. A: The proposed backbone displacement of the homology 3D structure of the HCMV DNA polymerase is presented along with DNA template. The four colours represent the four TLS groups moving independently from one another during TLS simulation (blue: , green red and magenta ). The width of the strand indicates the predicted amplitude of movement. The proposed functional assignments to these groups are indicated. B: Model of the HCMV polymerase in editing mode with GCV, primer and template DNA. The predicted catalytic site is also indicated. Position of the mutations selected with GCV from the clinical isolate are indicated in blue whereas those selected from AD169 are in yellow. The backbone color pattern is the same as in A. C: Replicative model of HCMV polymerase with template and primer DNA, and dttps. Locations of the mutations selected with FOS are indicated in either red or blue to discriminate between the two patterns of emergence that were observed. The backbone color pattern is the same as in A. 36

37 Figure 1 A) UL54 promoter Tr L Ir L Ir S U S Tr S U L UL54 BAC phb5 UL54 conserved regions Phage λ (Gam, Bet, Exo) B) Tet r pspoldel insert Tetracycline selection Tet r C) UL54 conserved regions deleted from the HCMV/ BAC Tr L U L Ir L Ir S U S Tr S BAC phbul54del Tet r Phage λ (Gam, Bet, Exo) D) Ka n r pspoll-kan insert (WT or mutated ( ) UL 54) Kanamycine selection E) Ka n r F) FLP recombinase (collapse FRT sites) Tr L U L Ir L Ir S U S Tr S UL54 BAC phbwt or phbmut

38 Figure 2 Mutants selected with GCV-1 Mutants selected with GCV-2 Log 10 of virus yield in supernatant (genome copies/ml) Inoculum Day 4 WT Viruses AD169 RvHB5 RvHBWT Day 6 Day 8 Day 10 Days post-infection Day Inoculum Inoculum Day 4 Day 4 Day 6 Day 6 Day 8 Day 8 Day 10 Day 10 Day 12 Mutants selected with FOS-1 Day 12 RvHBWT RvHB488R RvHB539R RvHB787L RvHB862F 6 RvHBWT 5 RvHB408D 4 RvHB552N RvHB957F 3 RvHB408D/552N 2 RvHB552N/957F Inoculum Inoculum Day 4 Day 4 Day 6 Day 6 Day 8 Day 8 Day 10 Day 10 Day 12 Mutants selected with FOS-2 Day 12 RvHBWT RvHB545S RvHB812L RvHB829S RvHB545S/829S RvHBWT RvHB500N RvHB585A RvHB500N/585A

39 Figure 3 A) Exonuclease Domain N-terminal Region DNA Polymerase Domain F595 Predicted Catalytic Site T552 NH2-Domain B) Editing mode C) Polymerization mode C539 V812 P488 P829 S585 N757 V787 GCV L802 dttps L545 V946 N408 K500 L926 L957 Template DNA Primer DNA Primer DNA Template DNA