by Che-Pei Kung Chapel Hill

Transcription

1 The Epstein-Barr Virus Latent Membrane Protein 1 Regulates Gene Expression by Engaging Multiple Signaling Pathways by Che-Pei Kung A dissertation submitted to the faculty of the University of North Carolina at Chapel Hill in the partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Microbiology and Immunology Chapel Hill 2009 Approved by: Advisor: Nancy Raab-Traub, Ph.D. Reader: Albert S. Baldwin, Ph.D. Reader: Eng-Shang Huang, Ph.D. Reader: Blossom Damania, Ph.D. Reader: Dirk Dittmer, Ph.D.

2 ABSTRACT Che-Pei Kung: The Epstein-Barr Virus Latent Membrane Protein 1 Regulates Gene Expression by Engaging Multiple Signaling Pathways (Under the direction of Nancy Raab-Traub) Epstein-Barr virus (EBV) is a ubiquitous human gammaherpesvirus that is associated with a variety of human malignancies of lymphoid and epithelial origins, such as posttransplant lymphoproliferative disorder (PTLD), Burkitt s lymphoma (BL), Hodgkin disease (HL), nasopharyngeal carcinoma, and others. Latent membrane protein 1 (LMP1), which is expressed in latency type II and III, is considered the EBV oncoprotein due to its ability to transform rodent fibroblasts and its critical roles in EBV-mediated B cell transformation. Two major signaling domains of LMP1, carboxyl-terminal activating region (CTAR) 1 and 2, are responsible for the majority of LMP1-mediated signaling pathways. However, CTAR1 and CTAR2 induce distinctive signal transductions and only CTAR1 is essential for LMP1- mediated cell transformation. CTAR1 recruits TNFR-associated factors (TRAFs) to induce signaling pathways including PI3K/Akt, MEK/ERK, and complex NF-κB signaling. CTAR1 is also responsible for LMP1-regulated expression of cellular genes, such as epidermal growth factor receptor (EGFR). In this study, multiple signaling pathways engaged by LMP1 through CTAR1 to mediate EGFR upregulation were evaluated. LMP1 has been shown to induce EGFR expression by activating transcriptional active complex p50-homodimer/bcl-3. This study shows CTAR1 ii

3 also induces the expression of Bcl-3 through activating transcriptional regulator of Bcl-3, STAT3, and the STAT3 activation is required for CTAR1 s complete activity to induce EGFR expression. Using mouse embryonic fibroblasts (MEF) defective for different NF-κB effectors and TRAFs, we identified that CTAR1-mediated EGFR upregulation is dependent on NIK but not canonical or noncanonical NF-κB pathways. However NIK alone is not sufficient to induce EGFR expression, indicating that additional pathways are also needed. Consistent with previous studies, TRAF2 and TRAF3 but not TRAF6 are required for CTAR1-mediated EGFR induction. TRAF2 potentially contributes to EGFR induction by regulating p50 activation, and this activation is not mediated through the canonical or noncanonical NF-κB pathways. Both EGFR and STAT3 are activated by CTAR1 in a serum-independent manner, however, the CTAR1-activated EGFR can also activate STAT3 in response to EGF treatment and induce the expression of STAT3 target genes. CTAR1 was found to activate STAT3 through PKCδ, as inhibition of PKCδ by a chemical inhibitor reduced CTAR1-induced serine phosphorylation of STAT3 and Bcl-3 expression. These findings indicate that CTAR1 manipulates STAT3 signaling through multiple mechanisms. PKCδ was also shown to mediate CTAR1-induced ERK activation, and inhibition of PKCδ block CTAR1-mediated transformation of rodent fibroblast cells. These results suggest that CTAR1 induce EGFR expression by engaging multiple downstream signaling pathways that contribute to LMP1- mediated gene regulation. iii

4 To my parents and to Miin-Feng. iv

5 ACKNOWLEDGEMENTS First and foremost, I would like to thank my advisor, Dr. Nancy Raab-Traub, for her guidance over the past five years. I couldn t imagine having a more supportive and encouraging supervisor. I am confident to say that I made a great decision to join her lab, and I look forward to apply what I ve learned from her to my future scientific career. I would also like to thank my committee members, Dr. Blossom Damania, Dr. Dirk Dittmer, Dr. Albert Baldwin, and Dr. Eng-Shang Huang, for their suggestions and criticisms regarding my studies, as well as their support and time. The Raab-Traub lab is a great place to work not only because of the science, but also because of the people. Betsy Edwards is the perfect lab manager. I have been spoiled by the fact that if there is anything I need, Betsy is always there to make it happen. She is also a great listener who you always want to tell your jokes. To Dr. Natalie Thornburg for guiding me during my rotation. To George Ward, Kat Bendt, Dr. David Everly, Dr. Bernardo Mainou, and Dr. Cathy Siler for making me feel welcome when I first joined the lab. To Stephanie Mazzucca for reminding me that it is possible to be forever young in spirit. We have an outstanding group of postdocs from whom I have learned so much. Dr. Julie Fotheringham brings an unmatchable level of enthusiasm to the lab every day. She is also a great resource for scientific discussion and news around the entertainment world. Dr. Aron Marquitz is the expert of critical thinking. He shows me how to set a high standard for scientific research, and that is what I plan to follow for the rest of my career. My life in v

6 the lab would not have been the same without his sense of humor and those man s talks we ve shared over the years, including virtual basketball worlds and the Duke-UNC rivalry. Dr. Kathy Shair is a great scholar. I have no doubt that she will have a phenomenal scientific career ahead of her and that s what I also aspire to do because of her influence. The knowledge I learned from her, both for science and for life, will always be invaluable to me. The new member of the lab, Dr. David Meckes, has brought a new layer of expertise to an already excellent place. Our conversations as colleagues and desk-mates have generated new excitements which I enjoy a lot and hope to carry to my next destination. I would like to thank the student service manager, Dixie Flannery, for making my life in graduate school so much easier. To the former director of IBMS program, Dr. Sharon Milgram, for taking a chance on me as a graduate student. To Dr. Darrel Stafford in the Department of Biology for offering me a job as a technician at UNC. To my mentor back in Taiwan, Dr. Hwan-You Chang, for leading me into the world of microbiology and encouraging me to explore the opportunity of studying abroad. My family back in Taiwan, including my brother and my parents, is my rock. Leaving home so far away was the most difficult decision I have ever made in my life. Without their unconditional support, none of these would have been possible. For that, I am always in debt to them. To my wife Miin-Feng. She was my dearest friend and partner before our journey in America, and now she is my only family on this continent. I can t wait to move on to the next chapter of my life with her, knowing that she will always be there for me. Rain or shine. vi

7 TABLE OF CONTENTS LIST OF TABLES... x LIST OF FIGURES... xi LIST OF ABBREVIATIONS... xiii CHAPTER ONE: Introduction Epstein-Barr virus... 2 The Life Cycle of EBV... 3 Reverse Genetics with EBV Study... 6 Lytic Replication... 6 Immediate Early Genes... 7 Early Genes... 8 Late Genes... 9 Establishment of Latency... 9 LMP LMP2A and LMP2B EBNA EBNA EBNA-LP EBNA3A, 3B, 3C EBERs BARTs EBV and micrornas vii

8 EBV-Associated Diseases and Malignancies Infectious Mononucleosis Chronic Active EBV Infection Oral Hairy Leukoplakia Virus Associated Hemophagocytic Syndrome X-Linked Lymphoproliferative Syndrome Post-Transplant Lymphoproliferative Disorder Gastric Carcinoma Multiple Sclerosis Burkitt s Lymphoma Hodgkin Lymphoma Nasopharyngeal Carcinoma Therapeutic Approaches EBV Vaccines Epidermal Growth Factor Receptor in NPC OBJECTIVES REFERENCES CHAPTER TWO: Epstein-Barr Virus Latent Membrane Protein 1 Induces Expression of the Epidermal Growth Factor Receptor Through Effects on Bcl-3 and STAT3 ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION ACKNOWLEDGEMENTS viii

9 REFERENCES CHAPTER THREE: LMP1 modulates distinctive NF-κB pathways through CTAR1 to regulate EGFR expression ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION ACKNOWLEDGEMENTS REFERENCES CHAPTER FOUR: EBV Latent Membrane Protein 1 (LMP1) Activates STAT3 and ERK through effects on EGFR and PKCδ ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION ACKNOWLEDGEMENTS REFERENCES CHAPTER FIVE: General Conclusions REFERENCES ix

10 LIST OF TABLES CHAPTER ONE Table 1: Gene Expression patterns of different types of EBV latency and EBV-related malignancies associated with each latency type CHAPTER FOUR Table 1: Quantitative RT-PCR primers x

11 LIST OF FIGURES CHAPTER ONE Figure 1: EBV life cycle... 5 Figure 2: LMP1-associated signaling pathways CHAPTER TWO Figure 1: CTAR1 of LMP1upregulates EGFR mrna levels Figure 2: CTAR1 of LMP1 upregulates Bcl-3 and induces nuclear translocation of Bcl-3 and p Figure 3: CTAR1 of LMP1 upregulates Bcl-3 and EGFR by activating STAT Figure 4: IL-6 production in C33A cells Figure 5: LMP1 CTAR1 induces binding of STAT3 to Bcl-3 promoter and intronic Enhancers Figure 6: A working model for LMP1 CTAR1-mediated induction of Bcl-3 and, consequently, EGFR CHAPTER THREE Figure 1. EBV LMP1-CTAR1 mediates mild induction of EGFR expression in mouse embryonic fibroblast (MEF) cells Figure 2. LMP1-mediated EGFR upregulation is NIK-dependent Figure 3. Blocking NIK reduces LMP1-induced EGFR expression, but overexpression of NIK is not sufficient to mimic LMP1-mediated EGFR upregulation Figure 4. CTAR1-mediated p50 activation is not dependent on canonical or noncanonical pathway Figure 5. CTAR1 mediates p50 activation through proteasome-dependent pathways Figure 6. LMP1-mediated EGFR upregulation is TRAF2- and TRAF3-, but not TRAF6-Dependent xi

12 CHAPTER FOUR Figure 1. LMP1-CTAR1 activates EGFR and STAT3 independent of serum, and CTAR1-induced EGFR further activates STAT3 in response to EGF treatment Figure 2. mrna expression of EGFR ligands in CTAR1 cells Figure 3. Expression level of STAT3 target genes in EGF-treated CTAR1 -expressing C33A cells Figure 4. LMP1-induced serine phosphorylation of STAT3 is PKCδ-dependent Figure 5. PKCδ inhibitor, Rottlerin, inhibited CTAR1-induced focus formation Figure 6. Tyrosine-311 phosphorylation of PKCδ is elevated in CTAR1 C33A cells CHAPTER FIVE Figure 1. CTAR1-mediated signaling pathways for EGFR upregulation xii

13 LISTS OF ABBREVIATIONS AIDS Acquired immune deficiency syndrome ATF5 Activating transcription factor 5 BART BCR BL CDK ChIP CNS Csk BamHIA rightward transcript B cell receptor Burkitt s lymphoma Cyclin dependent kinase Chromatin-immunoprecipitation Central nervous system Carboxy-terminal Src kinase CTAR1 Carboxy-terminal activating region 1 CTAR2 Carboxy-terminal activating region 2 CXCL CXCR CYLD DMSO DN DNA DNMT DTT EBER CXC chemokine ligand CXC chemokine Receptor Cylindromatosis Dimethyl sulfoxide Dominant negative Deoxyribonucleic acid DNA methyltransferase Dithiothreitol Epstein-Barr virus encoded RNA xiii

14 EBNA EBNA-LP EBV EGF EGFR EMSA EREG ERK GAC GC gp GRP78 Epstein-Barr virus nuclear antigen EBV-encoded nuclear antigen leader protein Epstein-Barr virus Epidermal growth factor Epidermal growth factor receptor Electrophoretic mobility shift assay Epiregulin Extracellular signal regulated kinase Gastric carcinoma Germinal center Glycoprotein Glucose-regulated stress protein GSK3 Glycogen synthase kinase 3 HA HBEGF HBV HCMV HDAC Hdm2 HHV HIV HL Hemagglutinin Heparin-bound epidermal growth factor Hepatitis B virus Human cytomegalovirus Histone deacetylase Human double minute Human herpesvirus Human immune deficiency virus Hodgkin lymphoma xiv

15 HLA HOXA10 HPS HRS HS IκB Id IE IFN Ig Human leukocyte antigen Homeobox A10 Haemophagocytic syndrome Hodgkin and Reed-Sternberg Hypersensitive site Inhibitor of NF-κB Inhibitor of differentiation Immediate early Interferon Immunoglobulin IGF-1 Insulin like growth factor 1 IKK IL IM IR I-TAC ITAM JAK JNK KSHV LCV LD IκB kinase Interleukin Infectious mononucleosis Internal repeats Interferon-inducible T cell alpha chemoattractant Immunoreceptor tyrosine based activation motif Janus kinase c-jun N-terminal kinase Kaposi s sarcoma-associated herpesvirus Lymphocryptovirus Lymphocyte-depleted xv

16 LMP LCL MAPK MC MDM2 MEF MEK MHC MICB MIG MIP-2 mirna MMP MS NF-κB NIK NK cell NotchIC NPC NS OHL PAGE Latent membrane protein Lymphoblastoid cell line Mitogen-activated protein kinase Mixed cellularity Murine double minute Mouse embryonic fibroblast Mitogen-activated ERK kinase Major histocompatibility complex MHC class I polypeptide-related sequence B Monokine induced by the interferon-gamma Macrophage inflammatory protein-2 MicroRNA Matrix metalloproteinase Multiple Sclerosis Nuclear factor-kappa B NF-κB inducing kinase Natural killer cell Notch intracellular domain Nasopharyngeal carcinoma Nodular sclerosing Oral hairy leukoplakia Polyacrylamide gel electrophoresis xvi

17 PARP PBMC PBS PCR PI3K PKC PKR PP2A pss PTEN PTLD PUMA QRT-PCR RA RACK RASSF Rb RBPJκ RIP RIPA RNA RNAi Poly(ADP)-Ribose Polymerase Peripheral blood mononuclear cells Phosphate buffered saline Polymerase chain reaction Phosphatidylinositol-3 kinase Protein kinase c Protein kinase r Protein phosphatase 2A Primary Sjögren s syndrome phosphatase and tensin homolog Post-transplant lymphoproliferative disorder p53 upregulated modulator of apoptosis Quantitative real time PCR Rheumatoid arthritis Receptor for activated protein kinase C RAS association domain family protein Retinoblastoma protein Recombination signal-binding protein 1 for J-kappa Receptor interacting protein Radioimmunoprecipitation assay Ribonucleic acid RNA interference xvii

18 RT-PCR SAP SDS SLE STAT TCL1 TFs TGF-β Th1 TNF-α TNFR TPA TR TRADD TRAF WHO XIAP XLP Reverse transcriptase PCR Signals for lymphocyte activation molecule-associated protein Sodium dodecyl sulfate Systemic lupus erythematosus Signal transducers and activators of transcription T-cell leukemia-1 Transcription factors Transforming growth factor beta Type 1 T helper cell Tumor necrosis factor-alpha Tumor necrosis factor receptor Phorbol diester 12-O-tetradecanoylphorbol 13-acetate Terminal repeats TNF receptor-associated death domain TNF receptor-associated factor World Health Organization X-linked inhibitor-of-apoptosis X-linked lymphoproliferative syndrome xviii

19 CHAPTER ONE Introduction

20 Epstein-Barr Virus A novel extranodal lymphoma occurring in children was identified in the 1940s by Denis Burkitt in equatorial Africa where malaria was endemic (33-35, 54). Denis Burkitt referred to this disease as African Lymphoma (currently called Burkitt s lymphoma) and postulated that there may be an infectious agent involved due to the atypical epidemiological and clinical features of the disease. Epstein-Barr virus was discovered in 1964 by Anthony Epstein, Yvonne Barr, and Bert Achong in electron micrographs of the cells cultured from the tumor specimens provided by Denis Burkitt. They revealed a herpesvirus-like particle that did not react to antibodies from other known herpesviruses and did not replicate in cultured cells (79). EBV, originally known as human herpesvirus 4 (HHV4), is a prototype member of the gamma herpesvirus subfamily and belongs to the lymphocryptovirus (LCV; gamma 1) genus (190). EBV is an enveloped virus with a linear double-stranded DNA genome of more than 180 kilobase pairs in length (17, 59, 310, 313). EBV and most LCVs share four characteristic features to their genomes: Single overall format and gene rearrangement, Tandem and reiterated direct repeats at both termini (TR), six to twelve tandem and reiterated direct internal repeats (IR1), as well as short and long unique sequence domains (U S and U L ) that contain the most of the viral coding capacity (46, 47, 107, 108). Gamma herpesviruses are lymphotropic, generally replicate in B or T cells, and have a relatively limited range of hosts. Similarly, EBV can infect B lymphocytes to establish lifetime persistence while retain the ability to undergo productive replication in its only natural host, humans (190). EBV is a ubiquitous infectious agent that more than 90% of the world adult population is infected with EBV (190). EBV infection during the childhood is 2

21 normally asymptomatic and does not cause diseases. However, delayed infection in adolescence may cause infectious mononucleosis (IM) and in individuals like immunocompromised patients EBV infection is associated with pathological conditions, including the development of cancer (190). One defining biological property of EBV is its ability to transform resting B cells in vitro into lymphoblastoid cell lines (LCLs) (190). EBV is also capable of infecting epithelial cells in vitro and in vivo and is associated with cancers of epithelial origins (190, 212, 358). It has also been reported that EBV can infect cell types other than B cells and epithelial cells, such as T cells, natural killer (NK) cells, monocytes, and neutrophils (116, 155, 337). The Life Cycle of EBV A schematic illustration of the EBV life cycle is shown in Figure 1. EBV is normally transmitted through saliva that contains both cell-free virus and EBV-infected cells that eventually lead to the infection of oral epithelial cells (321). The mechanism by which EBV infects the oral epithelium is still not well understood, although one early study suggested that EBV infection begins with the fusion of EBV-infected B cells to epithelial targets (21). This model is supported by the observation that infection of epithelial cells is more efficient when in close proximity with EBV-producing B cells than with cell-free virus (153, 391). Infection of the oral epithelium leads to production of progeny virions through lytic replication (204, 205, 357). Oral epithelium-released virions infect naïve B cells circulating near the oral epithelium or in lymphoid organs (255, 278). Interestingly, EBV infects naïve and memory B cells at similar efficiency in vitro (429). 3

22 EBV infects B cells through the binding of gp350/220 to cell-surface receptor CD21 to initiate endocytosis into the host cells, as well as the binding of gp42 to class II human leukocyte antigen (HLA, also called major histocompatibility complex or MHC) as a coreceptor (87, 211, 274, 372). Attachment of EBV to B cells leads to viral fusion with the endosomal membrane at a low ph (249). However, whether CD21 plays a role in EBV infection of epithelial cells remains to be determined, indicating that different mechanisms may be required for EBV binding and entry of epithelial cells. It has been shown that EBV needs gh and gl to bind to several epithelial cell lines, but the participating receptors have not yet been identified (256, 284). Recently it has been reported that EBV glycoprotein BMRF2 interacts with integrin α5β1 and the binding can be blocked by antibodies against integrin or BMRF2 (391). Moreover, endocytosis is not required in EBV infection of epithelial cells, and fusion occurs at neutral ph (249). Interestingly, cell tropism of EBV infection can be modified depending on the cell types in which the virus is produced. Virions that are made in HLA-class-II-positive B cells are depleted of gp42, and therefore target HLA-class-II-negative epithelial cells more effectively than B cells. Conversely, virions produced in epithelial cells can infect B cells more effectively (391). Once viral entry is complete, the EBV genome circularizes to form a viral episome in the B cells and initiates a limited latency program through transcription from the viral Wp promoter using cellular RNA polymerase II (150, 336). Activation of Wp promoter in resting naïve B cells leads to expression of EBNA2, which then turn on a growth program (similar to type III latency described below) which activates the Cp promoter to initiate B cell proliferation (377, 415). These B cells can undergo germinal center (GC) differentiation and become memory B cells (377). Lifetime viral persistency is established and most viral 4

23 EBV Saliva Amplification Oral epithelium Amplification Naïve B cell Type III programme Plasma Cell Germinal Center Terminal differentiation Type II programme Memory B cell Type 0 programme Type I programme Figure 1. EBV Life Cycle. EBV infects the oral epithelium through saliva contact. Lytic infection in the oral epithelium leads to amplification of progeny EBVs, which then infect naïve B cells in the surrounding lymphoid tissues and drive their proliferation and growth. The infected B cells then undergo germinal center differentiation to become memory B cells. Most viral protein expression is turned off at this point, except for dividing memory B cells, which express EBNA1. Persistently-infected memory B cells occasionally undergo differentiation to become plasma cells, where viral reactivation takes place. Released virus may re-infect other B cells or be shed into saliva for spread to other hosts. (Adapted from (379)) 5

24 proteins are not expressed (375). Persistently infected memory B cells occasionally undergo plasma-cell differentiation which triggers viral reactivation (14, 24, 201, 365). The newly released virus can be shed into saliva for spread to other hosts or for infection of surrounding B cells and epithelial cells. Reverse Genetics with EBV study Studies with genetic manipulations of EBV have been hindered due to the limited host range of EBV and the lack of permissiveness for EBV replication in most cell lines. Several approaches have been tried to conduct reverse genetic studies of EBV. By transfecting latently infected lymphocytes with mutated EBV DNA fragments cloned in Escherichia coli, recombinant EBV can be made following lytic program induction and homologous recombination (244, 402). Alternatively, a latently infected cell line with replication-competent EBV strain, P3HR1, has been used as the parental strain for homologous recombination following transfection of mutated EBV DNA fragments (383). A system using bacterial artificial chromosome (BAC) to produce recombinant EBV has also been developed to aid the genetic studies of EBV (63, 171). Lytic Replication Due to the availability of cell lines latently infected with EBV and the lack of good genetic tools for EBV primary infection, EBV lytic replication is normally studied by inducing the reactivation of EBV in latently infected cells. Since infection of epithelial cells in vitro does not achieve full lytic replication, transformed B cells remains the dominant model of infection (429). In vitro studies have focused on using phorbol esters (TPA) to 6

25 induce lytic replication through activating protein kinase c (PKC) pathway, which induces transcription of EBV immediate early genes including BZLF1 (10, 91). The lytic program can also be induced by activating the B cell receptors using soluble immunoglobulin (371). Induction of lytic replication results in the production of infectious virus following cytopathic effects on infected cells, such as marginization of heterochromatin, inhibition of host macromolecule synthesis, assembly of nucleocapsids, and envelopment of virions through the inner nuclear membrane (104, 179, 190, 337). Like other herpesviruses, EBV lytic replication follows a temporal and sequential order and production of lytic genes can be divided into three categories, immediate early (IE), early, and late gene expressions (371). Immediate Early Genes BZLF1 (also called Zta or ZEBRA) and BRLF1 (also called Rta) are EBV immediate early genes because of their expression in the presence of protein synthesis inhibitors, such as cycloheximide. BZLF1 and BRLF1 are located in the cell nucleus and function as transcriptional regulators to initiate and promote lytic infection (113, 122, 315, 362, 371). BRLF1 and BZLF1 have both been shown to transactivate early gene promoters and also to be required for efficient viral DNA replication (31, 48, 89, 92, 122, 142, 185, 339). Moreover, expression of either BZLF1 or BRLF1 during latency will result in the induction of the other to drive the virus into the lytic cycle (92, 223, 315). Uniquely, BZLF1 preferentially binds to methylated-forms of promoters of BRLF1 and other viral genes (25, 67). During the transition from latent to lytic cycle, BZLF1 also ensures the successful switch by inhibiting the activity of Cp promoter which regulates the expression of latencyassociated EBNA genes (186). 7

26 Interaction between BZLF1 and the NF-κB subunit, p65, has been identified and it s believed that they mutually inhibit each other s transcriptional activity depending on the stages of EBV infection (117, 262). Furthermore, BZLF1 prevents an EBV-stimulated immune response by downregulating CIITA, tumor necrosis factor receptor 1 (TNFR1), and interferon gamma receptor. BZLF1 also promotes B-cell proliferation by inducing IL-13 (209, 263, 264, 387). Interestingly, it has been recently reported that in AIDS-associated primary effusion lymphoma (PEL) co-infected with Kaposi s sarcoma-associated herpesvirus (KSHV) and EBV, lytic replication initiators for both viruses, K-RTA (KSHV) and BZLF1 (EBV), inhibits each other s transcriptional activity (165). This mutual inhibition may be important for maintaining viral latency in dually infected cells. Recently it has been shown that BRLF1 induces the expression of decoy receptor 3 (DcR3), which is also upregulated by EBV LMP1 (140, 141). The upregulation of DcR3 may contribute to evade immune surveillance and promote cell migration and invasion. Early Genes The expression of EBV early genes is dependent on active protein synthesis but not on viral replication. EBV-encoded early genes are involved with several early events during EBV infection, including viral gene transcription and DNA replication (90). For example, EBV DNA polymerase BALF5 is responsible for EBV genome replication during the lytic cycle and its activity is dependent on another early gene, BMRF1, which encodes the DNA polymerase processivity factor (142, 218). Another EBV early gene, BHRF1, has been identified as a viral homolog of cellular Bcl-2 both sequence-wise and functionally (125). Cellular Bcl-2 protects cells from programmed cell death and activation of Bcl-2 by 8

27 chromosomal translocation is characteristic of human follicular lymphomas (389, 390). Therefore, it has been suggested that BHRF1 may function similarly to protect EBV-infected cells from apoptosis during the viral life cycle. Notably, BHRF1 has been recently shown to be also expressed in EBV-transformed B cells and BHRF1 may contribute to B cell transformation by providing resistance to apoptosis (182). Interestingly, another EBV early gene detected in lytic cycle, BARF1, is also expressed during type II EBV latency (NPC and GC) and has been shown to possess tumorigenic potentials (62, 350, 441). Late Genes The last subset of genes expressed during the lytic cycle after viral DNA synthesis, usually referred to as late genes, encode viral structural components including tegument proteins and glycoproteins (236, 376). EBV late genes BLLF1 and BZLF2 encoded EBV glycoproteins gp350/220 and gp42, respectively (87, 211). Both gp350/220 and gp42 are important for viral entry of EBV into B cells as described previously. Due to its critical role in EBV infection, gp350 has served as a prime candidate for the development of EBV vaccines (225, 360). BCRF1 encodes a viral homolog of IL-10 and it has been shown that BCRF1 negatively regulates the host immune response, similar to cellular IL-10, by inhibiting activities of T cells, NK cell, and macrophage function (146, 257, 334, 367). Establishment of Latency Types of EBV latency are defined by the expression of specific subsets of EBV latent genes, including six EBV-encoded nuclear antigens (EBNAs 1, 2, 3A, 3B, 3C, and LP), three latent membrane proteins (LMPs 1, 2A, and 2B), small non-polyadenylated RNAs (EBER1 9

28 and EBER2), and a group of spliced 3 transcripts known as BamHIA rightward transcripts or BARTs (190, 429). Genes expressed in certain types of latency, as well as associated diseases, are summarized in Table 1. In type I latency of EBV infection, with Burkitt s lymphoma as the classical example, only EBNA1 is expressed at the protein level along with transcripts for the BARTs and EBERs. Type 0 latency is referred to the cell state where infected resting memory B cells do not express EBNA1 before cells undergo cell-division. During type II latency, major EBV oncoproteins like LMP1, LMP2A, and LMP2B are expressed in addition to EBNA1 as well as the transcripts of BARTs and EBERs. Type II latency is normally seen in EBV-associated Hodgkin disease and EBV-associated diseases of epithelial origins, such as nasopharyngeal carcinoma and gastric carcinoma. In type III latency, expression of most EBV latent genes can be detected, including all EBNAs, LMPs, EBERs, as well as of BARTs. Typical examples of type III latency include EBV-generated LCLs in vitro and post-transplant lymphoproliferative disorders (PTLDs) (30). Latency Type EBV Genes Expressed Associated Malignancies Type I EBNA1, BARTs, EBERs Burkitt s Lymphoma Type II EBNA1, BARTs, EBERs, LMP1, LMP2A and 2B, +/- BARF1 Hodgkin Disease, Nasopharyngeal Carcinoma, Gastric Carcinoma Type III EBNA1, 2, 3A, 3B, 3C, and LP, BARTs, EBERs, LMP1, LMP2A and 2B. Lymphoblastoid Cell Lines, Post-transplant Lymphoproliferative Disorder Table 1. Gene Expression pattern of different types of EBV latency and EBVrelated malignancies associated with each latency type. LMP1 EBV latent membrane protein 1 (LMP1) is expressed in latency type II and III. LMP1 is the EBV major oncogene since it is essential for EBV-mediated B-cell transformation and LMP1 alone can transform rodent fibroblasts in vitro (180, 401). LMP1 10

29 expression in epithelial cells can significantly affect cell growth, morphological transformation, and inhibit cell differentiation (60, 82). Moreover, LMP1 expression in mouse models can cause hyperplasia and B cell lymphomas (197, 414). LMP1 is an integral membrane protein which has 386 amino acids and encodes a 63kDa protein product. LMP1 can be basically divided into three domains: first, the N-terminal cytoplasmic tail (aa 1-23), which is responsible for the orientation of LMP1; Second, six transmembrane domains (aa ), which are involved in self aggregation and oligomerization; third, the long C- terminal cytoplasmic tail (aa ), which is responsible to mediate most of LMP1 s signaling activities (429). In latently infected B cells, LMP1 mrna is more abundant than EBNA mrnas despite being regulated by a weak promoter (85). Transcription of LMP1 is regulated through multiple TATA-less sites in the first terminal repeat (TR) to result in a transcript with a long 5 untranslated region (105, 330). The half-life of LMP1 is less than two hours and post-translational modifications of LMP1 include phosphorylation of multiple serine and threonine, but not tyrosine, residues (18, 242, 258). It has been shown that LMP1 associates with cytoplasmic cytoskeleton and also incorporates in cholesterol-rich lipid rafts on the cell membrane (131, 215, 245). Although most studies of LMP1 focus on its function in the plasma membrane, only half of the cellular LMP1 is found in the plasma membrane, indicating that LMP1 s function may be regulated by its cellular localization (216, 241). Interestingly, a variety of LMP1 sequence variants have been identified and it seems they arise from the onset of primary infection. These sequence variants appear to associate with compartmentalization (e.g. oral cavity, peripheral blood, or NPC tumors) and could potentially provide cell growth advantages (72, 73, 252, 354, 355). 11

30 LMP1 functions as a constitutively active tumor necrosis factor receptor (TNFR) by associating with tumor necrosis factor receptors-associated factors (TRAFs) (160, 250, 265). LMP1 is functionally similar to another TNFR member, CD40, and can partially substitute for CD40 in B cells (392). A myriad of signaling pathways have been shown to be activated by LMP1, including mitogen-activated protein kinase (MAPK), c-jun N-terminal kinase (JNK), phosphatidylinositol 3-kinase (PI3K)-Akt, and NF-κB pathways (77, 239, 290, 320). In order to control cell cycle progression, cell proliferation, and migration, LMP1 regulates transcriptional expression of many cellular genes, including EGFR, Bcl-2, A20, inhibitor of differentiation (Id) 1 and 3, p27, and plakoglobin, (81, 93, 126, 251, 345). LMP1 has two major signaling domains in its c-terminal tail, carboxyl-terminal activating regions 1 and 2 (CTAR1 and CTAR2), which mediate LMP1-associated signaling pathways through recruiting different set of TRAFs. CTAR1 recruits TRAF1/2/3/5 through a TRAF-binding PxQxT motif at aa (PQQAT), whereas CTAR2 recruits TRAF2 and TRAF6 through TNFR-associated death domain (TRADD), the receptor interacting protein (RIP), and BS69 (159, 361). CTAR1 and CTAR2 have different effects on LMP1-mediated signaling and cellular transformation, possibly due to their distinctive TRAF binding patterns. CTAR1 induces MAPK, PI3K/Akt/GSK3β signaling, while CTAR2 activates JNK pathway (76, 239, 240). CTAR2 can strongly activate canonical NF-κB signals, while CTAR1 weakly induces NF-κB signalings including canonical, noncanonical, and atypical pathways (232, 250). Interestingly, it has been reported that expression of LMP1 can be regulated by NF-κB (65, 168). Furthermore, CTAR1 is essential for LMP1-mediated transformation of B-lymphocyte and rodent fibroblast, while CTAR2 is dispensable (160, 239). CTAR1 also has unique 12

31 LMP1 Plakoglobin TRAFs 1,2,3,5 PI3K MAPKK Akt GSK3β TRAF2/6 BS69 TRADD NF-κB Id1, Id3 ERK MAPKK Canonical Noncanonical Atypical p27 CDK2 IKKγ IKKβ IKKα NIK p50/p50 Rb JNK IKKα IκBα EGFR p65 p100 p65/p50 p52/p50 p52/p65 p52/relb Figure 2. LMP1-associated signaling pathways. CTAR1 associates with TRAF1, 2, 3, a nd 5 and activates a variety of signaling pathways, including PI3K/Akt/GSK3β, MAPKK/ERK, and NF-κB pathways. CTAR1 also regulates expression of proteins involved with proliferation and cell cycle regulation, including Id1/Id3, p27, Rb, and EGFR among others. C TAR2 recruits TRAF2 and 6 through TRADD and BS69, followed by activation of JNK and canonical NF-κB pathway. Full-length LMP1 is required for the inhibition of plakoglobin, as well as the initiation of the cadherin switch. 13

32 effects on regulating cellular gene expression in induction of EGFR, TRAF1, EBI3, Id1, and Id3, as well as the repression of p27 (66, 81, 250). It has been reported that LMP1 downregulates E-cadherin gene expression via activation of DNA methyltransferases to induce cell migration (386). More recent studies revealed that in addition to downregulation of E-cadherin, LMP1 contributes to cell migration and NPC metastasis by downregulating junctional protein plakoglobin and initiating a cadherin switch in LMP1-expressing epithelial cells (345, 346). A schematic illustration of the LMP1-associated signaling pathways is shown in Figure 2. LMP2A and LMP2B LMP2A and LMP2B are two EBV integral membrane proteins. LMP2A and LMP2B share similar structural features, with 12 transmembrane domains and a 27-amino-acid cytoplasmic C-terminus (429). LMP2A has an extra 119-amino-acid cytoplasmic N- terminus that contains an immunoreceptor-tyrosine activation motif (ITAM) and a phosphotyrosine (PY) motif. The LMP2s are expressed in type II and type III latency, however they are not required for EBV-mediated B-cell transformation (226, 227). LMP2- mutant EBV-infected cells undergo normal lytic replication upon viral reactivation (192, 228). B-cell-targeted expression of LMP2A in transgenic mice can abrogate normal B-cell development by mimicking the signaling mediated by B-cell receptor (BCR), resulting in colonization of Ig-negative cells in peripheral lymphoid organs (39). LMP2A can also transform epithelial cells and induce cell adhesion and migration, as well as inhibit cell differentiation (340). These results suggest that LMP2A potentially contribute to EBVassociated tumorigenesis. The function of LMP2B is not well understood, but recent studies 14

33 have suggested that LMP2B negatively regulates the function of LMP2A, one of which is to prevent the switch from latent to lytic EBV replication (317, 326). LMP2A blocks BCR signaling by sequestering the Src family of tyrosine kinases and the Syk tyrosine kinase through activated ITAM motif, in which Tyr74 and Tyr85 are phosphorylated (32, 94). Lyn tyrosine kinase can be recruited to a membrane-proximal tyrosine residue Tyr112 and mediate phosphorylation of other tyrosine residues of LMP2A (95). Interestingly, LMP2A can be phosphorylated by Csk in epithelial cells instead of Src kinase (341). LMP2A also recruits NEDD4-like ubiquitin protein ligases, such as AIP4, WWP2, and Nedd4, through the PY motif to promote the degradation of Lyn and LMP2A, providing another mechanism for regulation of BCR signaling (151). LMP2A also contributes to cell transformation by actively activating several signaling pathways, including PI3K/Akt/GSK3β, MAPKK/ERK/JUN, and Wnt/β-catenin pathways (45, 260, 261, 340). LMP2A has been found to induce expression of a variety of genes that are involved with cell cycle progression, inhibition of apoptosis, and evasion of immune response, indicating LMP2A s role in EBV-associated tumorigenesis through transcriptional regulation (429). Interestingly, the transcriptional profiles of LMP2A-expressing B cells or LMP2A transgenic mice have been reported to resemble those observed in malignant Hodgkin and Reed Sternberg (HRS) cells of Hodgkin disease or germinal center B cells, indicating the roles of LMP2A in vivo (307, 308). A recent study has shown that LMP2A can also cause epigenetic abnormality in gastric carcinoma cell line by inducing STAT3-dependent DNA methyltransferase 1 (DNMT1) upregulation to decrease transcription of PTEN through promoter methylation (135). 15

34 EBNA1 EBV-encoded nuclear antigen 1 (EBNA1) is expressed in all types of EBV latency. The two main functions of EBNA1 are to maintain the episomal EBV genome and to regulate transcription of viral genes. Through binding to the plasmid origin of viral replication, OriP, EBNA1 tethers the viral episome to chromosomes in dividing cells to ensure that every daughter cell retains the viral episome after mitosis (285, 424, 425). Recent studies have suggested that EBNA1 binds to OriP through RNA-dependent mechanisms (282, 283). EBNA1 contributes to transcriptional regulation by binding to the promoters controlling viral latent genes, including EBNAs and LMP1, in a zinc-dependent manner (6, 11, 97). An internal Gly-Ala repeat sequence between the amino- and carboxyl-terminus of EBNA1 stabilizes EBNA1 by preventing its proteasome-mediated degradation (206, 207). This block of proteasome-mediated degradation and processing of EBNA1 may also contribute to the lack of immune response elicited by EBNA1 expression in EBV-infected cells (385). The oncogenic potential of EBNA1 is still under debate. Although it has been shown that EBNA1 is not essential for EBV to establish LCLs, EBNA1 does seem to provide certain survival signals to EBV-associated Burkitt s lymphomas (149, 183). Moreover, EBNA1 s ability to cause cancer in transgenic mouse models has been inconsistent, with various results observed among mice with different genetic backgrounds (174, 175, 413). EBNA2 Expressed in type III latency, EBNA2 is considered essential for EBV-mediated B cell transformation initially from studying the lack of transforming ability of EBNA2- deficient EBV strain P3HR-1 (56). EBNA2 contributes to EBV-mediated transformation by 16

35 regulating transcription of both cellular and viral genes, such as CD21, CD23, BATF, LMP1, and LMP2A (2, 57, 114, 167). The transactivating function of EBNA2 is mediated through its ability to interact with downstream target of Notch, Jκ-recombination-binding protein (RBP-Jκ), and abolish RBP-Jκ-mediated transcriptional repression (114, 145, 332, 438). Other than Notch, EBNA2 has also been suggested to regulate signaling pathways mediated by other transcriptional factors, such as STAT3 (269). EBNA-LP EBV-encoded nuclear antigen leader protein (EBNA-LP) is not essential for EBVmediated transformation but is important for the outgrowth of EBV-transformed B cells (56, 243, 353). The main function identified so far for EBNA-LP is that it interacts with the acid activation domain of EBNA2 and cooperate with EBNA2 in RBP-Jκ-mediated transcriptional activation of cellular and viral genes (120, 281). Moreover, it has been shown that EBNA- LP s activity may be mediated through the interaction with Sp100 (222). Three evolutionarily conserved regions of EBNA-LP are important for its nuclear translocation and functions, and EBNA-LP interacts with the tumor suppressor genes p53 and retinoblastoma (Rb) (299, 368). EBNA-LP also binds the anti-apoptotic protein Bcl-2 and its EBV counterpart BHRF1, indicating that it regulates apoptosis in EBV-infected cells (247). Interestingly, a recent study showed that a truncated form of EBNA-LP is expressed in some BL cells infected with EBV strains defective for EBNA2. The truncated EBNA-LP induced resistance to caspase-mediated apoptosis through its interaction and sequestration of phosphatase 2A (PP2A) (101). These findings further suggest that in addition to cooperating 17

36 with EBNA2, EBNA-LP has independent functions to contribute to EBV-mediated transformation. EBNA3A, EBNA3B, EBNA3C Similar to EBNA2 and EBNA-LP, EBNA3s are only expressed in type III latency of EBV infections. In vitro infections using recombinant EBV have shown that EBNA3A and EBNA3C are essential for EBV-mediated B cell transformation but EBNA3B is dispensable (382, 383). The EBNA3s repress EBNA2/EBNA-LP-mediated RBP-Jκ transactivation through competing for binding with RBP-Jκ (166, 322, 400, 435). EBNA3A has been shown to repress the EBV Cp promoter in both epithelial and B cells (53). The roles of EBNA3B in EBV infection is unclear since it s not required for EBV-mediated transformation, but it may be important for maintaining viral latency by regulating chemokine receptor CXCR4 (43). In cooperating with RAS, EBNA3C can disrupt cell cycle checkpoints and transform rodent embryonic fibroblast (292, 293). The transforming activity of EBNA3C may reflect its ability to interact with cellular proteins that modulate gene transcription and apoptosis, such as histone deacetylase 1 (HDAC1), p53, Rb, and cyclin A (195, 292, 314, 426). Despite the aforementioned negative effects on EBNA2, EBNA3C can also induce LMP1 transcription in conjunction with EBNA2 (436). A recent study reported that EBNA3A and EBNA3C cooperatively regulate BL pathogenesis through downregulation of the pro-apoptotic tumor suppressor gene Bim (9). EBERs 18

37 EBER1 and EBER2 are two small nonpolyadenylated, non-coding, RNAs that are expressed in all types of EBV latency and thus serve as good targets for detection of EBV infection using in situ hybridization (118, 144). Although the EBERs are not essential for EBV-mediated B-cell transformation, they are shown to be able to enhance the tumorigenic potential of B cells in cell culture and in immunodeficient mice by preventing apoptosis (196, 329, 423). Similarly, overexpression of EBERs can also increase the resistance of NPC cell lines to apoptosis (273, 416). A recent study suggests that despite their structural similarities, EBER2 contributes to B-cell transformation more significantly than EBER1 (417). The effects of the EBERs on apoptosis may be due to its ability to assemble into ribonucleoprotein complexes and bind with double-stranded RNA-activated protein kinase PKR (272, 370). PKR has been known to induce pro-apoptotic pathways (68). By binding and inhibiting PKR activity, EBERs may increase the tumor cell s resistance to apoptosis, and promote viral persistence (272, 348). However, this hypothesis has been recently challenged by a study which showed that EBERs are not able to block PKR-induced protein phosphorylation mediated by interferon (328). This result argues that EBER-mediated inhibition of apoptosis is not due to direct interaction with PKR. EBERs may also provide anti-apoptotic signals by inducing the expression of anti-apoptotic factor Bcl-2, and contribute to tumorigenesis by inducing expression of pro-proliferative factors, such as IL-10 in B cells and insulin-like growth factor 1 (IGF-1) in EBV-associated NPC or gastric carcinoma (157, 158, 194, 196). Due to their status as the most abundant transcripts in EBV-infected cells, a recent study has taken advantage of this fact to develop shrna fusion transcripts controlled by the EBERs promoter (49). SiRNAs processed from these fusion transcripts exhibit stronger 19

38 efficiency of knocking down target genes without activating double-stranded RNAdependent protein kinase activity. This strategy may be used for more effective gene therapy, especially in EBV-infected cells. BARTs BamHIA rightward transcripts (BARTs) are a group of abundantly expressed RNAs that are highly spliced and encoded by the BamHIA region of the EBV genome (331, 359). The BARTs were first identified and characterized in NPC and were shown to be highly abundant compared to transformed lymphocytes (44, 138, 177, 331). However, using partially-deleted EBV cosmid recombinants, the BARTs were shown to not required for EBV-mediated latent infection or B-cell transformation (323). Three potential open reading frames (ORFs), rk103 (RPMS1), rb2 (A73), and rkbarf0, are located in BARTs. Transcripts containing RK-BARF0 and RB2 are prevalently expressed in NPC tumors (331). Although the protein products of these ORFs have not been conclusively identified in vivo, despite the detection of specific antibodies in NPC patients, recombinant technologies have been used to evaluate their potential function (106). RK- BARF0 has been found to interact with human I-mfa domain-containing protein (HIC), epithelin, scramblase, Notch3, and Notch4 by yeast-two-hybrid screenings (200, 378). RK- BARF0 interacts with both processed and unprocessed Notch4 but only induces the nuclear translocation of unprocessed Notch4. Moreover, interaction of RK-BARF0 with Notch induces proteasome-mediated degradation of Notch, which may explain the low level of endogenous Notch expression in EBV-positive cell lines (378). These results indicate that RK-BARF0 may contribute to EBV-mediated tumorigenesis by regulating Notch pathways. 20

39 Interestingly, RK103 may also contribute to Notch regulation by interacting with RBP-Jκ, a Notch target, to inhibit transactivating activities of NotchIC or EBNA2 (433). Furthermore, it has been reported that overexpression of RK103 exhibits oncogenic potential in 293 cells and in nude mice (208). RB2 has been shown to be a cytoplasmic protein which can interact with receptor for activated protein kinase C (RACK1), a modulator of protein kinase C (PKC) or Src kinases (359). Interestingly, a recent study suggests that multiple polymorphisms in the rb2 gene may be correlated with NPC development (434). Another transcript product of BARTs, BARF1, is expressed both as an early gene in the lytic cycle or as a secreted latent protein in EBV-associated NPC (62). Overexpression of BARF1 displays oncogenic activity in B cells, rodent fibroblasts and monkey primary epithelial cells by stimulating the cell cycle (335, 350, 351). EBV and MicroRNAs EBV is the first virus to be identified encoding micrornas (mirnas) (301). Multiple approaches have been applied to identify EBV mirnas, including computational prediction, microarray analysis, and small RNA cloning (38, 115, 300, 301, 439). To date, approximately 30 EBV mirnas have been identified, mainly distributed within two areas, BARTs introns and BHRFs transcripts. Similarly to the BART transcripts, the expression of BART mirnas is tissue-specific, BART mirnas are expressed at high level in latently infected epithelial cells, such as NPC or GC, but at much lower level in B cells (38, 191). In contrast, the BHRF mirnas are expressed in a latency type-dependent manner. BHRFs mirnas are produced from an intron within the EBNA2 transcript and expressed at high 21

40 levels in B cells in type III latency but are undetectable in B cells or epithelial cells of type I or II latency (38). During transcription, mirnas are processed prior to the splicing reaction and a specific form of transcript favors mirna production. Therefore, the BART structure may account for the difference in EBV mirna abundance (71). Interestingly, the induction of lytic replication enhances the expression of many EBV mirnas (38, 422). Several studies have suggested that EBV mirnas may contribute to EBV tumorigenesis by targeting both viral and cellular genes. BART mirnas have been suggested to promote cancer development and viral latency by regulating expression of LMP1 and viral DNA polymerase BALF5, respectively (20, 224). EBV mirnas also provide cancer cells with immune-evasive and survival signals by targeting cellular genes involved with the immune response and apoptosis, such as CXCL-11, MICB, and PUMA (50, 271, 418). EBV infection also has significant effects on cellular mirna expression (110). EBV infection has been shown to induce expression of human oncogenic mirnas, or oncomirs, like mir-155 and mir-146a to regulate cellular transcription machinery (230, 267, 427). It has been suggested that EBV regulates the expression of cellular mirnas through LMP1- activated transcriptional factors, such as NF-κB (103, 267, 316). These quicklyaccumulating data suggest that EBV can regulate expression of viral and cellular genes through novel mirna pathways to promote tumor progression and maintain viral latency. EBV-Associated Diseases and Malignancies Infectious Mononucleosis 22

41 Primary infection of EBV, through oral transmission during childhood, is normally asymptomatic. However, if the primary infection is delayed until adolescence or early adulthood, half of the patients develop benign lymphoproliferative disease infectious mononucleosis (IM) (277). IM has been shown to be a significant risk factor for EBVassociated Hodgkin s lymphoma with about 1 in 1,000 patients with IM developing HL later in life (139, 164). During IM, complex infection involving multiple strains of EBV occurs in the oral cavity, peripheral blood lymphocytes, and the cell-free plasma (356). Patients with IM shed high titers of infectious virus and could suffer clinical symptoms with various degrees of severity, including fever, pharyngitis, headache, malaise, lymphadenopathy, and splenomegaly (55, 80). These symptoms are mainly due to hyperexpansion of CD8 + T cells and subsequent cytotoxic immune response, such as induction of IFN-γ and TNF-α, induced by EBV-infected B-lymphocytes (4, 40, 137). Polymorphisms in the interleukin-10 gene have been linked to the severity of lymphoproliferation of symptomatic primary EBV infection (124). Recent studies showed that class I human leukocyte antigen (HLA)-A1 fails to present LCL-expressed, highly immunogenic peptides of EBV latent antigens and thus represent one of the risk factors of acute IM and Hodgkin lymphoma (29, 279). Moreover, class I HLA polymorphisms within HLA-A1 and HLA-A3 was suggested to predispose patients to development of IM upon primary EBV infection (248). Chronic Active EBV Infection In most IM cases, the primary infection is controlled by immune system. However, in some young patients recurrent fever, lymphadenopathy, hepatosplenomegaly, chronic fatigue, and other symptoms occurs even several years after the primary infection (289). 23

42 Patients with chronic active EBV infection have very high EBV genome loads in the peripheral blood mononuclear cells (PBMC), high titers of antibodies against EBV-encoded antigens, and expression of EBV proteins and transcripts in the affected tissues (127, 237, 342). It has been suggested that defects in cytotoxic activity of T cells and natural killer (NK) cells contribute to the occurrence of chronic active EBV infection (96, 169, 388). A recent study showed that EBNA1-specific CD4 (+) T cells are capable of killing EBVinfected NK and T cells derived from patients with chronic active EBV infection, indicating the potential of this approach in vaccine design and immunotherapy of EBV infection (64). Oral Hairy Leukoplakia Characterized by productive infection of EBV in the squamous epithelial cells of the lateral tongue border, oral hairy leukoplakia (OHL) often develops in HIV-infected or otherwise immunocompromised patients and is the only known pathological manifestation of permissive EBV infection in epithelial cells (112). Without obvious symptoms, OHL develops as white or gray patch on the tongue or the inside of the cheek and is identified histologically by epithelial acanthosis, lack of inflammatory infiltrate, and hyperkeratosis (133). It has been shown that OHL is infected by multiple EBV strains characterized by sequence variation within the LMP1 gene (355, 397, 399). In addition to lytic gene products, the EBV latent genes EBNA1, EBNA2, and LMP1 are also detected in OHL lesions, as well as signaling pathways contributing to EBV transformation, such as LMP1-induced NF-κB and JNK activation (398, 406, 407). The EBV glycoprotein BMRF-2 is highly expressed in OHL epithelium and is thought to play an important role in cell-to-cell spread of EBV within the oral epithelium through association with various integrins (419, 420). 24

43 Virus Associated Hemophagocytic Syndrome Haemophagocytic syndrome (HPS) is a rare but often fatal disease despite treatment. HPS is caused by dysregulations in T-cell and NK-cell functions, resulting in activation and proliferation of lymphocytes with out-of-control haemophagocytosis and cytokine overproduction (61, 363). Characterized by clinical symptoms such as fever, hepatosplenomegaly, liver dysfunction, cytopenias, and hyperferritinaemia, HPS is associated with viral infections, including EBV, human cytomegalovirus (HCMV), human herpesvirus 8 (HHV8), HIV, influenza virus, and hepatitis virus (88, 325). Among all of the viruses associated with this disease, EBV is the most common triggering agent and EBVassociated syndrome results in the worst prognosis. In EBV-associated HPS, EBV infects CD8 + T cells and results in the lack of production of EBV-specific cytotoxic T cells, followed by severe cytokine storm and organ dysfunctions (154, 178). Normally occurs during reactivation, EBV-associated HPS also develop with other EBV-caused diseases, such as IM, chronic active infection, and NK T-cell lymphoma (5, 51, 286). It has been recently suggested that LMP1-induced ATF5 may contribute to the pathogenesis of HPS by transcriptionally downregulating signals for lymphocyte activation molecule-associated protein (SAP) to enhance Th1 cytokine secretion in T cells (52). X-linked Lymphoproliferative Syndrome X-linked lymphoproliferative syndrome (XLP; also called Duncan s disease) is a rare immunodeficiency disease identified by its inability to control EBV infection-induced immune response (121, 219). XLP patients exhibit polyclonal B-cell proliferation, defective 25

44 NK cell cytotoxicity and prolonged cytotoxic T-cell activity, resulting in often fatal infectious mononucleosis and malignant lymphoma in response to EBV infection (119, 276, 344). The phenotype of XLP is thought to result from defective-mutations within several genes on the human X chromosome, including SAP and X-linked inhibitor-of-apoptosis (XIAP), lead to defects in the activity of NK-cells to kill EBV-infected B cells (275, 294, 319). A recent study identified a homozygous missense mutation of IL-2-inducible T cell kinase (ITK) in two Turkish girls who suffered fatal immunoproliferative disorders following EBV infection, resembling the pathogenesis of XLP (148). Post-Transplant Lymphoproliferative Disorder Solid organ transplant patients who receive immunosuppressive therapy are vulnerable to the development of post-transplant lymphoproliferative disorders (PTLD), including a variety of B-cell diseases which are mostly EBV-positive (408). Although capable of developing much later after the transplantation, most PTLDs occur within the first year of allografting with the most severe immunosuppression and the weakest cytotoxic T- cell activity. The majority of PTLD tumors are in type III latency, with expression of all latent genes, although occasionally lytic gene of EBV or more intermediate patterns can also be detected (270, 381, 428). Data from studying gene sequencing and rearrangements of immunoglobulin (Ig) variable regions showed that in PTLDs EBV can infect B cells at any stage of differentiation, including naïve cells, memory cells, germinal center B cells, or even B cells possessing hypermutations of Ig (15, 28, 381). These novel EBV infections of nonnaïve B cells in immunocompromised patients may create a pool of EBV-infected B cells with permanent transforming potential by trapping these infected cells into the growth 26

45 program of EBV gene expression (15, 297). An in vitro study showed that EBV infection results in transcriptional and posttranscriptional defects of surface immunoglobulin, indicating that EBV infection contributes to the development of PTLD by rendering B-cell receptor (BCR)-deficient and pre-apoptotic germinal center B cells independent from survival signals normally supplied by the BCR (22). Several genetic mutations are associated with PTLD, including c-myc and bcl-6 (41, 214, 374, 428). Gastric Carcinoma EBV is associated with approximately 10% of ordinary gastric carcinoma (GAC), while some rare subtypes are associated with EBV more frequently, such as lymphoepithelioma-like GAC (80%) and post-operative gastric stump carcinoma (35%) (152, 369). EBV-associated GAC normally localize to the upper stomach area, and EBV infection is considered a late event in GAC development due to the lack of detection of EBERs in the preneoplastic cells (442). EBV-associated GAC exhibits a unique latency expression pattern, with both latent and lytic genes being expressed (143). Moreover, only LMP2A, but not LMP1 and LMP2B, is expressed in EBV-associated GAC (364). A recent study showed that LMP2A induces the expression of survivin through NF-κB pathway in GAC cell lines, potentially providing survival advantage for EBV-associated GAC (134). The BARF1 gene is also expressed in GAC and can induce expression of cyclin D1 and increase ratio of Bcl2 to Bax to provide anti-apoptotic properties for GAC cells (403, 412, 441). Increasing amount of evidence have suggested that frequent aberrant methylations of CpG island occur in a global but also target-specific manner in EBV-associated GAC (173). Multiple genes are downregulated through methylation-mediated silencing mechanisms, including p14, p16, 27

46 p73, PTEN, HOXA10, and RASSF2A (135, 172, 246, 333, 393). Interestingly, despite these implications that EBV provide survival advantages to GAC, EBV infection has been linked to better patient survival (394). Multiple Sclerosis EBV has been associated with multiple sclerosis (MS) by epidemiological studies investigating the relationship between infectious mononucleosis and MS, a complex inflammatory CNS disease (235, 373). Elevated humoral and cellular immune response against EBNA1 has been found in MS patients (233, 235). A strong correlation between EBV infection and MS was recently demonstrated by the discovery of selectively-expanded EBNA1 specific CD4 + Th1 cells that also possess the ability to cross-recognize MSassociated myelin antigens to trigger immune response (234). It has also been suggested that potential genetic defects of CD8+ T cells result in decreased T cell reactivity to EBVinfected LCLs and predispose patients to MS by accumulating EBV-infected B cells in the CNS of MS patients (298). Characterized by high titers of anti-ebv antibodies, increased EBV viral load and expression of EBV DNA/RNA, EBV infection has also been linked to other autoimmune diseases, including systemic lupus erythematosus (SLE), primary Sjögren s syndrome (pss), and rheumatoid arthritis (RA) (304, 384). Burkitt s Lymphoma EBV-associated Burkitt s lymphoma (BL) can be basically divided into three categories: endemic, sporadic, and AIDS-associated. BL is 100% EBV-positive in New Guinea and areas of Africa where malaria is holoendemic, and is approximately 85% EBV- 28

47 positive in Brazil and North Africa where incidence of BL is lower (16, 34, 36, 238, 305). In these areas, EBV-associated BL is the leading cause of childhood cancers and normally develops at extranodal sites in the jaw during molar eruption or in the CNS (3, 190). Only 15% of sporadic BL in the developed countries are associated with EBV and these cases normally develop at a later age and frequently present with an abdominal mass and occasionally as leukemia (238). Approximately 30-40% of AIDS-associated BLs are associated with EBV. These tumors appear as small B cell lymphoma in adult HIV-carriers and also often occur as the first sign of AIDS development in relatively immunocompetent patients (98, 190). All BLs appear to be monoclonal and may originate from the germinal center B cells due to expression of germinal centroblasts markers, such as CD10, CD77, and Bcl6 (75, 311). It has been suggested that HIV-infection and holoendemic malaria may contribute to BL development by inducing lymphadenopathy and germinal center activity, or recruiting EBV-infected B cells into germinal center reactions (12, 23). BL can have one of three characteristic chromosomal translocations that place the c-myc oncogene under the control of the Ig heavy chain promoter on chromosome 14 or one of the light chain loci on chromosome 2 or 22 (58). These translocations result in deregulation of c-myc expression and are important for BL proliferation (123, 213, 303). This is especially critical for BL pathogenesis considering that EBV-associated BL tumors have type I latency pattern with expression of only EBNA1 but not major oncoproteins EBNA2 or LMPs (303, 327). However, EBNA1 does seem to provide survival signals for BLs in addition to its normal function of maintaining viral episomes (183). Interestingly, in a subset of BLs where type III latency expression pattern is mostly retained, EBNA2 is deleted from the viral genome (181). 29

48 Transcriptional silencing of tumor suppressor genes are often found in BLs in addition to mutations of p53, p14, Bax, and Rb, as well as methylation-mediated inhibition of p16, p73, PUMA, and cyclin D2 (102, 221, 352). Upregulations of several oncogenes, such as TCL1 and MDM2, have also been reported in BLs (193, 220). Hodgkin Lymphoma A common cancer in developed countries, incidence of Hodgkin lymphoma (HL) peaks at young adults aged years and more prevalent in male (163). HL is an unusual tumor, where the neoplastic cells only account for 1% of the cells within the tumor (99). Neoplastic cells in HL, including mononucleate Hodgkin cells and multinucleate Reed- Sternberg cells (collectively called HRS cells), are surrounded by non-malignant inflammatory infiltrate. Different types of infiltrate define HL into three subtypes: nodular sclerosing (NS), mixed cellularity (MC), and lymphocyte-depleted (LD) subtypes. Approximately 40% and nearly 100% of HL cases are associated with EBV-infection in developed and developing countries, respectively (147). And individuals with a prior history of IM have higher risk of developing HL, further indicating the importance of EBV-infection in HL (109). Interestingly, in developed countries EBV-associated HL cases include most MC and LD subtypes but only a minority of the NS subtype, which makes up for the peak group of young adults. This phenomenon reflects the fact that EBV-associated HL cases are most frequent in the older population of developed countries. In developing countries, however, HL cases are most frequent in childhood without the peak in young adults (13, 147). Cytokines released from both HRS and inflammatory infiltrate cells, such as IL-1, IL- 6, TGF-β, and TNF-α result in the clinical symptoms of HL (187). 30

49 In EBV-positive HLs, the virus is found only in malignant HRS cells. Genotyping of Ig V locus has identified that HRS are likely derived from nonfunctional postgerminal center B cells that atypically survived the GC reaction (26, 27, 176, 199). EBV-infected HRS cells exhibit a type II latency expression pattern and have no chromosomal abnormalities (8, 409, 410). EBV-positive HLs demonstrate constitutive activation of NF-κB, and PI3K pathways, which are potentially induced by LMP1 or LMP2A to ensure the proliferation and survival of HRS cells (19, 69, 307, 343). Interestingly, EBV-negative HLs also show constitutive NFκB activities by inactivating inhibitor of κbα (IκBα) or amplifying the REL gene (198). Deregulation of cellular genes expression have also been shown in HL, including increased IL-10, STAT1, STAT3, and Bcl-3, as well as decreased p27,p53, CDK6, cyclin E, and BCL- X L (100, 306). Nasopharyngeal Carcinoma Nasopharyngeal carcinoma (NPC) is a subset of gastric adenocarcinomas and certain salivary-gland carcinomas (309). Its anatomical location is in the upper throat and directly behind the nosal cavities, and the carcinoma arises from the epithelium lining the surface and subterranean chambers of the nasopharynx (162, 395). The World Health Organization (WHO) classifies NPC into three subtypes based on the degree of differentiation: keratinizing squamous cell carcinoma (type 1), non-keratinizing carcinoma (type 2), and undifferentiated carcinoma (type 3), which is the most frequent form of the disease and also shows the most consistent association with EBV infection (309, 347). EBV-associated NPC has specific geographical and ethnic distribution. In most part of the world, including Europe and North America, the incidence of NPC is lower than 1 case per 100,000 human population. 31

50 However, the frequency of NPC incidence increases dramatically in Arctic region, South China, and Southeast Asia, with cases person 100,000 population per year (430). In Chinese Cantonese males in Hong Kong or Guangzhou, the incidence rates can even climb up to a jaw-dropping 150 cases per 100,000 population per year (129). Notably, the incidence rate of NPC remains high in populations moved from high-incidence areas, as well as in their descendants, regardless of where they live (132). This suggests a genetic predisposition to the disease in addition to environmental triggers such as salted fish consumption and exposure to chemical carcinogens (1, 430). EBV association with more differentiated forms of NPC has also been shown in these high-incidence areas (295). NPC appears as a mixture of malignant epithelial cells and a prominent, nonmalignant, EBV-negative lymphocytic infiltrate, which likely contributes to tumor propagation by producing cytokines (297, 429). NPC cells also express immune regulatory factors, indicating the functional interaction between NPC cells and surrounding lymphoid cells (4). EBV-associated NPC is in type II latency which includes the expression of EBNA1, EBERs, BARTs transcripts, LMP1 (in ~50% of cases), and LMP2A (in ~45% of cases) (130, 297, 309, 312, 429). It has been shown that EBV-associated NPC has monoclonal infection of EBV, indicating that EBV infection occurs before the clonal expansion of malignant cells (311). Some NPC cells may spontaneously undergo productive replication and linear EBV genome can be detected in NPC patients as well as viral lytic antigens (128). NPC tumor cells express human leukocyte antigen (HLA) class I and II that process antigens efficiently (188, 203). HLA haplotype contributes to NPC pathogenesis as genes linked to HLA are associated with different degrees of risk for NPC development (231). 32

51 HLA haplotypes HLA-A2, BW46, A19, and B17 of class I, as well as HLA-DR β10803 of class II are associated with an increased risk for NPC, while HLA-A11 and HLA-B13 of class I are associated with a decreased risk for NPC (73, 190). A distinctive predominance of specific LMP1 strains in endemic NPC has been identified with sequence changes in HLArestricted epitopes. This finding suggested that LMP1 evade immune recognition by having specific sequence variation in NPC (73). The association between HLA haplotypes and NPC prevalence may explain the high incidence rates of NPC in Chinese descendant who no longer live in high-risk areas. Other than HLA haplotypes, other genetic factors could be important for EBV infection and NPC development. This is supported by the fact that EBV is monoclonal in malignant cells and also appears in pre-malignant lesions in the nasopharynx (296). Multiple genetic alterations, such as deletions or methylations, have been reported in NPC, locating in chromosomes 3p (RASSF1A), 9p (p16), 11q, 13q, and 14q (280, 429). Interestingly, mutations of p53 are detected in NPC tumors passaged in nude mice but much more infrequently in primary NPC samples, indicating that p53 mutations are not essential for NPC development (74). Therapeutic Approaches Traditional treatments of EBV-associated diseases include antiviral agents, immune modulators, and chemotherapeutic drugs. Two major directions of therapeutic approach are being developed to treat EBV-associated tumors, including pharmacological and Immunological-based therapies. In pharmacological methods, one approach is to induce EBV lytic cycle in order to enhance cytotoxic immune response. For example, 33

52 demethylating agent 5-azacytidine can de-repress lytic cycle of EBV to induce EBV-encoded kinases that subsequently activate nucleoside analogue gancyclovir for cytotoxic activities (42). Delivery of EBV immediate early genes may elicit similar effects (7, 84, 156). More selective approach was experimented using EBNA1-responsive gene-therapy construct to express cytotoxic proteins or p53 in tumor cells (210). Approaches directly targeting individual EBV proteins have also been tested using single-chain antibodies, antisense RNA, and small chemical compounds or EBNA2-TAT peptide inhibiting NF-κB and RBP-Jκ pathways (37, 83, 184, 302). Immunotherapy approach has been proven successful firstly in preventing bonemarrow-transplant patients from developing PTLD. Effector T cells were prepared from the bone marrow donor by autologous LCL stimulation and expansion ex vivo before being infused to the recipient to provide EBV-specific, mostly EBNA3s-specific, cytotoxicity (324). Similar adoptive immunotherapy has also been developed in solid organ transplant cases and showed promising results (338). Similar methods are also being developed to target other EBV proteins that are less immunogenic, such as LMPs (396). Dendritic cells pulsed with LMP2 epitopes have been used to treat EBV-positive nasopharyngeal carcinoma patients with noticeable CD8 + T-cell responses (217). Alternative treatments using monoclonal antibodies to target EBV receptor CD21 or B-cell antigen CD24 and CD20 have also been used to try to eliminate EBV-infected B cells (287). Moreover, anti TNF-α agents have been used to treat X-linked lymphoproliferative syndrome (288). EBV Vaccines 34

53 The development of EBV vaccines has been hampered by some limitations and concerns. The nature of EBV s life cycle and tumorigenesis make it difficult to design vaccines delivered to people at risk of developing malignancies such as NPC or lymphoproliferative diseases before primary infection. Moreover, potential antigens expressed by EBV during latency normally have oncogenic potentials and will be evaluated as vaccine candidates with great skeptism (189, 266). However, with increasing understandings of EBV biology as well as immunological controls of EBV-associated diseases, multiple vaccines have been under development for prophylactic protection (IM) and therapeutic purposes (Malignancies) (229). Recombinant gp350 subunit vaccine has been shown to induce neutralizing antibody response to prevent the development of IM caused by EBV-infection after phase I and II clinical study (161, 268, 360). Single peptidebased vaccine using CD8 + T-cell epitope from EBNA3 conjugated with tetanus toxoid as a source of CD4 + T-cell help has shown positive results, after phase I trial, in preventing IM without predisposing recipients to diseases (78). However, the HLA diversity across human population will limit the efficacy of vaccines with single peptide. This problem can potentially be solved by using recombinant virus technique to express multiple epitopes at once (111). A recent mice study showed that a tetrameric vaccinia virus-based vaccine expressing epitopes from gp110, gp350, EBNA2, and EBNA3C elicited the production of neutralizing antibodies and EBV-specific T-cell responses (225). This cocktail strategy may prove to be efficient against both EBV primary infection and EBV-associated malignancies. Epidermal Growth Factor Receptor in NPC 35

54 Upregulation of the epidermal growth factor receptor (EGFR) has been detected in over 70% of EBV-associated NPC samples and correlated with LMP1 expression level (291, 349, 437). Moreover, the level of EGFR expression is positively associated with the stage of the disease (291). Treatment with EGFR tyrosine kinase inhibitors induces cell cycle arrest, inhibits cell proliferation of NPC cell lines, and exhibits potent antitumor effects on NPC xenografts using in vivo mouse model (366, 404, 421, 440). EGFR is a member of the ErbB receptor tyrosine kinase family which includes EGFR (ErbB-1), HER2/c-neu (ErbB-2), HER3 (ErbB-3), and HER4 (ErbB-4). Upon ligand binding, ErbBs undergo dimerization, autophosphorylation, activation, and subsequently degradation/turnover from an originally inactive conformation (86, 432). Multiple signaling pathways are activated downstream of EGFR, including Ras/MAPK, Src kinases, JAKs/STATs, and PI3K-AKT pathways (170). Deregulated EGFR signaling has been associated with tumor progression, invasion, and metastasis (411). EGFR signaling has been shown to be targeted by oncogenic viral proteins to regulate tumorigenesis, including v- ErbB, E5, and HBVx (254). EGFR also serves as cellular receptor for HCMV entry and signaling (405). One important mechanisms by which EGFR becomes active and potentially oncogenic is through activating mutations (431). Numerous activating mutations have been identified in EGFR that can affect ligand binding, receptor dimerization and phosphorylation, as well as its enzymatic activity and substrate specificity (318). However, somatic mutations were not detected in a comprehensive sequencing analysis in NPC (202). This indicates that alternative mechanisms, such as amplification of EGFR found in NPC, play major roles in NPC development. EGFR was previously shown to be induced by LMP1 in epithelial cell 36

55 line C33A at transcriptional level (250, 251, 253). This transcriptional upregulation was found to be mediated by a novel NF-κB complex comprised with p50 homodimer and Bcl-3 (379, 380). LMP1-induced EGFR may play a very important role in EBV tumorigenesis and is a prime target for development of therapeutic strategies. Interestingly, in current EGFRtargeted treatments using chemical inhibitors and monoclonal antibodies, patients with elevated EGFR expression level generally exhibit better response (70, 136, 259). This further suggests NPC patients could more likely benefit from EGFR-specific treatments. 37

56 OBJECTIVES EBV LMP1 is the main oncoprotein of EBV during latent infection. LMP1 is required for EBV-mediated B cell transformation and overexpression of LMP1 results in deregulated proliferation and transformation of rodent fibroblast cells. The oncogenic potential of LMP1 is due to multiple signaling pathways mediated through two major signaling domains of LMP1, CTAR1 and CTAR2. CTAR1 is capable of inducing cell transformation while CTAR2 is dispensable, indicating that signaling transduction downstream of CTAR1 are critical for LMP1-mediated transformation and ultimately, EBVassociated tumorigenesis. The goal of the studies presented in this dissertation is to evaluate several signaling pathways engaged by LMP1-CTAR1 to regulate cellular gene expression and cell transformation focused on CTAR1-specific induction of EGFR. Aim 1. LMP1 induces EGFR upregulation in epithelial cells through STAT3 activation and Bcl-3 induction. In C33A cells and NPC, LMP1-CTAR1 induces EGFR transcriptional expression through a transactivating complex comprised of p50 and Bcl-3. The effects of LMP1 on Bcl- 3 expression and translocation in C33A cells were analyzed in this study. The connection between CTAR1-mediated STAT3 activation and EGFR upregulation was established using chemical inhibitors and chromatin-immunoprecipitation analysis. Aim 2. LMP1 modulates distinctive NF-κB pathways through CTAR1 to regulate EGFR expression. In addition to EGFR induction, CTAR1 also activates multiple forms of NF-κB. Mouse embryonic fibroblasts (MEFs) defective for different NF-κB effectors were used in 38

57 this study to evaluate the effects of NF-κB pathways on CTAR1-mediated EGFR induction. MEFs defective for NF-κB effectors or different TRAFs were also used to identify the factors involved with CTAR1-induced p50 activation. Aim 3. Effects of CTAR1 on signaling transductions involved with EGFR and STAT3. In addition to increased EGFR expression, we show that overexpression of CTAR1 also induced EGFR activation intrinsically and in response to an EGFR ligand. EGFRmediated STAT3 activation and potential downstream targets were evaluated. Importantly, PKCδ was identified as the serine kinase of STAT3 in CTAR1-expressing C33A cells and was required for activation of ERK. The effects ofpkcδ onctar1-mediated transformation were tested using focus formation assay. 39

58 REFERENCES Salted fish and nasopharyngeal carcinoma. Lancet 2: Abbot, S. D., M. Rowe, K. Cadwallader, A. Ricksten, J. Gordon, F. Wang, L. Rymo, and A. B. Rickinson Epstein-Barr virus nuclear antigen 2 induces expression of the virus-encoded latent membrane protein. J Virol 64: Adatia, A. K Burkitt's tumour in the jaws. Br Dent J 120: Agathanggelou, A., G. Niedobitek, R. Chen, J. Nicholls, W. Yin, and L. S. Young Expression of immune regulatory molecules in Epstein-Barr virusassociated nasopharyngeal carcinomas with prominent lymphoid stroma. Evidence for a functional interaction between epithelial tumor cells and infiltrating lymphoid cells. Am J Pathol 147: Akashi, K., and S. Mizuno Epstein-Barr virus-infected natural killer cell leukemia. Leuk Lymphoma 40: Altmann, M., D. Pich, R. Ruiss, J. Wang, B. Sugden, and W. Hammerschmidt Transcriptional activation by EBV nuclear antigen 1 is essential for the expression of EBV's transforming genes. Proc Natl Acad Sci U S A 103: Ambinder, R. F., K. D. Robertson, and Q. Tao DNA methylation and the Epstein-Barr virus. Semin Cancer Biol 9: Anagnostopoulos, I., H. Herbst, G. Niedobitek, and H. Stein Demonstration of monoclonal EBV genomes in Hodgkin's disease and Ki-1-positive anaplastic large cell lymphoma by combined Southern blot and in situ hybridization. Blood 74: Anderton, E., J. Yee, P. Smith, T. Crook, R. E. White, and M. J. Allday Two Epstein-Barr virus (EBV) oncoproteins cooperate to repress expression of the proapoptotic tumour-suppressor Bim: clues to the pathogenesis of Burkitt's lymphoma. Oncogene 27: Angel, P., M. Imagawa, R. Chiu, B. Stein, R. J. Imbra, H. J. Rahmsdorf, C. Jonat, P. Herrlich, and M. Karin Phorbol ester-inducible genes contain a common cis element recognized by a TPA-modulated trans-acting factor. Cell 49: Aras, S., G. Singh, K. Johnston, T. Foster, and A. Aiyar Zinc coordination is required for and regulates transcription activation by Epstein-Barr nuclear antigen 1. PLoS Pathog 5:e Araujo, I., H. D. Foss, M. Hummel, I. Anagnostopoulos, H. S. Barbosa, A. Bittencourt, and H. Stein Frequent expansion of Epstein-Barr virus (EBV) 40

59 infected cells in germinal centres of tonsils from an area with a high incidence of EBV-associated lymphoma. J Pathol 187: Armstrong, A. A., F. E. Alexander, R. P. Paes, N. A. Morad, A. Gallagher, A. S. Krajewski, D. B. Jones, B. Angus, J. Adams, R. A. Cartwright, and et al Association of Epstein-Barr virus with pediatric Hodgkin's disease. Am J Pathol 142: Babcock, G. J., L. L. Decker, M. Volk, and D. A. Thorley-Lawson EBV persistence in memory B cells in vivo. Immunity 9: Babcock, G. J., D. Hochberg, and A. D. Thorley-Lawson The expression pattern of Epstein-Barr virus latent genes in vivo is dependent upon the differentiation stage of the infected B cell. Immunity 13: Bacchi, M. M., C. E. Bacchi, M. Alvarenga, R. Miranda, Y. Y. Chen, and L. M. Weiss Burkitt's lymphoma in Brazil: strong association with Epstein-Barr virus. Mod Pathol 9: Baer, R., A. T. Bankier, M. D. Biggin, P. L. Deininger, P. J. Farrell, T. J. Gibson, G. Hatfull, G. S. Hudson, S. C. Satchwell, C. Seguin, and et al DNA sequence and expression of the B95-8 Epstein-Barr virus genome. Nature 310: Baichwal, V. R., and B. Sugden Posttranslational processing of an Epstein- Barr virus-encoded membrane protein expressed in cells transformed by Epstein-Barr virus. J Virol 61: Bargou, R. C., F. Emmerich, D. Krappmann, K. Bommert, M. Y. Mapara, W. Arnold, H. D. Royer, E. Grinstein, A. Greiner, C. Scheidereit, and B. Dorken Constitutive nuclear factor-kappab-rela activation is required for proliferation and survival of Hodgkin's disease tumor cells. J Clin Invest 100: Barth, S., T. Pfuhl, A. Mamiani, C. Ehses, K. Roemer, E. Kremmer, C. Jaker, J. Hock, G. Meister, and F. A. Grasser Epstein-Barr virus-encoded microrna mir-bart2 down-regulates the viral DNA polymerase BALF5. Nucleic Acids Res 36: Bayliss, G. J., and H. Wolf Epstein--Barr virus-induced cell fusion. Nature 287: Bechtel, D., J. Kurth, C. Unkel, and R. Kuppers Transformation of BCRdeficient germinal-center B cells by EBV supports a major role of the virus in the pathogenesis of Hodgkin and posttransplantation lymphomas. Blood 106:

60 23. Bellan, C., S. Lazzi, M. Hummel, N. Palummo, M. de Santi, T. Amato, J. Nyagol, E. Sabattini, T. Lazure, S. A. Pileri, M. Raphael, H. Stein, P. Tosi, and L. Leoncini Immunoglobulin gene analysis reveals 2 distinct cells of origin for EBV-positive and EBV-negative Burkitt lymphomas. Blood 106: Bhende, P. M., S. J. Dickerson, X. Sun, W. H. Feng, and S. C. Kenney X- box-binding protein 1 activates lytic Epstein-Barr virus gene expression in combination with protein kinase D. J Virol 81: Bhende, P. M., W. T. Seaman, H. J. Delecluse, and S. C. Kenney The EBV lytic switch protein, Z, preferentially binds to and activates the methylated viral genome. Nat Genet 36: Braeuninger, A., R. Kuppers, J. G. Strickler, H. H. Wacker, K. Rajewsky, and M. L. Hansmann Hodgkin and Reed-Sternberg cells in lymphocyte predominant Hodgkin disease represent clonal populations of germinal center-derived tumor B cells. Proc Natl Acad Sci U S A 94: Brauninger, A., M. L. Hansmann, J. G. Strickler, R. Dummer, G. Burg, K. Rajewsky, and R. Kuppers Identification of common germinal-center B-cell precursors in two patients with both Hodgkin's disease and non-hodgkin's lymphoma. N Engl J Med 340: Brauninger, A., T. Spieker, A. Mottok, A. S. Baur, R. Kuppers, and M. L. Hansmann Epstein-Barr virus (EBV)-positive lymphoproliferations in posttransplant patients show immunoglobulin V gene mutation patterns suggesting interference of EBV with normal B cell differentiation processes. Eur J Immunol 33: Brennan, R. M., and S. R. Burrows A mechanism for the HLA-A*01- associated risk for EBV+ Hodgkin lymphoma and infectious mononucleosis. Blood 112: Brink, A. A., D. F. Dukers, A. J. van den Brule, J. J. Oudejans, J. M. Middeldorp, C. J. Meijer, and M. Jiwa Presence of Epstein-Barr virus latency type III at the single cell level in post-transplantation lymphoproliferative disorders and AIDS related lymphomas. J Clin Pathol 50: Buisson, M., E. Manet, M. C. Trescol-Biemont, H. Gruffat, B. Durand, and A. Sergeant The Epstein-Barr virus (EBV) early protein EB2 is a posttranscriptional activator expressed under the control of EBV transcription factors EB1 and R. J Virol 63: Burkhardt, A. L., J. B. Bolen, E. Kieff, and R. Longnecker An Epstein-Barr virus transformation-associated membrane protein interacts with src family tyrosine kinases. J Virol 66:

61 33. Burkitt, D A children's cancer dependent on climatic factors. Nature 194: Burkitt, D A lymphoma syndrome in African children. Ann R Coll Surg Engl 30: Burkitt, D A sarcoma involving the jaws in African children. Br J Surg 46: Burkitt, D A tumour syndrome affecting children in tropical Africa. Postgrad Med J 38: Cahir-McFarland, E. D., D. M. Davidson, S. L. Schauer, J. Duong, and E. Kieff NF-kappa B inhibition causes spontaneous apoptosis in Epstein-Barr virustransformed lymphoblastoid cells. Proc Natl Acad Sci U S A 97: Cai, X., A. Schafer, S. Lu, J. P. Bilello, R. C. Desrosiers, R. Edwards, N. Raab- Traub, and B. R. Cullen Epstein-Barr virus micrornas are evolutionarily conserved and differentially expressed. PLoS Pathog 2:e Caldwell, R. G., J. B. Wilson, S. J. Anderson, and R. Longnecker Epstein- Barr virus LMP2A drives B cell development and survival in the absence of normal B cell receptor signals. Immunity 9: Callan, M. F., N. Steven, P. Krausa, J. D. Wilson, P. A. Moss, G. M. Gillespie, J. I. Bell, A. B. Rickinson, and A. J. McMichael Large clonal expansions of CD8+ T cells in acute infectious mononucleosis. Nat Med 2: Cesarman, E., A. Chadburn, Y. F. Liu, A. Migliazza, R. Dalla-Favera, and D. M. Knowles BCL-6 gene mutations in posttransplantation lymphoproliferative disorders predict response to therapy and clinical outcome. Blood 92: Chan, A. T., Q. Tao, K. D. Robertson, I. W. Flinn, R. B. Mann, B. Klencke, W. H. Kwan, T. W. Leung, P. J. Johnson, and R. F. Ambinder Azacitidine induces demethylation of the Epstein-Barr virus genome in tumors. J Clin Oncol 22: Chen, A., B. Zhao, E. Kieff, J. C. Aster, and F. Wang EBNA-3B- and EBNA-3C-regulated cellular genes in Epstein-Barr virus-immortalized lymphoblastoid cell lines. J Virol 80: Chen, H., P. Smith, R. F. Ambinder, and S. D. Hayward Expression of Epstein-Barr virus BamHI-A rightward transcripts in latently infected B cells from peripheral blood. Blood 93:

62 45. Chen, S. Y., J. Lu, Y. C. Shih, and C. H. Tsai Epstein-Barr virus latent membrane protein 2A regulates c-jun protein through extracellular signal-regulated kinase. J Virol 76: Cheung, A., and E. Kieff Epstein-Barr virus DNA. X. Direct repeat within the internal direct repeat of Epstein-Barr virus DNA. J Virol 40: Cheung, A., and E. Kieff Long internal direct repeat in Epstein-Barr virus DNA. J Virol 44: Chevallier-Greco, A., E. Manet, P. Chavrier, C. Mosnier, J. Daillie, and A. Sergeant Both Epstein-Barr virus (EBV)-encoded trans-acting factors, EB1 and EB2, are required to activate transcription from an EBV early promoter. Embo J 5: Choy, E. Y., K. H. Kok, S. W. Tsao, and D. Y. Jin Utility of Epstein-Barr virus-encoded small RNA promoters for driving the expression of fusion transcripts harboring short hairpin RNAs. Gene Ther 15: Choy, E. Y., K. L. Siu, K. H. Kok, R. W. Lung, C. M. Tsang, K. F. To, D. L. Kwong, S. W. Tsao, and D. Y. Jin An Epstein-Barr virus-encoded microrna targets PUMA to promote host cell survival. J Exp Med 205: Christensson, B., J. H. Braconier, I. Winqvist, T. Relander, and M. Dictor Fulminant course of infectious mononucleosis with virus-associated hemophagocytic syndrome. Scand J Infect Dis 19: Chuang, H. C., J. M. Wang, W. C. Hsieh, Y. Chang, and I. J. Su Upregulation of activating transcription factor-5 suppresses SAP expression to activate T cells in hemophagocytic syndrome associated with Epstein-Barr virus infection and immune disorders. Am J Pathol 173: Cludts, I., and P. J. Farrell Multiple functions within the Epstein-Barr virus EBNA-3A protein. J Virol 72: Coakley, D Denis Burkitt and his contribution to haematology/oncology. Br J Haematol 135: Cohen, J. I Epstein-Barr virus infection. N Engl J Med 343: Cohen, J. I., F. Wang, J. Mannick, and E. Kieff Epstein-Barr virus nuclear protein 2 is a key determinant of lymphocyte transformation. Proc Natl Acad Sci U S A 86: Cordier, M., A. Calender, M. Billaud, U. Zimber, G. Rousselet, O. Pavlish, J. Banchereau, T. Tursz, G. Bornkamm, and G. M. Lenoir Stable transfection 44

63 of Epstein-Barr virus (EBV) nuclear antigen 2 in lymphoma cells containing the EBV P3HR1 genome induces expression of B-cell activation molecules CD21 and CD23. J Virol 64: Dalla-Favera, R., M. Bregni, J. Erikson, D. Patterson, R. C. Gallo, and C. M. Croce Human c-myc onc gene is located on the region of chromosome 8 that is translocated in Burkitt lymphoma cells. Proc Natl Acad Sci U S A 79: Dambaugh, T., C. Beisel, M. Hummel, W. King, S. Fennewald, A. Cheung, M. Heller, N. Raab-Traub, and E. Kieff Epstein-Barr virus (B95-8) DNA VII: molecular cloning and detailed mapping. Proc Natl Acad Sci U S A 77: Dawson, C. W., A. B. Rickinson, and L. S. Young Epstein-Barr virus latent membrane protein inhibits human epithelial cell differentiation. Nature 344: de Saint Basile, G., and A. Fischer Defective cytotoxic granule-mediated cell death pathway impairs T lymphocyte homeostasis. Curr Opin Rheumatol 15: Decaussin, G., F. Sbih-Lammali, M. de Turenne-Tessier, A. Bouguermouh, and T. Ooka Expression of BARF1 gene encoded by Epstein-Barr virus in nasopharyngeal carcinoma biopsies. Cancer Res 60: Delecluse, H. J., R. Feederle, U. Behrends, and J. Mautner Contribution of viral recombinants to the study of the immune response against the Epstein-Barr virus. Semin Cancer Biol 18: Demachi-Okamura, A., Y. Ito, Y. Akatsuka, K. Tsujimura, Y. Morishima, T. Takahashi, and K. Kuzushima Epstein-Barr virus nuclear antigen 1-specific CD4+ T cells directly kill Epstein-Barr virus-carrying natural killer and T cells. Cancer Sci 99: Demetriades, C., and G. Mosialos The LMP1 promoter can be transactivated directly by NF-kappaB. J Virol 83: Devergne, O., E. D. Cahir McFarland, G. Mosialos, K. M. Izumi, C. F. Ware, and E. Kieff Role of the TRAF binding site and NF-kappaB activation in Epstein-Barr virus latent membrane protein 1-induced cell gene expression. J Virol 72: Dickerson, S. J., Y. Xing, A. R. Robinson, W. T. Seaman, H. Gruffat, and S. C. Kenney Methylation-dependent binding of the epstein-barr virus BZLF1 protein to viral promoters. PLoS Pathog 5:e Donze, O., J. Deng, J. Curran, R. Sladek, D. Picard, and N. Sonenberg The protein kinase PKR: a molecular clock that sequentially activates survival and death programs. Embo J 23:

64 69. Dutton, A., G. M. Reynolds, C. W. Dawson, L. S. Young, and P. G. Murray Constitutive activation of phosphatidyl-inositide 3 kinase contributes to the survival of Hodgkin's lymphoma cells through a mechanism involving Akt kinase and mtor. J Pathol 205: Dziadziuszko, R., S. E. Witta, F. Cappuzzo, S. Park, K. Tanaka, P. V. Danenberg, A. E. Baron, L. Crino, W. A. Franklin, P. A. Bunn, Jr., M. Varella- Garcia, K. D. Danenberg, and F. R. Hirsch Epidermal growth factor receptor messenger RNA expression, gene dosage, and gefitinib sensitivity in nonsmall cell lung cancer. Clin Cancer Res 12: Edwards, R. H., A. R. Marquitz, and N. Raab-Traub Epstein-Barr virus BART micrornas are produced from a large intron prior to splicing. J Virol 82: Edwards, R. H., F. Seillier-Moiseiwitsch, and N. Raab-Traub Signature amino acid changes in latent membrane protein 1 distinguish Epstein-Barr virus strains. Virology 261: Edwards, R. H., D. Sitki-Green, D. T. Moore, and N. Raab-Traub Potential selection of LMP1 variants in nasopharyngeal carcinoma. J Virol 78: Effert, P., R. McCoy, M. Abdel-Hamid, K. Flynn, Q. Zhang, P. Busson, T. Tursz, E. Liu, and N. Raab-Traub Alterations of the p53 gene in nasopharyngeal carcinoma. J Virol 66: Ehlin-Henriksson, B., A. Manneborg-Sandlund, and G. Klein Expression of B-cell-specific markers in different Burkitt lymphoma subgroups. Int J Cancer 39: Eliopoulos, A. G., S. M. Blake, J. E. Floettmann, M. Rowe, and L. S. Young Epstein-Barr virus-encoded latent membrane protein 1 activates the JNK pathway through its extreme C terminus via a mechanism involving TRADD and TRAF2. J Virol 73: Eliopoulos, A. G., and L. S. Young Activation of the cjun N-terminal kinase (JNK) pathway by the Epstein-Barr virus-encoded latent membrane protein 1 (LMP1). Oncogene 16: Elliott, S. L., A. Suhrbier, J. J. Miles, G. Lawrence, S. J. Pye, T. T. Le, A. Rosenstengel, T. Nguyen, A. Allworth, S. R. Burrows, J. Cox, D. Pye, D. J. Moss, and M. Bharadwaj Phase I trial of a CD8+ T-cell peptide epitope-based vaccine for infectious mononucleosis. J Virol 82:

65 79. Epstein, M. A., B. G. Achong, and Y. M. Barr Virus Particles in Cultured Lymphoblasts from Burkitt's Lymphoma. Lancet 1: Evans, A. S Infectious mononucleosis and other mono-like syndromes. N Engl J Med 286: Everly, D. N., Jr., B. A. Mainou, and N. Raab-Traub Induction of Id1 and Id3 by latent membrane protein 1 of Epstein-Barr virus and regulation of p27/kip and cyclin-dependent kinase 2 in rodent fibroblast transformation. J Virol 78: Fahraeus, R., L. Rymo, J. S. Rhim, and G. Klein Morphological transformation of human keratinocytes expressing the LMP gene of Epstein-Barr virus. Nature 345: Farrell, C. J., J. M. Lee, E. C. Shin, M. Cebrat, P. A. Cole, and S. D. Hayward Inhibition of Epstein-Barr virus-induced growth proliferation by a nuclear antigen EBNA2-TAT peptide. Proc Natl Acad Sci U S A 101: Feng, W. H., G. Hong, H. J. Delecluse, and S. C. Kenney Lytic induction therapy for Epstein-Barr virus-positive B-cell lymphomas. J Virol 78: Fennewald, S., V. van Santen, and E. Kieff Nucleotide sequence of an mrna transcribed in latent growth-transforming virus infection indicates that it may encode a membrane protein. J Virol 51: Ferguson, K. M Structure-based view of epidermal growth factor receptor regulation. Annu Rev Biophys 37: Fingeroth, J. D., J. J. Weis, T. F. Tedder, J. L. Strominger, P. A. Biro, and D. T. Fearon Epstein-Barr virus receptor of human B lymphocytes is the C3d receptor CR2. Proc Natl Acad Sci U S A 81: Fisman, D. N Hemophagocytic syndromes and infection. Emerg Infect Dis 6: Fixman, E. D., G. S. Hayward, and S. D. Hayward Replication of Epstein- Barr virus orilyt: lack of a dedicated virally encoded origin-binding protein and dependence on Zta in cotransfection assays. J Virol 69: Fixman, E. D., G. S. Hayward, and S. D. Hayward trans-acting requirements for replication of Epstein-Barr virus ori-lyt. J Virol 66: Flemington, E., and S. H. Speck Identification of phorbol ester response elements in the promoter of Epstein-Barr virus putative lytic switch gene BZLF1. J Virol 64:

66 92. Flemington, E. K., A. E. Goldfeld, and S. H. Speck Efficient transcription of the Epstein-Barr virus immediate-early BZLF1 and BRLF1 genes requires protein synthesis. J Virol 65: Fries, K. L., W. E. Miller, and N. Raab-Traub Epstein-Barr virus latent membrane protein 1 blocks p53-mediated apoptosis through the induction of the A20 gene. J Virol 70: Fruehling, S., S. K. Lee, R. Herrold, B. Frech, G. Laux, E. Kremmer, F. A. Grasser, and R. Longnecker Identification of latent membrane protein 2A (LMP2A) domains essential for the LMP2A dominant-negative effect on B- lymphocyte surface immunoglobulin signal transduction. J Virol 70: Fruehling, S., R. Swart, K. M. Dolwick, E. Kremmer, and R. Longnecker Tyrosine 112 of latent membrane protein 2A is essential for protein tyrosine kinase loading and regulation of Epstein-Barr virus latency. J Virol 72: Fujieda, M., H. Wakiguchi, H. Hisakawa, H. Kubota, and T. Kurashige Defective activity of Epstein-Barr virus (EBV) specific cytotoxic T lymphocytes in children with chronic active EBV infection and in their parents. Acta Paediatr Jpn 35: Gahn, T. A., and B. Sugden An EBNA-1-dependent enhancer acts from a distance of 10 kilobase pairs to increase expression of the Epstein-Barr virus LMP gene. J Virol 69: Gaidano, G., A. Carbone, and R. Dalla-Favera Pathogenesis of AIDSrelated lymphomas: molecular and histogenetic heterogeneity. Am J Pathol 152: Gandhi, M. K., J. T. Tellam, and R. Khanna Epstein-Barr virus-associated Hodgkin's lymphoma. Br J Haematol 125: Garcia, J. F., F. I. Camacho, M. Morente, M. Fraga, C. Montalban, T. Alvaro, C. Bellas, A. Castano, A. Diez, T. Flores, C. Martin, M. A. Martinez, F. Mazorra, J. Menarguez, M. J. Mestre, M. Mollejo, A. I. Saez, L. Sanchez, and M. A. Piris Hodgkin and Reed-Sternberg cells harbor alterations in the major tumor suppressor pathways and cell-cycle checkpoints: analyses using tissue microarrays. Blood 101: Garibal, J., E. Hollville, A. I. Bell, G. L. Kelly, B. Renouf, Y. Kawaguchi, A. B. Rickinson, and J. Wiels Truncated form of the Epstein-Barr virus protein EBNA-LP protects against caspase-dependent apoptosis by inhibiting protein phosphatase 2A. J Virol 81:

67 102. Garrison, S. P., J. R. Jeffers, C. Yang, J. A. Nilsson, M. A. Hall, J. E. Rehg, W. Yue, J. Yu, L. Zhang, M. Onciu, J. T. Sample, J. L. Cleveland, and G. P. Zambetti Selection against PUMA gene expression in Myc-driven B-cell lymphomagenesis. Mol Cell Biol 28: Gatto, G., A. Rossi, D. Rossi, S. Kroening, S. Bonatti, and M. Mallardo Epstein-Barr virus latent membrane protein 1 trans-activates mir-155 transcription through the NF-kappaB pathway. Nucleic Acids Res 36: Gergely, L., G. Klein, and I. Ernberg Host cell macromolecular synthesis in cells containing EBV-induced early antigens, studied by combined immunofluorescence and radioautography. Virology 45: Gilligan, K., H. Sato, P. Rajadurai, P. Busson, L. Young, A. Rickinson, T. Tursz, and N. Raab-Traub Novel transcription from the Epstein-Barr virus terminal EcoRI fragment, DIJhet, in a nasopharyngeal carcinoma. J Virol 64: Gilligan, K. J., P. Rajadurai, J. C. Lin, P. Busson, M. Abdel-Hamid, U. Prasad, T. Tursz, and N. Raab-Traub Expression of the Epstein-Barr virus BamHI A fragment in nasopharyngeal carcinoma: evidence for a viral protein expressed in vivo. J Virol 65: Given, D., and E. Kieff DNA of Epstein-Barr virus. VI. Mapping of the internal tandem reiteration. J Virol 31: Given, D., D. Yee, K. Griem, and E. Kieff DNA of Epstein-Barr virus. V. Direct repeats of the ends of Epstein-Barr virus DNA. J Virol 30: Glaser, S. L., and R. F. Jarrett The epidemiology of Hodgkin's disease. Baillieres Clin Haematol 9: Godshalk, S. E., S. Bhaduri-McIntosh, and F. J. Slack Epstein-Barr virusmediated dysregulation of human microrna expression. Cell Cycle 7: Goonetilleke, N., S. Moore, L. Dally, N. Winstone, I. Cebere, A. Mahmoud, S. Pinheiro, G. Gillespie, D. Brown, V. Loach, J. Roberts, A. Guimaraes-Walker, P. Hayes, K. Loughran, C. Smith, J. De Bont, C. Verlinde, D. Vooijs, C. Schmidt, M. Boaz, J. Gilmour, P. Fast, L. Dorrell, T. Hanke, and A. J. McMichael Induction of multifunctional human immunodeficiency virus type 1 (HIV-1)-specific T cells capable of proliferation in healthy subjects by using a prime-boost regimen of DNA- and modified vaccinia virus Ankara-vectored vaccines expressing HIV-1 Gag coupled to CD8+ T-cell epitopes. J Virol 80: Greenspan, J. S., D. Greenspan, E. T. Lennette, D. I. Abrams, M. A. Conant, V. Petersen, and U. K. Freese Replication of Epstein-Barr virus within the 49

68 epithelial cells of oral "hairy" leukoplakia, an AIDS-associated lesion. N Engl J Med 313: Grogan, E., H. Jenson, J. Countryman, L. Heston, L. Gradoville, and G. Miller Transfection of a rearranged viral DNA fragment, WZhet, stably converts latent Epstein-Barr viral infection to productive infection in lymphoid cells. Proc Natl Acad Sci U S A 84: Grossman, S. R., E. Johannsen, X. Tong, R. Yalamanchili, and E. Kieff The Epstein-Barr virus nuclear antigen 2 transactivator is directed to response elements by the J kappa recombination signal binding protein. Proc Natl Acad Sci U S A 91: Grundhoff, A., C. S. Sullivan, and D. Ganem A combined computational and microarray-based approach identifies novel micrornas encoded by human gamma-herpesviruses. Rna 12: Guan, M., G. Romano, and E. E. Henderson Epstein-Barr virus (EBV)- induced long-term proliferation of CD4+ lymphocytes leading to T lymphoblastoid cell lines carrying EBV. Anticancer Res 19: Gutsch, D. E., E. A. Holley-Guthrie, Q. Zhang, B. Stein, M. A. Blanar, A. S. Baldwin, and S. C. Kenney The bzip transactivator of Epstein-Barr virus, BZLF1, functionally and physically interacts with the p65 subunit of NF-kappa B. Mol Cell Biol 14: Hamilton-Dutoit, S. J., and G. Pallesen Detection of Epstein-Barr virus small RNAs in routine paraffin sections using non-isotopic RNA/RNA in situ hybridization. Histopathology 25: Harada, S., T. Bechtold, J. K. Seeley, and D. T. Purtilo Cell-mediated immunity to Epstein-Barr virus (EBV) and natural killer (NK)-cell activity in the X- linked lymphoproliferative syndrome. Int J Cancer 30: Harada, S., and E. Kieff Epstein-Barr virus nuclear protein LP stimulates EBNA-2 acidic domain-mediated transcriptional activation. J Virol 71: Harada, S., K. Sakamoto, J. K. Seeley, T. Lindsten, T. Bechtold, J. Yetz, G. Rogers, G. Pearson, and D. T. Purtilo Immune deficiency in the X-linked lymphoproliferative syndrome. I. Epstein-Barr virus-specific defects. J Immunol 129: Hardwick, J. M., P. M. Lieberman, and S. D. Hayward A new Epstein-Barr virus transactivator, R, induces expression of a cytoplasmic early antigen. J Virol 62:

69 123. Harris, R. S., D. S. Croom-Carter, A. B. Rickinson, and M. S. Neuberger Epstein-Barr virus and the somatic hypermutation of immunoglobulin genes in Burkitt's lymphoma cells. J Virol 75: Helminen, M. E., S. Kilpinen, M. Virta, and M. Hurme Susceptibility to primary Epstein-Barr virus infection is associated with interleukin-10 gene promoter polymorphism. J Infect Dis 184: Henderson, S., D. Huen, M. Rowe, C. Dawson, G. Johnson, and A. Rickinson Epstein-Barr virus-coded BHRF1 protein, a viral homologue of Bcl-2, protects human B cells from programmed cell death. Proc Natl Acad Sci U S A 90: Henderson, S., M. Rowe, C. Gregory, D. Croom-Carter, F. Wang, R. Longnecker, E. Kieff, and A. Rickinson Induction of bcl-2 expression by Epstein-Barr virus latent membrane protein 1 protects infected B cells from programmed cell death. Cell 65: Henle, W., G. Henle, J. Andersson, I. Ernberg, G. Klein, C. A. Horwitz, G. Marklund, L. Rymo, C. Wellinder, and S. E. Straus Antibody responses to Epstein-Barr virus-determined nuclear antigen (EBNA)-1 and EBNA-2 in acute and chronic Epstein-Barr virus infection. Proc Natl Acad Sci U S A 84: Henle, W., G. Henle, H. C. Ho, P. Burtin, Y. Cachin, P. Clifford, A. de Schryver, G. de-the, V. Diehl, and G. Klein Antibodies to Epstein-Barr virus in nasopharyngeal carcinoma, other head and neck neoplasms, and control groups. J Natl Cancer Inst 44: Her, C Nasopharyngeal cancer and the Southeast Asian patient. Am Fam Physician 63: Heussinger, N., M. Buttner, G. Ott, E. Brachtel, B. Z. Pilch, E. Kremmer, and G. Niedobitek Expression of the Epstein-Barr virus (EBV)-encoded latent membrane protein 2A (LMP2A) in EBV-associated nasopharyngeal carcinoma. J Pathol 203: Higuchi, M., K. M. Izumi, and E. Kieff Epstein-Barr virus latent-infection membrane proteins are palmitoylated and raft-associated: protein 1 binds to the cytoskeleton through TNF receptor cytoplasmic factors. Proc Natl Acad Sci U S A 98: Hildesheim, A., and P. H. Levine Etiology of nasopharyngeal carcinoma: a review. Epidemiol Rev 15: Hille, J. J., J. Webster-Cyriaque, J. M. Palefski, and N. Raab-Traub Mechanisms of expression of HHV8, EBV and HPV in selected HIV-associated oral lesions. Oral Dis 8 Suppl 2:

70 134. Hino, R., H. Uozaki, Y. Inoue, Y. Shintani, T. Ushiku, T. Sakatani, K. Takada, and M. Fukayama Survival advantage of EBV-associated gastric carcinoma: survivin up-regulation by viral latent membrane protein 2A. Cancer Res 68: Hino, R., H. Uozaki, N. Murakami, T. Ushiku, A. Shinozaki, S. Ishikawa, T. Morikawa, T. Nakaya, T. Sakatani, K. Takada, and M. Fukayama Activation of DNA methyltransferase 1 by EBV latent membrane protein 2A leads to promoter hypermethylation of PTEN gene in gastric carcinoma. Cancer Res 69: Hirsch, F. R., M. Varella-Garcia, J. McCoy, H. West, A. C. Xavier, P. Gumerlock, P. A. Bunn, Jr., W. A. Franklin, J. Crowley, and D. R. Gandara Increased epidermal growth factor receptor gene copy number detected by fluorescence in situ hybridization associates with increased sensitivity to gefitinib in patients with bronchioloalveolar carcinoma subtypes: a Southwest Oncology Group Study. J Clin Oncol 23: Hislop, A. D., N. E. Annels, N. H. Gudgeon, A. M. Leese, and A. B. Rickinson Epitope-specific evolution of human CD8(+) T cell responses from primary to persistent phases of Epstein-Barr virus infection. J Exp Med 195: Hitt, M. M., M. J. Allday, T. Hara, L. Karran, M. D. Jones, P. Busson, T. Tursz, I. Ernberg, and B. E. Griffin EBV gene expression in an NPC-related tumour. Embo J 8: Hjalgrim, H., J. Askling, K. Rostgaard, S. Hamilton-Dutoit, M. Frisch, J. S. Zhang, M. Madsen, N. Rosdahl, H. B. Konradsen, H. H. Storm, and M. Melbye Characteristics of Hodgkin's lymphoma after infectious mononucleosis. N Engl J Med 349: Ho, C. H., C. L. Chen, W. Y. Li, and C. J. Chen Decoy receptor 3, upregulated by Epstein-Barr virus latent membrane protein 1, enhances nasopharyngeal carcinoma cell migration and invasion. Carcinogenesis 30: Ho, C. H., C. F. Hsu, P. F. Fong, S. K. Tai, S. L. Hsieh, and C. J. Chen Epstein-Barr virus transcription activator Rta upregulates decoy receptor 3 expression by binding to its promoter. J Virol 81: Holley-Guthrie, E. A., E. B. Quinlivan, E. C. Mar, and S. Kenney The Epstein-Barr virus (EBV) BMRF1 promoter for early antigen (EA-D) is regulated by the EBV transactivators, BRLF1 and BZLF1, in a cell-specific manner. J Virol 64:

71 143. Hoshikawa, Y., Y. Satoh, M. Murakami, M. Maeta, N. Kaibara, H. Ito, T. Kurata, and T. Sairenji Evidence of lytic infection of Epstein-Barr virus (EBV) in EBV-positive gastric carcinoma. J Med Virol 66: Howe, J. G., and J. A. Steitz Localization of Epstein-Barr virus-encoded small RNAs by in situ hybridization. Proc Natl Acad Sci U S A 83: Hsieh, J. J., and S. D. Hayward Masking of the CBF1/RBPJ kappa transcriptional repression domain by Epstein-Barr virus EBNA2. Science 268: Hsu, D. H., R. de Waal Malefyt, D. F. Fiorentino, M. N. Dang, P. Vieira, J. de Vries, H. Spits, T. R. Mosmann, and K. W. Moore Expression of interleukin-10 activity by Epstein-Barr virus protein BCRF1. Science 250: Hsu, J. L., and S. L. Glaser Epstein-barr virus-associated malignancies: epidemiologic patterns and etiologic implications. Crit Rev Oncol Hematol 34: Huck, K., O. Feyen, T. Niehues, F. Ruschendorf, N. Hubner, H. J. Laws, T. Telieps, S. Knapp, H. H. Wacker, A. Meindl, H. Jumaa, and A. Borkhardt Girls homozygous for an IL-2-inducible T cell kinase mutation that leads to protein deficiency develop fatal EBV-associated lymphoproliferation. J Clin Invest 119: Humme, S., G. Reisbach, R. Feederle, H. J. Delecluse, K. Bousset, W. Hammerschmidt, and A. Schepers The EBV nuclear antigen 1 (EBNA1) enhances B cell immortalization several thousandfold. Proc Natl Acad Sci U S A 100: Hurley, E. A., and D. A. Thorley-Lawson B cell activation and the establishment of Epstein-Barr virus latency. J Exp Med 168: Ikeda, M., A. Ikeda, L. C. Longan, and R. Longnecker The Epstein-Barr virus latent membrane protein 2A PY motif recruits WW domain-containing ubiquitin-protein ligases. Virology 268: Imai, S., S. Koizumi, M. Sugiura, M. Tokunaga, Y. Uemura, N. Yamamoto, S. Tanaka, E. Sato, and T. Osato Gastric carcinoma: monoclonal epithelial malignant cells expressing Epstein-Barr virus latent infection protein. Proc Natl Acad Sci U S A 91: Imai, S., J. Nishikawa, and K. Takada Cell-to-cell contact as an efficient mode of Epstein-Barr virus infection of diverse human epithelial cells. J Virol 72: Imashuku, S., S. Hibi, Y. Tabata, M. Sako, Y. Sekine, K. Hirayama, H. Sakazaki, N. Maeda, H. Kito, H. Shichino, and H. Mugishima Biomarker 53

72 and morphological characteristics of Epstein-Barr virus-related hemophagocytic lymphohistiocytosis. Med Pediatr Oncol 31: Isobe, Y., K. Sugimoto, L. Yang, K. Tamayose, M. Egashira, T. Kaneko, K. Takada, and K. Oshimi Epstein-Barr virus infection of human natural killer cell lines and peripheral blood natural killer cells. Cancer Res 64: Israel, B. F., and S. C. Kenney Virally targeted therapies for EBV-associated malignancies. Oncogene 22: Iwakiri, D., Y. Eizuru, M. Tokunaga, and K. Takada Autocrine growth of Epstein-Barr virus-positive gastric carcinoma cells mediated by an Epstein-Barr virus-encoded small RNA. Cancer Res 63: Iwakiri, D., T. S. Sheen, J. Y. Chen, D. P. Huang, and K. Takada Epstein- Barr virus-encoded small RNA induces insulin-like growth factor 1 and supports growth of nasopharyngeal carcinoma-derived cell lines. Oncogene 24: Izumi, K. M., E. D. Cahir McFarland, A. T. Ting, E. A. Riley, B. Seed, and E. D. Kieff The Epstein-Barr virus oncoprotein latent membrane protein 1 engages the tumor necrosis factor receptor-associated proteins TRADD and receptorinteracting protein (RIP) but does not induce apoptosis or require RIP for NF-kappaB activation. Mol Cell Biol 19: Izumi, K. M., K. M. Kaye, and E. D. Kieff The Epstein-Barr virus LMP1 amino acid sequence that engages tumor necrosis factor receptor associated factors is critical for primary B lymphocyte growth transformation. Proc Natl Acad Sci U S A 94: Jackman, W. T., K. A. Mann, H. J. Hoffmann, and R. R. Spaete Expression of Epstein-Barr virus gp350 as a single chain glycoprotein for an EBV subunit vaccine. Vaccine 17: Jain, D., V. Parkash, M. Li, J. Gill, J. Crouch, G. Howe, and G. Tallini Epstein-Barr virus RNA detection and glandular differentiation in nasopharyngeal carcinoma: report of 2 cases. Arch Pathol Lab Med 124: Jarrett, A. F., A. A. Armstrong, and E. Alexander Epidemiology of EBV and Hodgkin's lymphoma. Ann Oncol 7 Suppl 4: Jarrett, R. F., G. L. Stark, J. White, B. Angus, F. E. Alexander, A. S. Krajewski, J. Freeland, G. M. Taylor, and P. R. Taylor Impact of tumor Epstein-Barr virus status on presenting features and outcome in age-defined subgroups of patients with classic Hodgkin lymphoma: a population-based study. Blood 106:

73 165. Jiang, Y., D. Xu, Y. Zhao, and L. Zhang Mutual inhibition between Kaposi's sarcoma-associated herpesvirus and Epstein-Barr virus lytic replication initiators in dually-infected primary effusion lymphoma. PLoS One 3:e Johannsen, E., C. L. Miller, S. R. Grossman, and E. Kieff EBNA-2 and EBNA-3C extensively and mutually exclusively associate with RBPJkappa in Epstein-Barr virus-transformed B lymphocytes. J Virol 70: Johansen, L. M., C. D. Deppmann, K. D. Erickson, W. F. Coffin, 3rd, T. M. Thornton, S. E. Humphrey, J. M. Martin, and E. J. Taparowsky EBNA2 and activated Notch induce expression of BATF. J Virol 77: Johansson, P., A. Jansson, U. Ruetschi, and L. Rymo Nuclear factorkappab binds to the Epstein-Barr Virus LMP1 promoter and upregulates its expression. J Virol 83: Joncas, J., Y. Monczak, F. Ghibu, C. Alfieri, A. Bonin, G. Ahronheim, and G. Rivard Brief report: killer cell defect and persistent immunological abnormalities in two patients with chronic active Epstein-Barr virus infection. J Med Virol 28: Jorissen, R. N., F. Walker, N. Pouliot, T. P. Garrett, C. W. Ward, and A. W. Burgess Epidermal growth factor receptor: mechanisms of activation and signalling. Exp Cell Res 284: Kanda, T., M. Yajima, N. Ahsan, M. Tanaka, and K. Takada Production of high-titer Epstein-Barr virus recombinants derived from Akata cells by using a bacterial artificial chromosome system. J Virol 78: Kang, G. H., S. Lee, N. Y. Cho, T. Gandamihardja, T. I. Long, D. J. Weisenberger, M. Campan, and P. W. Laird DNA methylation profiles of gastric carcinoma characterized by quantitative DNA methylation analysis. Lab Invest 88: Kang, G. H., S. Lee, W. H. Kim, H. W. Lee, J. C. Kim, M. G. Rhyu, and J. Y. Ro Epstein-barr virus-positive gastric carcinoma demonstrates frequent aberrant methylation of multiple genes and constitutes CpG island methylator phenotypepositive gastric carcinoma. Am J Pathol 160: Kang, M. S., H. Lu, T. Yasui, A. Sharpe, H. Warren, E. Cahir-McFarland, R. Bronson, S. C. Hung, and E. Kieff Epstein-Barr virus nuclear antigen 1 does not induce lymphoma in transgenic FVB mice. Proc Natl Acad Sci U S A 102: Kang, M. S., V. Soni, R. Bronson, and E. Kieff Epstein-Barr virus nuclear antigen 1 does not cause lymphoma in C57BL/6J mice. J Virol 82:

74 176. Kanzler, H., R. Kuppers, M. L. Hansmann, and K. Rajewsky Hodgkin and Reed-Sternberg cells in Hodgkin's disease represent the outgrowth of a dominant tumor clone derived from (crippled) germinal center B cells. J Exp Med 184: Karran, L., Y. Gao, P. R. Smith, and B. E. Griffin Expression of a family of complementary-strand transcripts in Epstein-Barr virus-infected cells. Proc Natl Acad Sci U S A 89: Kasahara, Y., and A. Yachie Cell type specific infection of Epstein-Barr virus (EBV) in EBV-associated hemophagocytic lymphohistiocytosis and chronic active EBV infection. Crit Rev Oncol Hematol 44: Kawanishi, M Epstein-Barr virus induces fragmentation of chromosomal DNA during lytic infection. J Virol 67: Kaye, K. M., K. M. Izumi, and E. Kieff Epstein-Barr virus latent membrane protein 1 is essential for B-lymphocyte growth transformation. Proc Natl Acad Sci U S A 90: Kelly, G., A. Bell, and A. Rickinson Epstein-Barr virus-associated Burkitt lymphomagenesis selects for downregulation of the nuclear antigen EBNA2. Nat Med 8: Kelly, G. L., H. M. Long, J. Stylianou, W. A. Thomas, A. Leese, A. I. Bell, G. W. Bornkamm, J. Mautner, A. B. Rickinson, and M. Rowe An Epstein-Barr virus anti-apoptotic protein constitutively expressed in transformed cells and implicated in burkitt lymphomagenesis: the Wp/BHRF1 link. PLoS Pathog 5:e Kennedy, G., J. Komano, and B. Sugden Epstein-Barr virus provides a survival factor to Burkitt's lymphomas. Proc Natl Acad Sci U S A 100: Kenney, J. L., M. E. Guinness, T. Curiel, and J. Lacy Antisense to the epstein-barr virus (EBV)-encoded latent membrane protein 1 (LMP-1) suppresses LMP-1 and bcl-2 expression and promotes apoptosis in EBV-immortalized B cells. Blood 92: Kenney, S., E. Holley-Guthrie, E. C. Mar, and M. Smith The Epstein-Barr virus BMLF1 promoter contains an enhancer element that is responsive to the BZLF1 and BRLF1 transactivators. J Virol 63: Kenney, S., J. Kamine, E. Holley-Guthrie, J. C. Lin, E. C. Mar, and J. Pagano The Epstein-Barr virus (EBV) BZLF1 immediate-early gene product differentially affects latent versus productive EBV promoters. J Virol 63:

75 187. Khan, G Epstein-Barr virus, cytokines, and inflammation: a cocktail for the pathogenesis of Hodgkin's lymphoma? Exp Hematol 34: Khanna, R., P. Busson, S. R. Burrows, C. Raffoux, D. J. Moss, J. M. Nicholls, and L. Cooper Molecular characterization of antigen-processing function in nasopharyngeal carcinoma (NPC): evidence for efficient presentation of Epstein-Barr virus cytotoxic T-cell epitopes by NPC cells. Cancer Res 58: Khanna, R., D. J. Moss, and S. R. Burrows Vaccine strategies against Epstein-Barr virus-associated diseases: lessons from studies on cytotoxic T-cellmediated immune regulation. Immunol Rev 170: Kieff, E., and A. B. Rickinson Epstein-Barr virus and its replication, p In D. M. Knipe (ed.), Field's virology, 4th ed, vol. 2. Lippincott Williams & Wilkins, Philadelphia Kim do, N., H. S. Chae, S. T. Oh, J. H. Kang, C. H. Park, W. S. Park, K. Takada, J. M. Lee, W. K. Lee, and S. K. Lee Expression of viral micrornas in Epstein-Barr virus-associated gastric carcinoma. J Virol 81: Kim, O. J., and J. L. Yates Mutants of Epstein-Barr virus with a selective marker disrupting the TP gene transform B cells and replicate normally in culture. J Virol 67: Kiss, C., J. Nishikawa, K. Takada, P. Trivedi, G. Klein, and L. Szekely T cell leukemia I oncogene expression depends on the presence of Epstein-Barr virus in the virus-carrying Burkitt lymphoma lines. Proc Natl Acad Sci U S A 100: Kitagawa, N., M. Goto, K. Kurozumi, S. Maruo, M. Fukayama, T. Naoe, M. Yasukawa, K. Hino, T. Suzuki, S. Todo, and K. Takada Epstein-Barr virusencoded poly(a)(-) RNA supports Burkitt's lymphoma growth through interleukin-10 induction. Embo J 19: Knight, J. S., N. Sharma, D. E. Kalman, and E. S. Robertson A cyclinbinding motif within the amino-terminal homology domain of EBNA3C binds cyclin A and modulates cyclin A-dependent kinase activity in Epstein-Barr virus-infected cells. J Virol 78: Komano, J., S. Maruo, K. Kurozumi, T. Oda, and K. Takada Oncogenic role of Epstein-Barr virus-encoded RNAs in Burkitt's lymphoma cell line Akata. J Virol 73: Kulwichit, W., R. H. Edwards, E. M. Davenport, J. F. Baskar, V. Godfrey, and N. Raab-Traub Expression of the Epstein-Barr virus latent membrane protein 1 induces B cell lymphoma in transgenic mice. Proc Natl Acad Sci U S A 95:

76 198. Kuppers, R Molecular biology of Hodgkin's lymphoma. Adv Cancer Res 84: Kuppers, R., K. Rajewsky, M. Zhao, G. Simons, R. Laumann, R. Fischer, and M. L. Hansmann Hodgkin disease: Hodgkin and Reed-Sternberg cells picked from histological sections show clonal immunoglobulin gene rearrangements and appear to be derived from B cells at various stages of development. Proc Natl Acad Sci U S A 91: Kusano, S., and N. Raab-Traub An Epstein-Barr virus protein interacts with Notch. J Virol 75: Laichalk, L. L., and D. A. Thorley-Lawson Terminal differentiation into plasma cells initiates the replicative cycle of Epstein-Barr virus in vivo. J Virol 79: Lee, S. C., S. G. Lim, R. Soo, W. S. Hsieh, J. Y. Guo, T. Putti, Q. Tao, R. Soong, and B. C. Goh Lack of somatic mutations in EGFR tyrosine kinase domain in hepatocellular and nasopharyngeal carcinoma. Pharmacogenet Genomics 16: Lee, S. P., A. T. Chan, S. T. Cheung, W. A. Thomas, D. CroomCarter, C. W. Dawson, C. H. Tsai, S. F. Leung, P. J. Johnson, and D. P. Huang CTL control of EBV in nasopharyngeal carcinoma (NPC): EBV-specific CTL responses in the blood and tumors of NPC patients and the antigen-processing function of the tumor cells. J Immunol 165: Lemon, S. M., L. M. Hutt, J. E. Shaw, J. L. Li, and J. S. Pagano Replication of EBV in epithelial cells during infectious mononucleosis. Nature 268: Lemon, S. M., L. M. Hutt, J. E. Shaw, J. L. Li, and J. S. Pagano Replication of Epstein-Barr virus DNA in epithelial cells in vivo. IARC Sci Publ: Levitskaya, J., M. Coram, V. Levitsky, S. Imreh, P. M. Steigerwald-Mullen, G. Klein, M. G. Kurilla, and M. G. Masucci Inhibition of antigen processing by the internal repeat region of the Epstein-Barr virus nuclear antigen-1. Nature 375: Levitskaya, J., A. Sharipo, A. Leonchiks, A. Ciechanover, and M. G. Masucci Inhibition of ubiquitin/proteasome-dependent protein degradation by the Gly- Ala repeat domain of the Epstein-Barr virus nuclear antigen 1. Proc Natl Acad Sci U S A 94:

77 208. Li, A., X. S. Zhang, J. H. Jiang, H. H. Wang, X. Q. Liu, Z. G. Pan, and Y. X. Zeng Transcriptional expression of RPMS1 in nasopharyngeal carcinoma and its oncogenic potential. Cell Cycle 4: Li, D., L. Qian, C. Chen, M. Shi, M. Yu, M. Hu, L. Song, B. Shen, and N. Guo Down-regulation of MHC class II expression through inhibition of CIITA transcription by lytic transactivator Zta during Epstein-Barr virus reactivation. J Immunol 182: Li, J. H., W. Shi, M. Chia, O. Sanchez-Sweatman, C. Siatskas, D. Huang, P. Busson, H. Klamut, W. C. Yeh, C. Richardson, B. O'Sullivan, P. Gullane, P. Neligan, J. Medin, and F. F. Liu Efficacy of targeted FasL in nasopharyngeal carcinoma. Mol Ther 8: Li, Q., M. K. Spriggs, S. Kovats, S. M. Turk, M. R. Comeau, B. Nepom, and L. M. Hutt-Fletcher Epstein-Barr virus uses HLA class II as a cofactor for infection of B lymphocytes. J Virol 71: Li, Q. X., L. S. Young, G. Niedobitek, C. W. Dawson, M. Birkenbach, F. Wang, and A. B. Rickinson Epstein-Barr virus infection and replication in a human epithelial cell system. Nature 356: Li, Z., S. Van Calcar, C. Qu, W. K. Cavenee, M. Q. Zhang, and B. Ren A global transcriptional regulatory role for c-myc in Burkitt's lymphoma cells. Proc Natl Acad Sci U S A 100: Liebowitz, D Epstein-Barr virus and a cellular signaling pathway in lymphomas from immunosuppressed patients. N Engl J Med 338: Liebowitz, D., R. Kopan, E. Fuchs, J. Sample, and E. Kieff An Epstein-Barr virus transforming protein associates with vimentin in lymphocytes. Mol Cell Biol 7: Liebowitz, D., D. Wang, and E. Kieff Orientation and patching of the latent infection membrane protein encoded by Epstein-Barr virus. J Virol 58: Lin, C. L., W. F. Lo, T. H. Lee, Y. Ren, S. L. Hwang, Y. F. Cheng, C. L. Chen, Y. S. Chang, S. P. Lee, A. B. Rickinson, and P. K. Tam Immunization with Epstein-Barr Virus (EBV) peptide-pulsed dendritic cells induces functional CD8+ T- cell immunity and may lead to tumor regression in patients with EBV-positive nasopharyngeal carcinoma. Cancer Res 62: Lin, J. C., N. D. Sista, F. Besencon, J. Kamine, and J. S. Pagano Identification and functional characterization of Epstein-Barr virus DNA polymerase by in vitro transcription-translation of a cloned gene. J Virol 65:

78 219. Lindsten, T., J. K. Seeley, M. Ballow, K. Sakamoto, S. St Onge, J. Yetz, P. Aman, and D. T. Purtilo Immune deficiency in the X-linked lymphoproliferative syndrome. II. Immunoregulatory T cell defects. J Immunol 129: Lindstrom, M. S., U. Klangby, and K. G. Wiman p14arf homozygous deletion or MDM2 overexpression in Burkitt lymphoma lines carrying wild type p53. Oncogene 20: Lindstrom, M. S., and K. G. Wiman Role of genetic and epigenetic changes in Burkitt lymphoma. Semin Cancer Biol 12: Ling, P. D., R. S. Peng, A. Nakajima, J. H. Yu, J. Tan, S. M. Moses, W. H. Yang, B. Zhao, E. Kieff, K. D. Bloch, and D. B. Bloch Mediation of Epstein-Barr virus EBNA-LP transcriptional coactivation by Sp100. Embo J 24: Liu, P., and S. H. Speck Synergistic autoactivation of the Epstein-Barr virus immediate-early BRLF1 promoter by Rta and Zta. Virology 310: Lo, A. K., K. F. To, K. W. Lo, R. W. Lung, J. W. Hui, G. Liao, and S. D. Hayward Modulation of LMP1 protein expression by EBV-encoded micrornas. Proc Natl Acad Sci U S A 104: Lockey, T. D., X. Zhan, S. Surman, C. E. Sample, and J. L. Hurwitz Epstein-Barr virus vaccine development: a lytic and latent protein cocktail. Front Biosci 13: Longnecker, R Epstein-Barr virus latency: LMP2, a regulator or means for Epstein-Barr virus persistence? Adv Cancer Res 79: Longnecker, R., C. L. Miller, X. Q. Miao, A. Marchini, and E. Kieff The only domain which distinguishes Epstein-Barr virus latent membrane protein 2A (LMP2A) from LMP2B is dispensable for lymphocyte infection and growth transformation in vitro; LMP2A is therefore nonessential. J Virol 66: Longnecker, R., C. L. Miller, B. Tomkinson, X. Q. Miao, and E. Kieff Deletion of DNA encoding the first five transmembrane domains of Epstein-Barr virus latent membrane proteins 2A and 2B. J Virol 67: Lopes, V., L. S. Young, and P. G. Murray Epstein-Barr virus-associated cancers: aetiology and treatment. Herpes 10: Lu, F., A. Weidmer, C. G. Liu, S. Volinia, C. M. Croce, and P. M. Lieberman Epstein-Barr virus-induced mir-155 attenuates NF-kappaB signaling and stabilizes latent virus persistence. J Virol 82:

79 231. Lu, S. J., N. E. Day, L. Degos, V. Lepage, P. C. Wang, S. H. Chan, M. Simons, B. McKnight, D. Easton, Y. Zeng, and et al Linkage of a nasopharyngeal carcinoma susceptibility locus to the HLA region. Nature 346: Luftig, M., T. Yasui, V. Soni, M. S. Kang, N. Jacobson, E. Cahir-McFarland, B. Seed, and E. Kieff Epstein-Barr virus latent infection membrane protein 1 TRAF-binding site induces NIK/IKK alpha-dependent noncanonical NF-kappaB activation. Proc Natl Acad Sci U S A 101: Lunemann, J. D., P. Huppke, S. Roberts, W. Bruck, J. Gartner, and C. Munz Broadened and elevated humoral immune response to EBNA1 in pediatric multiple sclerosis. Neurology 71: Lunemann, J. D., I. Jelcic, S. Roberts, A. Lutterotti, B. Tackenberg, R. Martin, and C. Munz EBNA1-specific T cells from patients with multiple sclerosis cross react with myelin antigens and co-produce IFN-gamma and IL-2. J Exp Med 205: Lunemann, J. D., T. Kamradt, R. Martin, and C. Munz Epstein-barr virus: environmental trigger of multiple sclerosis? J Virol 81: Mackett, M., M. J. Conway, J. R. Arrand, R. S. Haddad, and L. M. Hutt- Fletcher Characterization and expression of a glycoprotein encoded by the Epstein-Barr virus BamHI I fragment. J Virol 64: Maeda, A., H. Wakiguchi, W. Yokoyama, H. Hisakawa, T. Tomoda, and T. Kurashige Persistently high Epstein-Barr virus (EBV) loads in peripheral blood lymphocytes from patients with chronic active EBV infection. J Infect Dis 179: Magrath, I The pathogenesis of Burkitt's lymphoma. Adv Cancer Res 55: Mainou, B. A., D. N. Everly, Jr., and N. Raab-Traub Epstein-Barr virus latent membrane protein 1 CTAR1 mediates rodent and human fibroblast transformation through activation of PI3K. Oncogene 24: Mainou, B. A., D. N. Everly, Jr., and N. Raab-Traub Unique signaling properties of CTAR1 in LMP1-mediated transformation. J Virol 81: Mann, K. P., D. Staunton, and D. A. Thorley-Lawson Epstein-Barr virusencoded protein found in plasma membranes of transformed cells. J Virol 55: Mann, K. P., and D. Thorley-Lawson Posttranslational processing of the Epstein-Barr virus-encoded p63/lmp protein. J Virol 61:

80 243. Mannick, J. B., J. I. Cohen, M. Birkenbach, A. Marchini, and E. Kieff The Epstein-Barr virus nuclear protein encoded by the leader of the EBNA RNAs is important in B-lymphocyte transformation. J Virol 65: Marchini, A., J. I. Cohen, F. Wang, and E. Kieff A selectable marker allows investigation of a nontransforming Epstein-Barr virus mutant. J Virol 66: Martin, J., and B. Sugden Transformation by the oncogenic latent membrane protein correlates with its rapid turnover, membrane localization, and cytoskeletal association. J Virol 65: Maruyama, R., K. Akino, M. Toyota, H. Suzuki, T. Imai, M. Ohe-Toyota, E. Yamamoto, M. Nojima, T. Fujikane, Y. Sasaki, T. Yamashita, Y. Watanabe, H. Hiratsuka, K. Hirata, F. Itoh, K. Imai, Y. Shinomura, and T. Tokino Cytoplasmic RASSF2A is a proapoptotic mediator whose expression is epigenetically silenced in gastric cancer. Carcinogenesis 29: Matsuda, G., K. Nakajima, Y. Kawaguchi, Y. Yamanashi, and K. Hirai Epstein-Barr virus (EBV) nuclear antigen leader protein (EBNA-LP) forms complexes with a cellular anti-apoptosis protein Bcl-2 or its EBV counterpart BHRF1 through HS1-associated protein X-1. Microbiol Immunol 47: McAulay, K. A., C. D. Higgins, K. F. Macsween, A. Lake, R. F. Jarrett, F. L. Robertson, H. Williams, and D. H. Crawford HLA class I polymorphisms are associated with development of infectious mononucleosis upon primary EBV infection. J Clin Invest 117: Miller, N., and L. M. Hutt-Fletcher Epstein-Barr virus enters B cells and epithelial cells by different routes. J Virol 66: Miller, W. E., J. L. Cheshire, and N. Raab-Traub Interaction of tumor necrosis factor receptor-associated factor signaling proteins with the latent membrane protein 1 PXQXT motif is essential for induction of epidermal growth factor receptor expression. Mol Cell Biol 18: Miller, W. E., H. S. Earp, and N. Raab-Traub The Epstein-Barr virus latent membrane protein 1 induces expression of the epidermal growth factor receptor. J Virol 69: Miller, W. E., R. H. Edwards, D. M. Walling, and N. Raab-Traub Sequence variation in the Epstein-Barr virus latent membrane protein 1. J Gen Virol 75 ( Pt 10): Miller, W. E., G. Mosialos, E. Kieff, and N. Raab-Traub Epstein-Barr virus LMP1 induction of the epidermal growth factor receptor is mediated through a TRAF signaling pathway distinct from NF-kappaB activation. J Virol 71:

81 254. Miller, W. E., and N. Raab-Traub The EGFR as a target for viral oncoproteins. Trends Microbiol 7: Miyashita, E. M., B. Yang, G. J. Babcock, and D. A. Thorley-Lawson Identification of the site of Epstein-Barr virus persistence in vivo as a resting B cell. J Virol 71: Molesworth, S. J., C. M. Lake, C. M. Borza, S. M. Turk, and L. M. Hutt- Fletcher Epstein-Barr virus gh is essential for penetration of B cells but also plays a role in attachment of virus to epithelial cells. J Virol 74: Moore, K. W., P. Vieira, D. F. Fiorentino, M. L. Trounstine, T. A. Khan, and T. R. Mosmann Homology of cytokine synthesis inhibitory factor (IL-10) to the Epstein-Barr virus gene BCRFI. Science 248: Moorthy, R. K., and D. A. Thorley-Lawson Biochemical, genetic, and functional analyses of the phosphorylation sites on the Epstein-Barr virus-encoded oncogenic latent membrane protein LMP-1. J Virol 67: Moroni, M., S. Veronese, S. Benvenuti, G. Marrapese, A. Sartore-Bianchi, F. Di Nicolantonio, M. Gambacorta, S. Siena, and A. Bardelli Gene copy number for epidermal growth factor receptor (EGFR) and clinical response to antiegfr treatment in colorectal cancer: a cohort study. Lancet Oncol 6: Morrison, J. A., A. J. Klingelhutz, and N. Raab-Traub Epstein-Barr virus latent membrane protein 2A activates beta-catenin signaling in epithelial cells. J Virol 77: Morrison, J. A., and N. Raab-Traub Roles of the ITAM and PY motifs of Epstein-Barr virus latent membrane protein 2A in the inhibition of epithelial cell differentiation and activation of {beta}-catenin signaling. J Virol 79: Morrison, T. E., and S. C. Kenney BZLF1, an Epstein-Barr virus immediateearly protein, induces p65 nuclear translocation while inhibiting p65 transcriptional function. Virology 328: Morrison, T. E., A. Mauser, A. Klingelhutz, and S. C. Kenney Epstein-Barr virus immediate-early protein BZLF1 inhibits tumor necrosis factor alpha-induced signaling and apoptosis by downregulating tumor necrosis factor receptor 1. J Virol 78: Morrison, T. E., A. Mauser, A. Wong, J. P. Ting, and S. C. Kenney Inhibition of IFN-gamma signaling by an Epstein-Barr virus immediate-early protein. Immunity 15:

82 265. Mosialos, G., M. Birkenbach, R. Yalamanchili, T. VanArsdale, C. Ware, and E. Kieff The Epstein-Barr virus transforming protein LMP1 engages signaling proteins for the tumor necrosis factor receptor family. Cell 80: Moss, D. J., A. Suhrbier, and S. L. Elliott Candidate vaccines for Epstein- Barr virus. Bmj 317: Motsch, N., T. Pfuhl, J. Mrazek, S. Barth, and F. A. Grasser Epstein-Barr virus-encoded latent membrane protein 1 (LMP1) induces the expression of the cellular microrna mir-146a. RNA Biol 4: Moutschen, M., P. Leonard, E. M. Sokal, F. Smets, M. Haumont, P. Mazzu, A. Bollen, F. Denamur, P. Peeters, G. Dubin, and M. Denis Phase I/II studies to evaluate safety and immunogenicity of a recombinant gp350 Epstein-Barr virus vaccine in healthy adults. Vaccine 25: Muromoto, R., O. Ikeda, K. Okabe, S. Togi, S. Kamitani, M. Fujimuro, S. Harada, K. Oritani, and T. Matsuda Epstein-Barr virus-derived EBNA2 regulates STAT3 activation. Biochem Biophys Res Commun 378: Murray, P. G., L. J. Swinnen, C. M. Constandinou, J. M. Pyle, T. J. Carr, J. M. Hardwick, and R. F. Ambinder BCL-2 but not its Epstein-Barr virusencoded homologue, BHRF1, is commonly expressed in posttransplantation lymphoproliferative disorders. Blood 87: Nachmani, D., N. Stern-Ginossar, R. Sarid, and O. Mandelboim Diverse herpesvirus micrornas target the stress-induced immune ligand MICB to escape recognition by natural killer cells. Cell Host Microbe 5: Nanbo, A., K. Inoue, K. Adachi-Takasawa, and K. Takada Epstein-Barr virus RNA confers resistance to interferon-alpha-induced apoptosis in Burkitt's lymphoma. Embo J 21: Nanbo, A., H. Yoshiyama, and K. Takada Epstein-Barr virus-encoded poly(a)- RNA confers resistance to apoptosis mediated through Fas by blocking the PKR pathway in human epithelial intestine 407 cells. J Virol 79: Nemerow, G. R., R. Wolfert, M. E. McNaughton, and N. R. Cooper Identification and characterization of the Epstein-Barr virus receptor on human B lymphocytes and its relationship to the C3d complement receptor (CR2). J Virol 55: Nichols, K. E., J. Hom, S. Y. Gong, A. Ganguly, C. S. Ma, J. L. Cannons, S. G. Tangye, P. L. Schwartzberg, G. A. Koretzky, and P. L. Stein Regulation of NKT cell development by SAP, the protein defective in XLP. Nat Med 11:

83 276. Nichols, K. E., C. S. Ma, J. L. Cannons, P. L. Schwartzberg, and S. G. Tangye Molecular and cellular pathogenesis of X-linked lymphoproliferative disease. Immunol Rev 203: Niederman, J. C Infectious mononucleosis: observations on transmission. Yale J Biol Med 55: Niedobitek, G., A. Agathanggelou, H. Herbst, L. Whitehead, D. H. Wright, and L. S. Young Epstein-Barr virus (EBV) infection in infectious mononucleosis: virus latency, replication and phenotype of EBV-infected cells. J Pathol 182: Niens, M., R. F. Jarrett, B. Hepkema, I. M. Nolte, A. Diepstra, M. Platteel, N. Kouprie, C. P. Delury, A. Gallagher, L. Visser, S. Poppema, G. J. te Meerman, and A. van den Berg HLA-A*02 is associated with a reduced risk and HLA- A*01 with an increased risk of developing EBV+ Hodgkin lymphoma. Blood 110: Niller, H. H., H. Wolf, and J. Minarovits Epigenetic dysregulation of the host cell genome in Epstein-Barr virus-associated neoplasia. Semin Cancer Biol 19: Nitsche, F., A. Bell, and A. Rickinson Epstein-Barr virus leader protein enhances EBNA-2-mediated transactivation of latent membrane protein 1 expression: a role for the W1W2 repeat domain. J Virol 71: Norseen, J., F. B. Johnson, and P. M. Lieberman A Role for G-Quadruplex RNA Binding by Epstein-Barr Virus Nuclear Antigen 1 (EBNA1) In DNA Replication and Metaphase Chromosome Attachment. J Virol Norseen, J., A. Thomae, V. Sridharan, A. Aiyar, A. Schepers, and P. M. Lieberman RNA-dependent recruitment of the origin recognition complex. Embo J 27: Oda, T., S. Imai, S. Chiba, and K. Takada Epstein-Barr virus lacking glycoprotein gp85 cannot infect B cells and epithelial cells. Virology 276: Ohno, S., J. Luka, T. Lindahl, and G. Klein Identification of a purified complement-fixing antigen as the Epstein-Barr-virus determined nuclear antigen (EBNA) by its binding to metaphase chromosomes. Proc Natl Acad Sci U S A 74: Ohshima, K., J. Suzumiya, M. Sugihara, S. Nagafuchi, S. Ohga, and M. Kikuchi Clinicopathological study of severe chronic active Epstein-Barr virus infection that developed in association with lymphoproliferative disorder and/or hemophagocytic syndrome. Pathol Int 48:

84 287. Okano, M The evolving therapeutic approaches for Epstein-Barr virus infection in immunocompetent and immunocompromised individuals. Curr Drug Targets Immune Endocr Metabol Disord 3: Okano, M., and T. G. Gross Advanced therapeutic and prophylactic strategies for Epstein-Barr virus infection in immunocompromised patients. Expert Rev Anti Infect Ther 5: Okano, M., S. Matsumoto, T. Osato, Y. Sakiyama, G. M. Thiele, and D. T. Purtilo Severe chronic active Epstein-Barr virus infection syndrome. Clin Microbiol Rev 4: Paine, E., R. I. Scheinman, A. S. Baldwin, Jr., and N. Raab-Traub Expression of LMP1 in epithelial cells leads to the activation of a select subset of NFkappa B/Rel family proteins. J Virol 69: Pan, J., L. Kong, S. Lin, G. Chen, Q. Chen, and J. J. Lu The clinical significance of coexpression of cyclooxygenases-2, vascular endothelial growth factors, and epidermal growth factor receptor in nasopharyngeal carcinoma. Laryngoscope 118: Parker, G. A., T. Crook, M. Bain, E. A. Sara, P. J. Farrell, and M. J. Allday Epstein-Barr virus nuclear antigen (EBNA)3C is an immortalizing oncoprotein with similar properties to adenovirus E1A and papillomavirus E7. Oncogene 13: Parker, G. A., R. Touitou, and M. J. Allday Epstein-Barr virus EBNA3C can disrupt multiple cell cycle checkpoints and induce nuclear division divorced from cytokinesis. Oncogene 19: Pasquier, B., L. Yin, M. C. Fondaneche, F. Relouzat, C. Bloch-Queyrat, N. Lambert, A. Fischer, G. de Saint-Basile, and S. Latour Defective NKT cell development in mice and humans lacking the adapter SAP, the X-linked lymphoproliferative syndrome gene product. J Exp Med 201: Pathmanathan, R., U. Prasad, G. Chandrika, R. Sadler, K. Flynn, and N. Raab- Traub Undifferentiated, nonkeratinizing, and squamous cell carcinoma of the nasopharynx. Variants of Epstein-Barr virus-infected neoplasia. Am J Pathol 146: Pathmanathan, R., U. Prasad, R. Sadler, K. Flynn, and N. Raab-Traub Clonal proliferations of cells infected with Epstein-Barr virus in preinvasive lesions related to nasopharyngeal carcinoma. N Engl J Med 333: Pattle, S. B., and P. J. Farrell The role of Epstein-Barr virus in cancer. Expert Opin Biol Ther 6:

85 298. Pender, M. P., P. A. Csurhes, A. Lenarczyk, C. M. Pfluger, and S. R. Burrows Decreased T cell reactivity to Epstein-Barr virus infected lymphoblastoid cell lines in multiple sclerosis. J Neurol Neurosurg Psychiatry 80: Peng, R., J. Tan, and P. D. Ling Conserved regions in the Epstein-Barr virus leader protein define distinct domains required for nuclear localization and transcriptional cooperation with EBNA2. J Virol 74: Pfeffer, S., A. Sewer, M. Lagos-Quintana, R. Sheridan, C. Sander, F. A. Grasser, L. F. van Dyk, C. K. Ho, S. Shuman, M. Chien, J. J. Russo, J. Ju, G. Randall, B. D. Lindenbach, C. M. Rice, V. Simon, D. D. Ho, M. Zavolan, and T. Tuschl Identification of micrornas of the herpesvirus family. Nat Methods 2: Pfeffer, S., M. Zavolan, F. A. Grasser, M. Chien, J. J. Russo, J. Ju, B. John, A. J. Enright, D. Marks, C. Sander, and T. Tuschl Identification of virus-encoded micrornas. Science 304: Piche, A., K. Kasono, F. Johanning, T. J. Curiel, and D. T. Curiel Phenotypic knock-out of the latent membrane protein 1 of Epstein-Barr virus by an intracellular single-chain antibody. Gene Ther 5: Polack, A., K. Hortnagel, A. Pajic, B. Christoph, B. Baier, M. Falk, J. Mautner, C. Geltinger, G. W. Bornkamm, and B. Kempkes c-myc activation renders proliferation of Epstein-Barr virus (EBV)-transformed cells independent of EBV nuclear antigen 2 and latent membrane protein 1. Proc Natl Acad Sci U S A 93: Poole, B. D., A. K. Templeton, J. M. Guthridge, E. J. Brown, J. B. Harley, and J. A. James Aberrant Epstein-Barr viral infection in systemic lupus erythematosus. Autoimmun Rev 8: Pope, J. H., B. G. Achong, M. A. Epstein, and J. Biddulph Burkitt lymphoma in New Guinea: establishment of a line of lymphoblasts in vitro and description of their fine structure. J Natl Cancer Inst 39: Poppema, S., and A. van den Berg Interaction between host T cells and Reed-Sternberg cells in Hodgkin lymphomas. Semin Cancer Biol 10: Portis, T., P. Dyck, and R. Longnecker Epstein-Barr Virus (EBV) LMP2A induces alterations in gene transcription similar to those observed in Reed-Sternberg cells of Hodgkin lymphoma. Blood 102: Portis, T., and R. Longnecker Epstein-Barr virus LMP2A interferes with global transcription factor regulation when expressed during B-lymphocyte development. J Virol 77:

86 309. Raab-Traub, N Epstein-Barr virus in the pathogenesis of NPC. Semin Cancer Biol 12: Raab-Traub, N., T. Dambaugh, and E. Kieff DNA of Epstein-Barr virus VIII: B95-8, the previous prototype, is an unusual deletion derivative. Cell 22: Raab-Traub, N., and K. Flynn The structure of the termini of the Epstein- Barr virus as a marker of clonal cellular proliferation. Cell 47: Raab-Traub, N., R. Hood, C. S. Yang, B. Henry, 2nd, and J. S. Pagano Epstein-Barr virus transcription in nasopharyngeal carcinoma. J Virol 48: Raab-Traub, N., R. Pritchett, and E. Kieff DNA of Epstein-Barr virus. III. Identification of restriction enzyme fragments that contain DNA sequences which differ among strains of Epstein-Barr virus. J Virol 27: Radkov, S. A., R. Touitou, A. Brehm, M. Rowe, M. West, T. Kouzarides, and M. J. Allday Epstein-Barr virus nuclear antigen 3C interacts with histone deacetylase to repress transcription. J Virol 73: Ragoczy, T., L. Heston, and G. Miller The Epstein-Barr virus Rta protein activates lytic cycle genes and can disrupt latency in B lymphocytes. J Virol 72: Rahadiani, N., T. Takakuwa, K. Tresnasari, E. Morii, and K. Aozasa Latent membrane protein-1 of Epstein-Barr virus induces the expression of B-cell integration cluster, a precursor form of microrna-155, in B lymphoma cell lines. Biochem Biophys Res Commun 377: Rechsteiner, M. P., C. Berger, L. Zauner, J. A. Sigrist, M. Weber, R. Longnecker, M. Bernasconi, and D. Nadal Latent membrane protein 2B regulates susceptibility to induction of lytic Epstein-Barr virus infection. J Virol 82: Riese, D. J., 2nd, R. M. Gallo, and J. Settleman Mutational activation of ErbB family receptor tyrosine kinases: insights into mechanisms of signal transduction and tumorigenesis. Bioessays 29: Rigaud, S., M. C. Fondaneche, N. Lambert, B. Pasquier, V. Mateo, P. Soulas, L. Galicier, F. Le Deist, F. Rieux-Laucat, P. Revy, A. Fischer, G. de Saint Basile, and S. Latour XIAP deficiency in humans causes an X-linked lymphoproliferative syndrome. Nature 444:

87 320. Roberts, M. L., and N. R. Cooper Activation of a ras-mapk-dependent pathway by Epstein-Barr virus latent membrane protein 1 is essential for cellular transformation. Virology 240: Robertson, E. S Epstein-Barr virus. Caister Academic Press, Wymondham, Norfolk, England Robertson, E. S., J. Lin, and E. Kieff The amino-terminal domains of Epstein-Barr virus nuclear proteins 3A, 3B, and 3C interact with RBPJ(kappa). J Virol 70: Robertson, E. S., B. Tomkinson, and E. Kieff An Epstein-Barr virus with a 58-kilobase-pair deletion that includes BARF0 transforms B lymphocytes in vitro. J Virol 68: Rooney, C. M., C. A. Smith, C. Y. Ng, S. Loftin, C. Li, R. A. Krance, M. K. Brenner, and H. E. Heslop Use of gene-modified virus-specific T lymphocytes to control Epstein-Barr-virus-related lymphoproliferation. Lancet 345: Rouphael, N. G., N. J. Talati, C. Vaughan, K. Cunningham, R. Moreira, and C. Gould Infections associated with haemophagocytic syndrome. Lancet Infect Dis 7: Rovedo, M., and R. Longnecker Epstein-barr virus latent membrane protein 2B (LMP2B) modulates LMP2A activity. J Virol 81: Rowe, M., D. T. Rowe, C. D. Gregory, L. S. Young, P. J. Farrell, H. Rupani, and A. B. Rickinson Differences in B cell growth phenotype reflect novel patterns of Epstein-Barr virus latent gene expression in Burkitt's lymphoma cells. Embo J 6: Ruf, I. K., K. A. Lackey, S. Warudkar, and J. T. Sample Protection from interferon-induced apoptosis by Epstein-Barr virus small RNAs is not mediated by inhibition of PKR. J Virol 79: Ruf, I. K., P. W. Rhyne, C. Yang, J. L. Cleveland, and J. T. Sample Epstein-Barr virus small RNAs potentiate tumorigenicity of Burkitt lymphoma cells independently of an effect on apoptosis. J Virol 74: Sadler, R. H., and N. Raab-Traub The Epstein-Barr virus 3.5-kilobase latent membrane protein 1 mrna initiates from a TATA-Less promoter within the first terminal repeat. J Virol 69: Sadler, R. H., and N. Raab-Traub Structural analyses of the Epstein-Barr virus BamHI A transcripts. J Virol 69:

88 332. Sakai, T., Y. Taniguchi, K. Tamura, S. Minoguchi, T. Fukuhara, L. J. Strobl, U. Zimber-Strobl, G. W. Bornkamm, and T. Honjo Functional replacement of the intracellular region of the Notch1 receptor by Epstein-Barr virus nuclear antigen 2. J Virol 72: Sakuma, K., J. M. Chong, M. Sudo, T. Ushiku, Y. Inoue, J. Shibahara, H. Uozaki, H. Nagai, and M. Fukayama High-density methylation of p14arf and p16ink4a in Epstein-Barr virus-associated gastric carcinoma. Int J Cancer 112: Salek-Ardakani, S., J. R. Arrand, and M. Mackett Epstein-Barr virus encoded interleukin-10 inhibits HLA-class I, ICAM-1, and B7 expression on human monocytes: implications for immune evasion by EBV. Virology 304: Sall, A., S. Caserta, P. Jolicoeur, L. Franqueville, M. de Turenne-Tessier, and T. Ooka Mitogenic activity of Epstein-Barr virus-encoded BARF1 protein. Oncogene 23: Sample, J., M. Hummel, D. Braun, M. Birkenbach, and E. Kieff Nucleotide sequences of mrnas encoding Epstein-Barr virus nuclear proteins: a probable transcriptional initiation site. Proc Natl Acad Sci U S A 83: Savard, M., C. Belanger, M. Tardif, P. Gourde, L. Flamand, and J. Gosselin Infection of primary human monocytes by Epstein-Barr virus. J Virol 74: Savoldo, B., J. A. Goss, M. M. Hammer, L. Zhang, T. Lopez, A. P. Gee, Y. F. Lin, R. E. Quiros-Tejeira, P. Reinke, S. Schubert, S. Gottschalk, M. J. Finegold, M. K. Brenner, C. M. Rooney, and H. E. Heslop Treatment of solid organ transplant recipients with autologous Epstein Barr virus-specific cytotoxic T lymphocytes (CTLs). Blood 108: Schepers, A., D. Pich, and W. Hammerschmidt A transcription factor with homology to the AP-1 family links RNA transcription and DNA replication in the lytic cycle of Epstein-Barr virus. Embo J 12: Scholle, F., K. M. Bendt, and N. Raab-Traub Epstein-Barr virus LMP2A transforms epithelial cells, inhibits cell differentiation, and activates Akt. J Virol 74: Scholle, F., R. Longnecker, and N. Raab-Traub Epithelial cell adhesion to extracellular matrix proteins induces tyrosine phosphorylation of the Epstein-Barr virus latent membrane protein 2: a role for C-terminal Src kinase. J Virol 73:

89 342. Schwarzmann, F., R. von Baehr, M. Jager, N. Prang, S. Bohm, U. Reischl, H. Wolf, and W. P. Bieger A case of severe chronic active infection with Epstein-Barr virus: immunologic deficiencies associated with a lytic virus strain. Clin Infect Dis 29: Schwering, I., A. Brauninger, U. Klein, B. Jungnickel, M. Tinguely, V. Diehl, M. L. Hansmann, R. Dalla-Favera, K. Rajewsky, and R. Kuppers Loss of the B-lineage-specific gene expression program in Hodgkin and Reed-Sternberg cells of Hodgkin lymphoma. Blood 101: Seemayer, T. A., T. G. Gross, R. M. Egeler, S. J. Pirruccello, J. R. Davis, C. M. Kelly, M. Okano, A. Lanyi, and J. Sumegi X-linked lymphoproliferative disease: twenty-five years after the discovery. Pediatr Res 38: Shair, K. H., C. I. Schnegg, and N. Raab-Traub EBV latent membrane protein 1 effects on plakoglobin, cell growth, and migration. Cancer Res 68: Shair, K. H., C. I. Schnegg, and N. Raab-Traub Epstein-Barr virus latent membrane protein-1 effects on junctional plakoglobin and induction of a cadherin switch. Cancer Res 69: Shanmugaratnam, K Histological typing of nasopharyngeal carcinoma. IARC Sci Publ: Sharp, T. V., M. Schwemmle, I. Jeffrey, K. Laing, H. Mellor, C. G. Proud, K. Hilse, and M. J. Clemens Comparative analysis of the regulation of the interferon-inducible protein kinase PKR by Epstein-Barr virus RNAs EBER-1 and EBER-2 and adenovirus VAI RNA. Nucleic Acids Res 21: Sheen, T. S., Y. T. Huang, Y. L. Chang, J. Y. Ko, C. S. Wu, Y. C. Yu, C. H. Tsai, and M. M. Hsu Epstein-Barr virus-encoded latent membrane protein 1 coexpresses with epidermal growth factor receptor in nasopharyngeal carcinoma. Jpn J Cancer Res 90: Sheng, W., G. Decaussin, A. Ligout, K. Takada, and T. Ooka Malignant transformation of Epstein-Barr virus-negative Akata cells by introduction of the BARF1 gene carried by Epstein-Barr virus. J Virol 77: Sheng, W., G. Decaussin, S. Sumner, and T. Ooka N-terminal domain of BARF1 gene encoded by Epstein-Barr virus is essential for malignant transformation of rodent fibroblasts and activation of BCL-2. Oncogene 20: Sinclair, A. J., I. Palmero, A. Holder, G. Peters, and P. J. Farrell Expression of cyclin D2 in Epstein-Barr virus-positive Burkitt's lymphoma cell lines is related to methylation status of the gene. J Virol 69:

90 353. Sinclair, A. J., I. Palmero, G. Peters, and P. J. Farrell EBNA-2 and EBNA- LP cooperate to cause G0 to G1 transition during immortalization of resting human B lymphocytes by Epstein-Barr virus. Embo J 13: Sitki-Green, D., M. Covington, and N. Raab-Traub Compartmentalization and transmission of multiple epstein-barr virus strains in asymptomatic carriers. J Virol 77: Sitki-Green, D., R. H. Edwards, J. Webster-Cyriaque, and N. Raab-Traub Identification of Epstein-Barr virus strain variants in hairy leukoplakia and peripheral blood by use of a heteroduplex tracking assay. J Virol 76: Sitki-Green, D. L., R. H. Edwards, M. M. Covington, and N. Raab-Traub Biology of Epstein-Barr virus during infectious mononucleosis. J Infect Dis 189: Sixbey, J. W., J. G. Nedrud, N. Raab-Traub, R. A. Hanes, and J. S. Pagano Epstein-Barr virus replication in oropharyngeal epithelial cells. N Engl J Med 310: Sixbey, J. W., E. H. Vesterinen, J. G. Nedrud, N. Raab-Traub, L. A. Walton, and J. S. Pagano Replication of Epstein-Barr virus in human epithelial cells infected in vitro. Nature 306: Smith, P. R., O. de Jesus, D. Turner, M. Hollyoake, C. E. Karstegl, B. E. Griffin, L. Karran, Y. Wang, S. D. Hayward, and P. J. Farrell Structure and coding content of CST (BART) family RNAs of Epstein-Barr virus. J Virol 74: Sokal, E. M., K. Hoppenbrouwers, C. Vandermeulen, M. Moutschen, P. Leonard, A. Moreels, M. Haumont, A. Bollen, F. Smets, and M. Denis Recombinant gp350 vaccine for infectious mononucleosis: a phase 2, randomized, double-blind, placebo-controlled trial to evaluate the safety, immunogenicity, and efficacy of an Epstein-Barr virus vaccine in healthy young adults. J Infect Dis 196: Soni, V., E. Cahir-McFarland, and E. Kieff LMP1 TRAFficking activates growth and survival pathways. Adv Exp Med Biol 597: Speck, S. H., T. Chatila, and E. Flemington Reactivation of Epstein-Barr virus: regulation and function of the BZLF1 gene. Trends Microbiol 5: Stepp, S. E., R. Dufourcq-Lagelouse, F. Le Deist, S. Bhawan, S. Certain, P. A. Mathew, J. I. Henter, M. Bennett, A. Fischer, G. de Saint Basile, and V. Kumar Perforin gene defects in familial hemophagocytic lymphohistiocytosis. Science 286:

91 364. Sugiura, M., S. Imai, M. Tokunaga, S. Koizumi, M. Uchizawa, K. Okamoto, and T. Osato Transcriptional analysis of Epstein-Barr virus gene expression in EBV-positive gastric carcinoma: unique viral latency in the tumour cells. Br J Cancer 74: Sun, C. C., and D. A. Thorley-Lawson Plasma cell-specific transcription factor XBP-1s binds to and transactivates the Epstein-Barr virus BZLF1 promoter. J Virol 81: Sun, Y., D. W. Fry, P. Vincent, J. M. Nelson, W. Elliott, and W. R. Leopold Growth inhibition of nasopharyngeal carcinoma cells by EGF receptor tyrosine kinase inhibitors. Anticancer Res 19: Suzuki, T., H. Tahara, S. Narula, K. W. Moore, P. D. Robbins, and M. T. Lotze Viral interleukin 10 (IL-10), the human herpes virus 4 cellular IL-10 homologue, induces local anergy to allogeneic and syngeneic tumors. J Exp Med 182: Szekely, L., G. Selivanova, K. P. Magnusson, G. Klein, and K. G. Wiman EBNA-5, an Epstein-Barr virus-encoded nuclear antigen, binds to the retinoblastoma and p53 proteins. Proc Natl Acad Sci U S A 90: Takada, K Epstein-Barr virus and gastric carcinoma. Mol Pathol 53: Takada, K., and A. Nanbo The role of EBERs in oncogenesis. Semin Cancer Biol 11: Takada, K., and Y. Ono Synchronous and sequential activation of latently infected Epstein-Barr virus genomes. J Virol 63: Tanner, J., J. Weis, D. Fearon, Y. Whang, and E. Kieff Epstein-Barr virus gp350/220 binding to the B lymphocyte C3d receptor mediates adsorption, capping, and endocytosis. Cell 50: Thacker, E. L., F. Mirzaei, and A. Ascherio Infectious mononucleosis and risk for multiple sclerosis: a meta-analysis. Ann Neurol 59: Thomas, J. A., N. A. Hotchin, M. J. Allday, P. Amlot, M. Rose, M. Yacoub, and D. H. Crawford Immunohistology of Epstein-Barr virus-associated antigens in B cell disorders from immunocompromised individuals. Transplantation 49: Thorley-Lawson, D. A., and M. J. Allday The curious case of the tumour virus: 50 years of Burkitt's lymphoma. Nat Rev Microbiol 6:

92 376. Thorley-Lawson, D. A., and C. M. Edson Polypeptides of the Epstein-Barr virus membrane antigen complex. J Virol 32: Thorley-Lawson, D. A., and A. Gross Persistence of the Epstein-Barr virus and the origins of associated lymphomas. N Engl J Med 350: Thornburg, N. J., S. Kusano, and N. Raab-Traub Identification of Epstein- Barr virus RK-BARF0-interacting proteins and characterization of expression pattern. J Virol 78: Thornburg, N. J., R. Pathmanathan, and N. Raab-Traub Activation of nuclear factor-kappab p50 homodimer/bcl-3 complexes in nasopharyngeal carcinoma. Cancer Res 63: Thornburg, N. J., and N. Raab-Traub Induction of epidermal growth factor receptor expression by Epstein-Barr virus latent membrane protein 1 C-terminalactivating region 1 is mediated by NF-kappaB p50 homodimer/bcl-3 complexes. J Virol 81: Timms, J. M., A. Bell, J. R. Flavell, P. G. Murray, A. B. Rickinson, A. Traverse- Glehen, F. Berger, and H. J. Delecluse Target cells of Epstein-Barr-virus (EBV)-positive post-transplant lymphoproliferative disease: similarities to EBVpositive Hodgkin's lymphoma. Lancet 361: Tomkinson, B., and E. Kieff Second-site homologous recombination in Epstein-Barr virus: insertion of type 1 EBNA 3 genes in place of type 2 has no effect on in vitro infection. J Virol 66: Tomkinson, B., E. Robertson, and E. Kieff Epstein-Barr virus nuclear proteins EBNA-3A and EBNA-3C are essential for B-lymphocyte growth transformation. J Virol 67: Toussirot, E., and J. Roudier Epstein-Barr virus in autoimmune diseases. Best Pract Res Clin Rheumatol 22: Trivedi, P., M. G. Masucci, G. Winberg, and G. Klein The epstein-barrvirus-encoded membrane protein LMP but not the nuclear antigen EBNA-1 induces rejection of transfected murine mammary carcinoma cells. Int J Cancer 48: Tsai, C. N., C. L. Tsai, K. P. Tse, H. Y. Chang, and Y. S. Chang The Epstein-Barr virus oncogene product, latent membrane protein 1, induces the downregulation of E-cadherin gene expression via activation of DNA methyltransferases. Proc Natl Acad Sci U S A 99: Tsai, S. C., S. J. Lin, P. W. Chen, W. Y. Luo, T. H. Yeh, H. W. Wang, C. J. Chen, and C. H. Tsai EBV Zta protein induces the expression of interleukin- 74

93 13, promoting the proliferation of EBV-infected B cells and lymphoblastoid cell lines. Blood 114: Tsuge, I., T. Morishima, H. Kimura, K. Kuzushima, and H. Matsuoka Impaired cytotoxic T lymphocyte response to Epstein-Barr virus-infected NK cells in patients with severe chronic active EBV infection. J Med Virol 64: Tsujimoto, Y., J. Cossman, E. Jaffe, and C. M. Croce Involvement of the bcl-2 gene in human follicular lymphoma. Science 228: Tsujimoto, Y., and C. M. Croce Analysis of the structure, transcripts, and protein products of bcl-2, the gene involved in human follicular lymphoma. Proc Natl Acad Sci U S A 83: Tugizov, S. M., J. W. Berline, and J. M. Palefsky Epstein-Barr virus infection of polarized tongue and nasopharyngeal epithelial cells. Nat Med 9: Uchida, J., T. Yasui, Y. Takaoka-Shichijo, M. Muraoka, W. Kulwichit, N. Raab- Traub, and H. Kikutani Mimicry of CD40 signals by Epstein-Barr virus LMP1 in B lymphocyte responses. Science 286: Ushiku, T., J. M. Chong, H. Uozaki, R. Hino, M. S. Chang, M. Sudo, B. R. Rani, K. Sakuma, H. Nagai, and M. Fukayama p73 gene promoter methylation in Epstein-Barr virus-associated gastric carcinoma. Int J Cancer 120: van Beek, J., A. zur Hausen, E. Klein Kranenbarg, C. J. van de Velde, J. M. Middeldorp, A. J. van den Brule, C. J. Meijer, and E. Bloemena EBVpositive gastric adenocarcinomas: a distinct clinicopathologic entity with a low frequency of lymph node involvement. J Clin Oncol 22: Vokes, E. E., D. N. Liebowitz, and R. R. Weichselbaum Nasopharyngeal carcinoma. Lancet 350: Wagner, H. J., U. Sili, B. Gahn, S. Vigouroux, M. H. Huls, W. Xie, D. Vignali, M. K. Brenner, H. E. Heslop, and C. M. Rooney Expansion of EBV latent membrane protein 2a specific cytotoxic T cells for the adoptive immunotherapy of EBV latency type 2 malignancies: influence of recombinant IL12 and IL15. Cytotherapy 5: Walling, D. M., S. N. Edmiston, J. W. Sixbey, M. Abdel-Hamid, L. Resnick, and N. Raab-Traub Coinfection with multiple strains of the Epstein-Barr virus in human immunodeficiency virus-associated hairy leukoplakia. Proc Natl Acad Sci U S A 89: Walling, D. M., P. D. Ling, A. V. Gordadze, M. Montes-Walters, C. M. Flaitz, and C. M. Nichols Expression of Epstein-Barr virus latent genes in oral 75

94 epithelium: determinants of the pathogenesis of oral hairy leukoplakia. J Infect Dis 190: Walling, D. M., and N. Raab-Traub Epstein-Barr virus intrastrain recombination in oral hairy leukoplakia. J Virol 68: Waltzer, L., M. Perricaudet, A. Sergeant, and E. Manet Epstein-Barr virus EBNA3A and EBNA3C proteins both repress RBP-J kappa-ebna2-activated transcription by inhibiting the binding of RBP-J kappa to DNA. J Virol 70: Wang, D., D. Liebowitz, and E. Kieff An EBV membrane protein expressed in immortalized lymphocytes transforms established rodent cells. Cell 43: Wang, F., A. Marchini, and E. Kieff Epstein-Barr virus (EBV) recombinants: use of positive selection markers to rescue mutants in EBV-negative B-lymphoma cells. J Virol 65: Wang, Q., S. W. Tsao, T. Ooka, J. M. Nicholls, H. W. Cheung, S. Fu, Y. C. Wong, and X. Wang Anti-apoptotic role of BARF1 in gastric cancer cells. Cancer Lett 238: Wang, S. S., Z. Z. Guan, W. Q. Jiang, T. Y. Lin, and L. Zhang [Effect of epidermal growth factor receptor-selective tyrosine kinase inhibitor ZD1839 on nasopharyngeal carcinoma cells]. Ai Zheng 23: Wang, X., S. M. Huong, M. L. Chiu, N. Raab-Traub, and E. S. Huang Epidermal growth factor receptor is a cellular receptor for human cytomegalovirus. Nature 424: Webster-Cyriaque, J., J. Middeldorp, and N. Raab-Traub Hairy leukoplakia: an unusual combination of transforming and permissive Epstein-Barr virus infections. J Virol 74: Webster-Cyriaque, J., and N. Raab-Traub Transcription of Epstein-Barr virus latent cycle genes in oral hairy leukoplakia. Virology 248: Weiss, L. M., and L. A. Movahed In situ demonstration of Epstein-Barr viral genomes in viral-associated B cell lymphoproliferations. Am J Pathol 134: Weiss, L. M., L. A. Movahed, R. A. Warnke, and J. Sklar Detection of Epstein-Barr viral genomes in Reed-Sternberg cells of Hodgkin's disease. N Engl J Med 320: Weiss, L. M., J. G. Strickler, R. A. Warnke, D. T. Purtilo, and J. Sklar Epstein-Barr viral DNA in tissues of Hodgkin's disease. Am J Pathol 129:

95 411. Wells, A EGF receptor. Int J Biochem Cell Biol 31: Wiech, T., E. Nikolopoulos, S. Lassman, T. Heidt, A. Schopflin, M. Sarbia, M. Werner, Y. Shimizu, E. Sakka, T. Ooka, and A. zur Hausen Cyclin D1 expression is induced by viral BARF1 and is overexpressed in EBV-associated gastric cancer. Virchows Arch 452: Wilson, J. B., J. L. Bell, and A. J. Levine Expression of Epstein-Barr virus nuclear antigen-1 induces B cell neoplasia in transgenic mice. Embo J 15: Wilson, J. B., W. Weinberg, R. Johnson, S. Yuspa, and A. J. Levine Expression of the BNLF-1 oncogene of Epstein-Barr virus in the skin of transgenic mice induces hyperplasia and aberrant expression of keratin 6. Cell 61: Woisetschlaeger, M., C. N. Yandava, L. A. Furmanski, J. L. Strominger, and S. H. Speck Promoter switching in Epstein-Barr virus during the initial stages of infection of B lymphocytes. Proc Natl Acad Sci U S A 87: Wong, H. L., X. Wang, R. C. Chang, D. Y. Jin, H. Feng, Q. Wang, K. W. Lo, D. P. Huang, P. W. Yuen, K. Takada, Y. C. Wong, and S. W. Tsao Stable expression of EBERs in immortalized nasopharyngeal epithelial cells confers resistance to apoptotic stress. Mol Carcinog 44: Wu, Y., S. Maruo, M. Yajima, T. Kanda, and K. Takada Epstein-Barr virus (EBV)-encoded RNA 2 (EBER2) but not EBER1 plays a critical role in EBV-induced B-cell growth transformation. J Virol 81: Xia, T., A. O'Hara, I. Araujo, J. Barreto, E. Carvalho, J. B. Sapucaia, J. C. Ramos, E. Luz, C. Pedroso, M. Manrique, N. L. Toomey, C. Brites, D. P. Dittmer, and W. J. Harrington, Jr EBV micrornas in primary lymphomas and targeting of CXCL-11 by ebv-mir-bhrf1-3. Cancer Res 68: Xiao, J., J. M. Palefsky, R. Herrera, J. Berline, and S. M. Tugizov EBV BMRF-2 facilitates cell-to-cell spread of virus within polarized oral epithelial cells. Virology 388: Xiao, J., J. M. Palefsky, R. Herrera, and S. M. Tugizov Characterization of the Epstein-Barr virus glycoprotein BMRF-2. Virology 359: Xiao, X., J. Wu, X. Zhu, P. Zhao, J. Zhou, Q. Q. Liu, L. Zheng, M. Zeng, R. Liu, and W. Huang Induction of cell cycle arrest and apoptosis in human nasopharyngeal carcinoma cells by ZD6474, an inhibitor of VEGFR tyrosine kinase with additional activity against EGFR tyrosine kinase. Int J Cancer 121: Xing, L., and E. Kieff Epstein-Barr virus BHRF1 micro- and stable RNAs during latency III and after induction of replication. J Virol 81:

96 423. Yamamoto, N., T. Takizawa, Y. Iwanaga, N. Shimizu, and N. Yamamoto Malignant transformation of B lymphoma cell line BJAB by Epstein-Barr virusencoded small RNAs. FEBS Lett 484: Yates, J., N. Warren, D. Reisman, and B. Sugden A cis-acting element from the Epstein-Barr viral genome that permits stable replication of recombinant plasmids in latently infected cells. Proc Natl Acad Sci U S A 81: Yates, J. L., N. Warren, and B. Sugden Stable replication of plasmids derived from Epstein-Barr virus in various mammalian cells. Nature 313: Yi, F., A. Saha, M. Murakami, P. Kumar, J. S. Knight, Q. Cai, T. Choudhuri, and E. S. Robertson Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and apoptotic activities. Virology 388: Yin, Q., J. McBride, C. Fewell, M. Lacey, X. Wang, Z. Lin, J. Cameron, and E. K. Flemington MicroRNA-155 is an Epstein-Barr virus-induced gene that modulates Epstein-Barr virus-regulated gene expression pathways. J Virol 82: Young, L., C. Alfieri, K. Hennessy, H. Evans, C. O'Hara, K. C. Anderson, J. Ritz, R. S. Shapiro, A. Rickinson, E. Kieff, and et al Expression of Epstein- Barr virus transformation-associated genes in tissues of patients with EBV lymphoproliferative disease. N Engl J Med 321: Young, L. S., and A. B. Rickinson Epstein-Barr virus: 40 years on. Nat Rev Cancer 4: Yu, M. C., and J. M. Yuan Epidemiology of nasopharyngeal carcinoma. Semin Cancer Biol 12: Zandi, R., A. B. Larsen, P. Andersen, M. T. Stockhausen, and H. S. Poulsen Mechanisms for oncogenic activation of the epidermal growth factor receptor. Cell Signal 19: Zhang, H., A. Berezov, Q. Wang, G. Zhang, J. Drebin, R. Murali, and M. I. Greene ErbB receptors: from oncogenes to targeted cancer therapies. J Clin Invest 117: Zhang, J., H. Chen, G. Weinmaster, and S. D. Hayward Epstein-Barr virus BamHi-a rightward transcript-encoded RPMS protein interacts with the CBF1- associated corepressor CIR to negatively regulate the activity of EBNA2 and NotchIC. J Virol 75:

97 434. Zhang, L. L., D. J. Li, Z. H. Li, X. S. Zhang, R. H. Zhang, X. J. Yu, L. Z. Chen, Q. S. Feng, Y. X. Zeng, and W. H. Jia [Correlation of Epstein-Barr virus A73 gene polymorphisms to susceptibility to nasopharyngeal carcinoma]. Ai Zheng 26: Zhao, B., D. R. Marshall, and C. E. Sample A conserved domain of the Epstein-Barr virus nuclear antigens 3A and 3C binds to a discrete domain of Jkappa. J Virol 70: Zhao, B., and C. E. Sample Epstein-barr virus nuclear antigen 3C activates the latent membrane protein 1 promoter in the presence of Epstein-Barr virus nuclear antigen 2 through sequences encompassing an spi-1/spi-b binding site. J Virol 74: Zheng, X., L. Hu, F. Chen, and B. Christensson Expression of Ki67 antigen, epidermal growth factor receptor and Epstein-Barr virus-encoded latent membrane protein (LMP1) in nasopharyngeal carcinoma. Eur J Cancer B Oral Oncol 30B: Zhou, S., M. Fujimuro, J. J. Hsieh, L. Chen, and S. D. Hayward A role for SKIP in EBNA2 activation of CBF1-repressed promoters. J Virol 74: Zhu, J. Y., T. Pfuhl, N. Motsch, S. Barth, J. Nicholls, F. Grasser, and G. Meister Identification of novel Epstein-Barr virus microrna genes from nasopharyngeal carcinomas. J Virol 83: Zhu, X. F., Z. C. Liu, B. F. Xie, Z. M. Li, G. K. Feng, D. Yang, and Y. X. Zeng EGFR tyrosine kinase inhibitor AG1478 inhibits cell proliferation and arrests cell cycle in nasopharyngeal carcinoma cells. Cancer Lett 169: zur Hausen, A., A. A. Brink, M. E. Craanen, J. M. Middeldorp, C. J. Meijer, and A. J. van den Brule Unique transcription pattern of Epstein-Barr virus (EBV) in EBV-carrying gastric adenocarcinomas: expression of the transforming BARF1 gene. Cancer Res 60: Zur Hausen, A., B. P. van Rees, J. van Beek, M. E. Craanen, E. Bloemena, G. J. Offerhaus, C. J. Meijer, and A. J. van den Brule Epstein-Barr virus in gastric carcinomas and gastric stump carcinomas: a late event in gastric carcinogenesis. J Clin Pathol 57:

98 CHAPTER TWO Epstein-Barr Virus Latent Membrane Protein 1 Induces Expression of the Epidermal Growth Factor Receptor Through Effects on Bcl-3 and STAT3 Che-Pei Kung and Nancy Raab-Traub This work was originally published in Journal of Virology (2008), Vol. 82 No. 11:

99 ABSTRACT Epstein-Barr virus (EBV) latent membrane protein 1 (LMP1) activates multiple signaling pathways. Two regions, CTAR1 and CTAR2, have been identified within the cytoplasmic carboxy terminal domain that activates NF-κB. C-terminal activating region 2 (CTAR2) activates the canonical NF-κB pathway which includes p50/p65 complexes. C-terminal activating region 1 (CTAR1) can activate both the canonical and noncanonical pathways to produce multiple distinct NF-κB dimers, including p52/p50, p52/p65, and p50/p50. CTAR1 also uniquely upregulates the epidermal growth factor receptor (EGFR) in epithelial cells. Increased p50-bcl-3 complexes have been detected by chromatin precipitation on the NF-κB consensus motifs within the egfr promoter in CTAR1-expressing epithelial cells and NPC cells. In this study, the mechanism responsible for the increased Bcl-3 has been further investigated. The data indicate that LMP1-CTAR1 induces Bcl-3 mrna and increases the nuclear translocation of both Bcl-3 and p50. LMP1-CTAR1 constitutively activates STAT3 and this activation was not due to induction of IL-6. In LMP1-CTAR1-expressing cells, increased levels of activated STAT3 were detected by chromatin immunoprecipitation on STAT-binding sites located within both the promoter and second intron of Bcl-3. A STAT3 inhibitor significantly reduced the activation of STAT3, as well as the CTAR1-mediated upregulation of Bcl-3 and EGFR. These data suggest that LMP1 activates distinct forms of NF-κB through 81

100 multiple pathways. In addition to the canonical and noncanonical pathways, LMP1-CTAR1 constitutively activates STAT3 and increases Bcl-3. The increased nuclear Bcl-3 and p50 homodimer complexes positively regulate EGFR expression. These results indicate that LMP1 likely regulates distinct cellular genes by activating specific NF-κB pathways. INTRODUCTION Epstein-Barr virus (EBV) latent membrane protein 1 (LMP1) is an essential factor in EBV-induced transformation and is expressed in many of the malignancies associated with EBV, including post-transplant lymphoma, Hodgkin s disease, and nasopharyngeal carcinoma (NPC) (12, 28, 51, 66). LMP1 is considered a constitutively activated member of the tumor necrosis factor receptor (TNFR) family and binds TNF associated factors (TRAFs) (27, 41, 44). Two major signaling domains have been identified within the cytoplasmic C-terminal domain of LMP1, CTAR1 and CTAR2, that can activate NF-κB (25). However, CTAR1 has several unique properties and is essential for transformation while CTAR2 is dispensable (34, 35). LMP1-CTAR1 uniquely induces expression of the epidermal growth factor receptor (EGFR) at the mrna level and this induction requires NF-κB and is mediated through the TRAF signaling pathway (41-43). Subsequent studies have identified other genes that are uniquely activated by 82

101 LMP1-CTAR1, including TRAF1 and EBI3 (14). The NF-κB transcription factors dimerize and bind NF-κB consensus sequences in cellular and viral promoters to regulate the expression of genes controlling inflammation, cell cycle regulation, apoptosis, and oncogenesis (21, 38). There are five mammalian NF-κB family members including p50, p52, p65 (RelA), c-rel, and RelB. The activation of NF-κB family members is regulated through interactions with inhibitors of NF-κB (IκB), which sequester NF-κB members in the cytosol. Activation of a kinase cascade that includes IKKα, IKKβ, and IKKγ results in phosphorylation, ubiquitination, and degradation of an IκB, leading to the release and nuclear translocation of NF-κB. The p50 and p52 precursor proteins, p105 and p100 respectively, can also function as IκB. Early studies initially showed that LMP1-CTAR1 activated multiple forms of NF-κB including p50/p65, p50/p52, and p50 homodimers and also greatly increased the processing of p100 to p52 in epithelial cells and the nuclear translocation of p50 (41, 48). It has subsequently been shown that the induction of processing of p100 represents another mechanism for activation of NF-κB. This is considered the noncanonical NF-κB pathway and the activation of this pathway is specific for LMP1-CTAR1 (1, 15, 33, 53). Noncanonical activation of NF-κB requires IKKα and is mediated through the NIK kinase to induce processing of p100 and activate p52/relb. Canonical activation requires IKKβ and IKKγ to activate p50/p65. The activation of specific genes by LMP1 83

102 has been linked to the canonical and noncanonical pathways using engineered mouse fibroblasts (33). MIP-2 was activated by canonical pathway, which is IKKβ/IKKγ-dependent. Induction of the cellular chemokine, CXCR4, required IKKα and was considered activated by the noncanonical pathway. An atypical pathway was also identified that was IKKβ dependent but independent of IKKγ and regulated expression of MIG and I-TAC. The link between LMP1-CTAR1 activation of unique genes and distinct forms of NF-κB was demonstrated in studies that showed that LMP1-CTAR1 induced the binding of NF-κB p50 and Bcl-3 to the NF-κB sites in the egfr promoter in C33A cells (59). LMP1 effectively induces the nuclear translocation of p50 and p50/p50 homodimers are the major NF-κB complex activated in LMP1-expressing cells and EBV-positive xenografted NPC tumors (48, 58, 59). In addition, elevated levels of p50/p50 homodimers and Bcl-3 are found in classical Hodgkin lymphoma and anaplastic large-cell lymphomas that are associated with EBV infection (37). In this study, the effects of LMP1-CTAR1 on Bcl-3 expression and EGFR induction were further evaluated. LMP1-CTAR1 induced Bcl-3 transcription resulting in increased levels of nuclear Bcl-3. The transcriptional activation of Bcl-3 required STAT3, which bound to sites within the Bcl-3 promoter and intron 2. LMP1-CTAR1 expression increased both the serine and tyrosine phosphorylations of STAT3 that are 84

103 indicative of activation. These data indicate that LMP1 activates distinct forms of NF-κB through different pathways. In addition to activation of the canonical and noncanonical pathways, LMP1-CTAR1 also activates p50/p50 homodimers by increasing expression of Bcl-3 through its effects on STAT3. MATERIALS AND METHODS Retrovirus production and transduction Recombinant retrovirus production and transduction were performed as previously described to establish C33A stable cell lines expressing full-length LMP1, CTAR1 (1-231), CTAR2 (d ), or vector control pbabe (34). Briefly, ~80% confluent 293T cells were triple transfected using FuGEGE 6 transfection reagent (Roche) according to the manufacturer s instruction with 5µg pbabe (vector), pbabe-ha-lmp1, pbabe-ha-1-231, or pbabe-ha-d , and 5µg pvsv-g and 5µg pgag/pol expressing plasmids. After 24 hours incubation at 37 C, media were replaced with fresh media and cells were incubated at 33 C for another 24 hours. Cell supernatant then was centrifuged at 1000g for 5 min to remove cell debris and virus-containing supernatant was collected. C33A cells with ~70-80% of confluence were then transduced with clarified supernatant with 4µg/ml polybrene for 24 hours at 37 C. 85

104 Cell Culture and stable cell lines C33A cervical carcinoma cells were cultured in Dulbecco s modified Eagle s medium (Gibco) supplemented with 10% fetal bovine serum (Sigma) and antibiotic/antimycotic (Gibco) at 37 C with 5% CO 2. C33A stable cell lines expressing full-length LMP1, CTAR1 (1-231), CTAR2 (d ), or vector control pbabe were established by retroviral transduction followed by selection and passage in the presence of 1µg/ml puromycin (Sigma). Fractionation of Cells After cultured cells reached ~80-90% confluence, cells were scrape harvested, washed once with cold phosphate-buffered saline (PBS, Gibco), centrifuged at 1000g, and lysed with RIPA buffer (20mM Tris-HCl [ph 7.5], 150mM NaCl, 1mM EDTA, 1% NP-40, 0.1% sodium dodecyl sulfate [SDS], 0.1% deoxycholic acid) supplemented with phenylmethylsulfonyl fluoride (PMSF), sodium orthovanadate (Na 3 VO 4 ), protease and phosphatase inhibitor cocktail (Sigma). Lysates were then clarified by centrifugation at 13,000 rpm, 4 C for 15 min and supernatants containing whole cell lysates were removed to new tubes. Nuclear extracts were made as previously described with slight modification (59). Briefly, cells were scrape harvested, washed once with cold PBS, and lysed by incubation in a hypotonic buffer (20 mm HEPES, 10 mm KCl, 0.1 mm EDTA, 86

105 0.1 mm EGTA) supplemented with PMSF, Na 3 VO 4, protease and phosphatase inhibitor cocktail (Sigma) for 15 min on ice. Nonidet P-40 was then added to a final concentration of 1%, followed by 1 min of vortex. Nuclei were pelleted by low-speed centrifugation at 1,200 rpm for 10 min at 4 C and the supernatant were collected as cytoplasmic fraction. The nuclei fraction were purified using the Optiprep reagent (Sigma) as directed by the manufacturer, as previously described (58). Nuclei were lysed with nuclear extraction buffer (20 mm Tris-HCl [ph 8.0], 420 mm NaCl, 1.5 mm MgCl 2, 0.2 mm EDTA, 25% glycerol, PMSF, Na 3 VO 4, protease and phosphatase inhibitor cocktail [Sigma]) with the salt concentration adjusted to 400 mm with 5 M NaCl. All lysates were stored at -80 C. Western Blot Analysis Protein concentration of cell lysates was determined using Bio-Rad DC protein assay system according to manufacturer s instruction. Equal amounts of protein were used for SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to Optitran (Schleicher and Schuell) for Western blot analysis. Primary antibodies used include anti-p50, anti-β-actin, anti-grp78, anti-stat3, anti-parp (Santa Cruz), anti-bcl-3 (Upstate Biotechnology), anti-phospho-stat3 (Ser 727 and Tyr 705) (Cell Signaling), anti-phospho-egfr (Tyr 1068) (BD Biosciences), and anti-ha tag (Covance). A rabbit 87

106 antiserum raised against the carboxyl-terminal 100 amino acids of the EGFR fused to glutathione S-transferase (kindly provided by H. Shelton Earp) was used to detect total EGFR. Secondary antibodies used to detect bound proteins include horseradish peroxidase-conjugated antimouse, antirabbit (Amersham Pharmacia), and antigoat (DAKO). Blots were developed using Pierce Supersignal West Pico chemiluminescence system followed by exposure to film. Chromatin Immunoprecipitation (ChIP) Analysis ChIP analysis was performed using a ChIP kit (Upstate Biotechnology) according to manufacturer's protocol. Briefly, cells were cultivated in 100 mm plates to 90% confluency and scrape harvested. Cells were then fixed for 5 min in 1% freshly-made formaldehyde, washed with PBS, and lysed for 10 min in lysis buffer provided in the kit. Chromatin was sheared by sonication to an average size of ~ bps, clarified, and precleared for 1 h at 4 C with salmon sperm DNA-saturated protein G-Sepharose beads. The supernatant was incubated with normal rabbit IgG, with anti-stat3 (Santa Cruz), or with anti-phospho-stat3 (Ser 727, Cell Signaling) and nutated overnight at 4 C. Lysates were immunoprecipitated with salmon sperm DNA-saturated protein G-Sepharose beads for 1 h at 4 C and washed extensively according to the manufacturer's instruction. Input and immunoprecipitated protein/dna complexes were eluted at room 88

107 temperature and the cross-linking was reversed overnight at 65 C in the presence of 200 mm NaCl. After RNase A (37 C for 30 min) and proteinase K (45 C for 2 h) treatment, sample DNAs were purified as directed by the manufacturer for further analysis. PCR of ChIP products were performed with HotStar Taq polymerase (Qiagen) and Primer pairs used for different ChIP target sequences include:bcl-3-pro:5 TGACCCGGACTCAACCCCAG 3 and 5 TCTCCTCCCCTCCTCTCCCTC 3 ;HS3: 5 CGCTTCCTCCAACCTTAACC 3 and 5 TGCCCAGTCCCTAACCTCTT 3 ;HS4: 5 CATTCGAGGATGGAAGTTGG 3 and 5 CAGGGTTAAGTGAGGGCAGA 3. Quantitative Real Time Polymerase Chain Reaction (QRT-PCR) Total cell RNA was isolated using RNAeasy kit as directed by the manufacturer (Qiagen). Primer pairs used in this paper include actin:5 TCACCCACACTGTGCCCATCTACGA 3 and 5 CAGCGGAACCGCTCATTGCCAATGG 3 ;EGFR:5 CTGCGTCTCTTGCCGGAATG 3 and 5 TTGGCTCACCCTCCAGAAGG 3 ;Bcl-3:5 ACAACAGCCTTAGCATGGTG 3 and 5 GCTGAGTGCAGGGCGGAGCT 3 ;IL-6:5 AGCCACTCACCTCTTCAGAAC 3 and 5 GCTGCTTTCACACATGTTACTCTT 3. Quantitative real time-pcr (QRT-PCR) was performed using Quantitect SYBR Green RT-PCR kit (Qiagen) according to the manufacturer s instruction. Amplification of PCR 89

108 products was detected using ABI 7900HT sequence detection system (Applied Biosystems) and analyzed using SDS 2.0 software (Applied Biosystems). The cycle threshold (C T ) was determined as the number of PCR cycles required for a given reaction to reach an arbitrary fluorescence value within the linear amplification range. The change in C T ( C T ) was determined between the same target gene primer sets and different samples, and the change in CT ( C T ) was determined by adjusting for the difference in the number of cycles required for actin to reach the C T. The fold change was determined as 2 CT since each PCR cycle results in a twofold amplification of each PCR product. Quantitative real time-pcr was also performed to amplify ChIP products and primer pairs used for different ChIP target sequences include:bcl-3-pro:5 TGACCCGGACTCAACCCCAG 3 and 5 TCTCCTCCCCTCCTCTCCCTC 3 ;HS3: 5 CGCTTCCTCCAACCTTAACC 3 and 5 AAGAGGAGCCGGTGGCGCAG 3 ; HS4:5 TTACTGGAAGTCCGAGGGCT 3 and 5 TTCAGAGAAACCGTCCAGGC 3. RESULTS CTAR1 of LMP1 induces EGFR mrna and protein. The CTAR1 domain of LMP1 has previously been shown to induce expression of the EGFR. The full length LMP1, (contains only CTAR1 but not CTAR2), and d (contains only CTAR2 but not CTAR1) previously cloned into the pbabe retroviral expression vector 90

109 were stably transduced into C33A epithelial cells (Fig. 1B) (17). Expression oflmp1 and the CTAR deletion mutants and EGFR expression was evaluated by immunoblotting (Fig. 1A). As previously shown, LMP1 and CTAR1 but not CTAR2 of LMP1 induced EGFR expression with highly elevated levels induced by CTAR1 (43). In addition, high levels of phosphorylated, activated EGFR were detected using a phospho-specific antibody, indicating that the EGFR induced by CTAR1 is functionally active. Real-time quantitative reverse transcription PCR (QT-PCR) confirmed previous studies that indicated that LMP1 upregulates EGFR at the mrna level (42) (Fig. 1C). Quantification of the immunoblot indicated that in C33A cells LMP1 and CTAR1 induced EGFR mrna expression 7-fold and 17-fold, respectively. LMP1-CTAR2 did not affect EGFR mrna level or the levels of phosphorylated EGFR protein. Although the levels of LMP1 expression were very similar, the total and activated EGFR induced by LMP1-CTAR1 was significantly higher than full-length LMP1. This suggests that CTAR2 or sequences between CTAR1 and CTAR2 may inhibit the ability of CTAR1 to induce specific targets, such as EGFR. LMP1-CTAR1 upregulates Bcl-3 expression and induces nuclear translocation of Bcl-3 and p50. In studies of EBV-positive NPC xenografts, p50 and Bcl-3 were detected by chromatin immunoprecipitation (ChIP) to be bound to the EGFR promoter while other forms of NF-kB were not detected (58). In addition, in C33A cells, 91

110 Fig. 1. CTAR1 of LMP1 upregulates EGFR mrna levels. A) LMP1 and EGFR expression was examined by western blot analysis in C33A cells expressing HA-tagged LMP1, deletion mutant 1-231, and deletion mutant d B) A schematic of LMP1, 1-231, and d constructs. C) Expression of EGFR mrna in stable C33A cells was analyzed by quantitative RT-PCR. Fold change was normalized to actin. Data shown are the mean values of three independent experiments, each being performed in triplicate. transient overexpression of Bcl-3 and/or p50 slightly increased EGFR expression and p50/bcl-3 complexes could be detected by CHIP on the EGFR promoter in C33A cells expressing LMP1-CTAR1 (59). To determine the effect of LMP1 and LMP1-CTAR1 on the localization and expression levels of Bcl-3 and p50, lysates of whole cell and nuclear fractions were analyzed by western blotting. Both LMP1 and LMP1-CTAR1 increased levels of Bcl-3 in the whole cell lysates, approximately 2.1-fold and 4.6-fold respectively (Fig. 2A). Elevated levels of p50 and Bcl-3 were also detected in the nucleus of the LMP1-expressing C33A cells (Fig. 2B). Equal loading was confirmed by 92

111 immunoblotting for the cytosolic and nuclear proteins, GRP78 and PARP. Quantification using the ImageJ software and normalization to the intensity of PARP bands indicated that LMP1-expressing C33A cells had a 1.4 fold increase of nuclear Bcl-3 and LMP1-CTAR1 expressing cells had an approximately 1.9 fold increase. Fig. 2. CTAR1 of LMP1 upregulates Bcl-3 and induces nuclear translocation of Bcl-3 and p50. A) Bcl-3 expression in stable C33A cells was examined by western blotting and quantitated using ImageJ software. Data shown are the mean values of three independent experiments. B) Nuclear p50 and Bcl-3 in C33A stable cells were shown by western blotting and quantitated using ImageJ software. Data shown are the mean values of four and three independent experiments for Bcl-3 and p50, respectively. Fold change was normalized to GRP78 and PARP in A) and B), respectively. C) mrna of Bcl-3 was examined by quantitative RT-PCR. Fold change was normalized to actin. Data shown are the mean values of three independent experiments, each being performed in triplicate. 93

112 LMP1-CTAR2 did not affect the levels of whole cell or nuclear Bcl-3 compared to vector control cells. Expression of LMP1 or LMP1-CTAR1 also significantly induced the nuclear translocation of NF-κB p50, approximately 13- and 16-fold, respectively (Fig. 2B) (48). Although LMP1-CTAR2 induces greater levels of NF-κB activity in reporter assays, in C33A cells expressing LMP1-CTAR2 nuclear p50 was only increased 5-fold (25, 57). QT-PCR using Bcl-3 specific primers indicated that Bcl-3 mrna was increased approximately 1.9 fold and 3.3 fold inductions in LMP1- and LMP1-CTAR1 expressing cells (Fig. 2C). LMP1-CTAR2 did not affect the Bcl-3 mrna level. These results indicate that LMP1-CTAR1 not only induces the nuclear translocation of NF-κB Bcl-3 and p50, it also transcriptionally activates Bcl-3. STAT3 is constitutively activated by LMP1-CTAR1. Previous studies have shown that LMP1 can activate signal transducer and activator of transcription 3 (STAT3) and that the activated STAT3 may regulate LMP1 expression through effects on the novel LMP1 promoter within the terminal repeats that is active in NPC (9, 10, 32, 52). STAT3 has also been shown to transcriptionally activate Bcl-3 through enhancer sequences detected within the Bcl-3 introns (4). The transcriptional activity of STAT3 is regulated by phosphorylation. Phosphorylation at tyrosine 705 induces STAT3 dimerization while phosphorylation at serine 727 affects DNA binding and transcriptional activity (3, 13). To determine the effects of LMP1 and LMP-1 on STAT3 activation, serine and tyrosine 94

113 phosphorylated STAT3 was identified using phospho-specific STAT3 antibodies, quantified by ImageJ, and normalized to loading control, GRP78 (Fig. 3A). The fold induction is indicated beneath the corresponding bands of a representative experiment out of three independent attempts. Cells expressing LMP1 had an approximately 2.4-fold Fig. 3. CTAR1 of LMP1 upregulates Bcl-3 and EGFR by activating STAT3. A) Total and phosphorylation levels of STAT3 were examined by western blotting. Fold inductions are listed beneath their corresponding bands. The blot is representative of three independent experiments. B) Phosphorylation of STAT3, as well as expression of Bcl-3 and EGFR, was examined in expressing C33A cells treated with the STAT3-specific inhibitor, Cucurbitacin. C) mrna of EGFR was examined by quantitative RT-PCR in pbabe control, cells treated with DMSO, and cells treated with Cucurbitacin. Fold change was normalized to actin. Data shown are the mean values of four independent experiments, each being performed in triplicate. 95

114 increase in tyrosine-phosphorylated STAT3 and 2.5-fold increase in serine-phosphorylated STAT3 compared to vector control. Cells expressing LMP1-CTAR1 had an approximately 3-fold increase in tyrosine-phosphorylated STAT3 and 4-fold increase in serine-phosphorylated STAT3. LMP1-CTAR2 had an approximately 1.6-fold increase in tyrosine-phosphorylated STAT3 and 1.7-fold increase in serine-phosphorylated STAT3. Although the levels of phosphorylated STAT3 were increased by LMP1, the total level of STAT3 was not affected. Cucurbitacin is a specific inhibitor of STAT3 activation through effects on the Janus kinases (2, 31). Treatment of the LMP1-CTAR1 expressing C33A cells with Cucurbitacin reduced both the tyrosine and serine phosphorylation of STAT3 induced by LMP1-CTAR1 (Fig. 3B). The effects of Cucurbitacin were dose-dependent in that 1μM of Cucurbitacin reduced LMP1-CTAR1-mediated induction to the level detected in control cells while 10μM eliminated phosphorylated STAT3. Importantly, treatment with Cucurbitacin significantly reduced the effects of LMP1-CTAR1 on Bcl-3 and EGFR and at 10μM expression of Bcl-3 was eliminated. QT-PCR of EGFR mrna indicated that EGFR mrna was reduced 63% and 86% by 1μM and 10μM of Cucurbitacin (Fig. 3C). These results suggest that CTAR1-mediated STAT3 activation is required for Bcl-3 induction and at least partially responsible for the induction of EGFR. Previous studies have shown that LMP1 can induce expression of IL-6 resulting in activation of STAT3 (4, 9, 10, 96

115 16). To determine whether LMP1-mediated STAT3 activation resulted from IL-6 induction in C33A cells, QRT-PCR was performed to detect IL-6 mrna (Fig. 4). In C33A cells, IL-6 mrna level was induced by LMP1, LMP1-CTAR1, or LMP1-CTAR2 to 1.6-, 2.7-, and 4.2-fold, respectively. The highest induction was detected in LMP1-CTAR2 cells that didn t activate STAT3. These data indicate that STAT3 is constitutively activated by LMP1-CTAR1 in C33A cells through mechanisms that are not dependent on IL-6 induction. Fig. 4. IL-6 production in C33A cells. Expression level of IL-6 mrna in stable C33A cells was analyzed by quantitative RT-PCR. Fold change was normalized to actin. Data shown are the mean values of four independent experiments, each being performed in triplicate. LMP1 CTAR1 induces STAT3 binding to sites in the Bcl-3 promoter and introns. Two enhancers, HS3 and HS4, have been identified within introns of Bcl-3 that mediate STAT3 induction of Bcl-3 (4). HS3 contains one and HS4 has three putative 97

116 STAT3 binding sites, respectively (Fig. 5A). The online program, ALGGEN-PROMO, ( lggen) was also used to predict STAT3 binding sites in the Bcl-3 promoter. One potential site (Bcl-3-Pro) was identified at approximately 1200 bps upstream of the Bcl-3 transcriptional start site (Fig. 5A) (18, 39). To determine if LMP1-CTAR1 induces binding of STAT3 to these putative binding sites, ChIP analysis was performed in C33A cells stably expressing pbabe vector control and LMP1-CTAR1 using primers specific for each of the three predicted sites (Fig. 5B). In the pbabe control cells, precipitation with STAT3 or serine-phosphorylated-stat3 antibodies did not increase the amplification compared to precipitation with normal rabbit immunoglobulin. In LMP1-CTAR1 cells, precipitation with STAT3 antibody slightly increased amplification of all three putative STAT3 binding sites. However, precipitation with the serine-phosphorylated specific STAT3 antibody detected increased binding between STAT3 and all three putative STAT3 binding sites in the presence of LMP1-CTAR1. LMP1-CTAR1 did not increase interaction between STAT3 and a nonspecific target within EGFR Exon2, indicating the specificity of the effect (data not shown). This result was confirmed using quantitative PCR to amplify ChIP products and the data were normalized to determine the enrichment fold in LMP1-CTAR1 cells compared to pbabe control cells (Fig. 5C). In LMP1-CTAR1 cells, the binding of serine phosphorylated STAT3 to Bcl-3-Pro, H3, and 98

117 H4 was increased 4.2-, 3-, and 4.6-fold, respectively. These data indicate that LMP1 CTAR1 likely regulates Bcl-3 by increasing the interaction of serine phosphorylated STAT3 to multiple binding sites that regulate Bcl-3 expression. Fig. 5. LMP1 CTAR1 induces binding of STAT3 to Bcl-3 promoter and intronic enhancers. A) Schematic representation of putative STAT binding sites. HS3 and HS4 were suggested in Brocke-Heidrich K et al. paper. Bcl-3-Pro was predicted using ALGGEN-PROMO online program. B) Chromatin immunoprecipitation ( ChIP ) analysis using normal IgG(lane 2), S TAT3(lane 3), and Serine-phosphorylation-STAT3 (lane 4)antibodies in pbabe control and CTAR1-expressing C33A cells. Precipitated complexes were subjected to PCR with primer pairs specific to Bcl-3-Pro, HS3, and HS4 regions. PCR was also performed with chromatin input(lane 1). C) Quantitative real time-pcr was performed to amplify ChIP products from pbabe control and CTAR1-expressing cells. Enrichment fold was calculated by normalizing results from CTAR1 cells to pbabe cells. Data shown are the mean values of two independent experiments, each being performed in triplicate. 99

118 DISCUSSION The induction of EGFR expression by LMP1 is likely a contributing factor to the development of cancer. The EGFR is frequently expressed at high levels in a variety of human cancers, including NPC (40, 54, 69). Stimulation of the tyrosine kinase activity of EGFR affects multiple signaling pathways leading to deregulation of cellular growth control and tumorigenesis (5, 65). Thus the effect of LMP1 on EGFR expression is likely an important factor in carcinogenesis. The unique activation of EGFR expression by LMP1-CTAR1 provides a novel system to assess the contribution of NF-kB activation. It was initially thought that p50/p50 or p52/p52 homodimers were transcriptionally inactive as these forms of NF-kB lack transactivation domains. However, subsequent studies determined that Bcl-3, which contains a transcriptional transactivation domain, can convert these complexes into active forms (19, 46, 47). It is thought that one of the major functions of Bcl-3 is to bring p50 into the nucleus and the increased nuclear presence of p50 correlates with elevated Bcl-3 in LMP1 CTAR1-expressing cells (61, 68). It has also been suggested that Bcl-3 might contribute to p50 activation by inhibiting the ubiquitination and subsequent degradation of DNA-bound p50 homodimers (7). The data presented here indicate that Bcl-3 is also regulated by LMP1-CTAR1 resulting in increased Bcl-3 mrna, protein, and nuclear translocation of Bcl-3. The data also indicate that the effects of LMP1 on Bcl-3 are linked to its effects on STAT3. STAT3 is 100

119 known to be activated in EBV-infected and LMP1-expressing epithelial cells and B-cell lymphomas (6, 9, 10, 32, 55). The induction of IL-6 by LMP1 can result in activation of STAT3 and increased IL-6 production has been detected in EBV-infected and LMP1-expressing epithelial cells (9, 10). In multiple myeloma cells, Bcl-3 transcription has been shown to be induced by IL-6 via STAT3 binding to intronic enhancers (4). However as shown here, IL-6 transcription was slightly induced in LMP1- and CTAR1-expressing C33A cells but was induced the highest in CTAR2-expressing cells, where no EGFR or Bcl-3 induction was detected. In addition, treatment with recombinant IL-6 did not increase serine phosphorylation of STAT3 or EGFR expression in pbabe control or CTAR1-expressing cells (data not shown). These data indicate that LMP1 CTAR1 mediates constitutive activation of STAT3 independently of effects on IL-6. IL-6-independent STAT3 activation by EBV has been suggested in studies where retinoic acid treatment of EBV-immortalized B lymphocytes inhibited IL-6-dependent but not constitutive STAT3 activation (67). It is not yet clear what exact signaling pathways activate STAT3 in LMP1-expressing cells. It was previously suggested that a novel activating region between CTAR1 and CTAR2 of LMP1 interacts with Janus kinase 3 (JAK3) and activates JAK/STAT signaling pathway (22). However, in EBV-transformed lymphoblastoid cell lines, the putative activating region did not mediate JAK3 association or JAK/STAT3 101

120 activation (23). In addition, in data presented here LMP1-CTAR1 is a deletion mutant, containing aa 1-231, that lacks this domain yet activates STAT3 considerably more effectively than full-length LMP1 (Fig. 3). These data indicate that the putative JAK-binding domain is not important for LMP1-mediated STAT3 activation in C33A cells. However, the inhibition of this activation by Cucurbitacin which is thought to inactivate STAT3 through inhibiting JAK2 and JAK3 activity may indicate that regulation of JAK activity contributes to LMP1-mediated STAT3 activation (2, 56). It will be of interest to determine how the CTAR1/TRAF complexes possibly affect STAT3 activity or the Janus kinases. Several signaling pathways affected by LMP1 have been associated with STAT3 activation. Serine phosphorylation of STAT3 has been shown to be mediated by PI3K/AKT and ERK signaling pathways which are both activated by LMP1-CTAR1 (11, 20, 34, 35, 50, 62). Interestingly, EGFR also activates STAT3 which suggests a positive signaling loop of STAT3 Bcl-3 EGFR STAT3 may be established in LMP1-expressing cells and during EBV-mediated transformation (8, 49). A recent study suggested that LMP1 induces Bcl-3 expression through CTAR2 and NF-κB pathway (45). This study showed that deletion of CTAR2 or the NF-κB binding sites in the Bcl-3 promoter abolished activity of a Bcl-3 reporter construct in LMP1-expressing Jurkat cells. The difference between this study and the data presented 102

121 here may reflect that the construct used in that study contained amino acid of LMP1 protein, which is 100 amino acids longer than the CTAR1 construct (1-231) tested in our study. This region of aa of LMP1 may have an inhibitory effect on CTAR1-mediated Bcl-3 induction. Possible inhibition by this domain is also suggested by the fact that CTAR1 alone has higher activity of inducing Bcl-3 and EGFR than full-length LMP1 (Fig. 1 and Fig. 2). Importantly, the LMP1-CTAR2 deletion mutant was only tested using a Bcl-3 reporter construct and CTAR1 was not tested for its effects on Bcl-3 expression in cell lines. In addition, the reporter construct did not include the STAT3-binding site located approximately 1200 bps upstream of Bcl-3 transcriptional start site which had the strongest interaction with STAT3 and serine phosphorylated STAT3 in CTAR1-expressing C33A cells. This STAT3 binding site is likely important for CTAR1-mediated Bcl-3 induction. It is intriguing that CTAR1 had a considerably stronger effect than full length LMP1 although both were expressed at very similar levels. It is possible that the presence of CTAR2 downregulates the ability of CTAR1 to induce Bcl-3 and EGFR. LMP1 CTAR2 mediates downstream signaling pathways through TRAF2 or TRAF6 which both are potential E3 ubiquitin ligases (26, 63). Since it has been shown that both EGFR and Bcl-3 can be regulated by ubiquitination, it is possible that either CTAR2-recruited TRAF2 or TRAF6 affects LMP1-mediated induction of EGFR and 103

122 Bcl-3 (24, 29, 30, 36, 60). In summary, the data here suggest a model of LMP1-mediated induction of EGFR with constitutive activation of STAT3 by CTAR1 through induction of tyrosine and serine phosphorylation of STAT3 (Fig. 6). The serine phosphorylated STAT3 would increase Bcl-3 expression through interaction with multiple STAT-binding sites in both the promoter and introns of Bcl-3. The increased levels of Bcl-3 and the elevated levels of p50 form a transcriptional active complex to transactivate EGFR. The link between Fig. 6. A working model for LMP1 CTAR1-mediated induction of Bcl-3 and, consequently, EGFR. 104

123 STAT3 and EGFR has also been shown by microarray data of epithelial cells overexpressing STAT3 (64). It has been suggested that the unique activation of distinct genes by LMP1-CTAR1 reflects its activation of the noncanonical pathway (33). However, the data presented here reveal that LMP1-CTAR1 has an additional mechanism to activate NF-kB through its effects on STAT3 and Bcl-3. As multiple genes have been shown to be regulated by the Bcl-3/p50-homodimer complex, it is likely that this pathway is responsible for other genes induced by LMP1 in EBV-associated tumorigenesis. ACKNOWLEDGMENTS We thank H. Shelton Earp for the anti-egfr rabbit antiserum and David Everly for pbabe-lmp1, pbabe-ctar1, and pbabe-ctar2 constructs. We also thank Aron Marquitz and Kathy Shair for critical reviews of the manuscript. This work was supported by NIH grant CA32979 to N.R.-T. 105

124 REFERENCES 1. Atkinson, P. G., H. J. Coope, M. Rowe, and S. C. Ley Latent membrane protein 1 of Epstein-Barr virus stimulates processing of NF-kappa B2 p100 to p52. J Biol Chem 278: Blaskovich, M. A., J. Sun, A. Cantor, J. Turkson, R. Jove, and S. M. Sebti Discovery of JSI-124 (cucurbitacin I), a selective Janus kinase/signal transducer and activator of transcription 3 signaling pathway inhibitor with potent antitumor activity against human and murine cancer cells in mice. Cancer Res 63: Bowman, T., R. Garcia, J. Turkson, and R. Jove STATs in oncogenesis. Oncogene 19: Brocke-Heidrich, K., B. Ge, H. Cvijic, G. Pfeifer, D. Loffler, C. Henze, T. W. McKeithan, and F. Horn BCL3 is induced by IL-6 via Stat3 binding to intronic enhancer HS4 and represses its own transcription. Oncogene 25: Buday, L., and J. Downward Epidermal growth factor regulates p21ras through the formation of a complex of receptor, Grb2 adapter protein, and Sos nucleotide exchange factor. Cell 73: Buettner, M., N. Heussinger, and G. Niedobitek Expression of Epstein-Barr virus (EBV)-encoded latent membrane proteins and STAT3 activation in nasopharyngeal carcinoma. Virchows Arch 449: Carmody, R. J., Q. Ruan, S. Palmer, B. Hilliard, and Y. H. Chen Negative regulation of toll-like receptor signaling by NF-kappaB p50 ubiquitination blockade. Science 317: Chan, K. S., S. Carbajal, K. Kiguchi, J. Clifford, S. Sano, and J. DiGiovanni Epidermal growth factor receptor-mediated activation of Stat3 during multistage skin carcinogenesis. Cancer Res 64: Chen, H., L. Hutt-Fletcher, L. Cao, and S. D. Hayward A positive autoregulatory loop of LMP1 expression and STAT activation in epithelial cells 106

125 latently infected with Epstein-Barr virus. J Virol 77: Chen, H., J. M. Lee, Y. Zong, M. Borowitz, M. H. Ng, R. F. Ambinder, and S. D. Hayward Linkage between STAT regulation and Epstein-Barr virus gene expression in tumors. J Virol 75: Chung, J., E. Uchida, T. C. Grammer, and J. Blenis STAT3 serine phosphorylation by ERK-dependent and -independent pathways negatively modulates its tyrosine phosphorylation. Mol Cell Biol 17: Deacon, E. M., G. Pallesen, G. Niedobitek, J. Crocker, L. Brooks, A. B. Rickinson, and L. S. Young Epstein-Barr virus and Hodgkin's disease: transcriptional analysis of virus latency in the malignant cells. J Exp Med 177: Decker, T., and P. Kovarik Serine phosphorylation of STATs. Oncogene 19: Devergne, O., E. D. Cahir McFarland, G. Mosialos, K. M. Izumi, C. F. Ware, and E. Kieff Role of the TRAF binding site and NF-kappaB activation in Epstein-Barr virus latent membrane protein 1-induced cell gene expression. J Virol 72: Eliopoulos, A. G., J. H. Caamano, J. Flavell, G. M. Reynolds, P. G. Murray, J. L. Poyet, and L. S. Young Epstein-Barr virus-encoded latent infection membrane protein 1 regulates the processing of p100 NF-kappaB2 to p52 via an IKKgamma/NEMO-independent signalling pathway. Oncogene 22: Eliopoulos, A. G., M. Stack, C. W. Dawson, K. M. Kaye, L. Hodgkin, S. Sihota, M. Rowe, and L. S. Young Epstein-Barr virus-encoded LMP1 and CD40 mediate IL-6 production in epithelial cells via an NF-kappaB pathway involving TNF receptor-associated factors. Oncogene 14: Everly, D. N., Jr., B. A. Mainou, and N. Raab-Traub Induction of Id1 and Id3 by latent membrane protein 1 of Epstein-Barr virus and regulation of p27/kip and cyclin-dependent kinase 2 in rodent fibroblast transformation. J Virol 78:

126 18. Farre, D., R. Roset, M. Huerta, J. E. Adsuara, L. Rosello, M. M. Alba, and X. Messeguer Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN. Nucleic Acids Res 31: Fujita, T., G. P. Nolan, H. C. Liou, M. L. Scott, and D. Baltimore The candidate proto-oncogene bcl-3 encodes a transcriptional coactivator that activates through NF-kappa B p50 homodimers. Genes Dev 7: Fung, M. M., F. Rohwer, and K. L. McGuire IL-2 activation of a PI3K-dependent STAT3 serine phosphorylation pathway in primary human T cells. Cell Signal 15: Ghosh, S., and M. Karin Missing pieces in the NF-kappaB puzzle. Cell 109 Suppl:S Gires, O., F. Kohlhuber, E. Kilger, M. Baumann, A. Kieser, C. Kaiser, R. Zeidler, B. Scheffer, M. Ueffing, and W. Hammerschmidt Latent membrane protein 1 of Epstein-Barr virus interacts with JAK3 and activates STAT proteins. Embo J 18: Higuchi, M., E. Kieff, and K. M. Izumi The Epstein-Barr virus latent membrane protein 1 putative Janus kinase 3 (JAK3) binding domain does not mediate JAK3 association or activation in B-lymphoma or lymphoblastoid cell lines. J Virol 76: Huang, F., L. K. Goh, and A. Sorkin EGF receptor ubiquitination is not necessary for its internalization. Proc Natl Acad Sci U S A 104: Huen, D. S., S. A. Henderson, D. Croom-Carter, and M. Rowe The Epstein-Barr virus latent membrane protein-1 (LMP1) mediates activation of NF-kappa B and cell surface phenotype via two effector regions in its carboxy-terminal cytoplasmic domain. Oncogene 10: Huye, L. E., S. Ning, M. Kelliher, and J. S. Pagano Interferon regulatory factor 7 is activated by a viral oncoprotein through RIP-dependent ubiquitination. Mol Cell Biol 27: Izumi, K. M., K. M. Kaye, and E. D. Kieff The Epstein-Barr virus LMP1 108

127 amino acid sequence that engages tumor necrosis factor receptor associated factors is critical for primary B lymphocyte growth transformation. Proc Natl Acad Sci U S A 94: Kieff, E., and A. B. Rickinson Epstein-Barr virus and its replication, p In D. M. Knipe (ed.), Field's virology, 4th ed, vol. 2. Lippincott Williams & Wilkins, Philadelphia, PA. 29. Levkowitz, G., H. Waterman, S. A. Ettenberg, M. Katz, A. Y. Tsygankov, I. Alroy, S. Lavi, K. Iwai, Y. Reiss, A. Ciechanover, S. Lipkowitz, and Y. Yarden Ubiquitin ligase activity and tyrosine phosphorylation underlie suppression of growth factor signaling by c-cbl/sli-1. Mol Cell 4: Levkowitz, G., H. Waterman, E. Zamir, Z. Kam, S. Oved, W. Y. Langdon, L. Beguinot, B. Geiger, and Y. Yarden c-cbl/sli-1 regulates endocytic sorting and ubiquitination of the epidermal growth factor receptor. Genes Dev 12: Lim, C. P., T. T. Phan, I. J. Lim, and X. Cao Stat3 contributes to keloid pathogenesis via promoting collagen production, cell proliferation and migration. Oncogene 25: Lo, A. K., K. W. Lo, S. W. Tsao, H. L. Wong, J. W. Hui, K. F. To, D. S. Hayward, Y. L. Chui, Y. L. Lau, K. Takada, and D. P. Huang Epstein-Barr virus infection alters cellular signal cascades in human nasopharyngeal epithelial cells. Neoplasia 8: Luftig, M., T. Yasui, V. Soni, M. S. Kang, N. Jacobson, E. Cahir-McFarland, B. Seed, and E. Kieff Epstein-Barr virus latent infection membrane protein 1 TRAF-binding site induces NIK/IKK alpha-dependent noncanonical NF-kappaB activation. Proc Natl Acad Sci U S A 101: Mainou, B. A., D. N. Everly, Jr., and N. Raab-Traub Epstein-Barr virus latent membrane protein 1 CTAR1 mediates rodent and human fibroblast transformation through activation of PI3K. Oncogene 24:

128 35. Mainou, B. A., D. N. Everly, Jr., and N. Raab-Traub Unique signaling properties of CTAR1 in LMP1-mediated transformation. J Virol 81: Massoumi, R., K. Chmielarska, K. Hennecke, A. Pfeifer, and R. Fassler Cyld inhibits tumor cell proliferation by blocking Bcl-3-dependent NF-kappaB signaling. Cell 125: Mathas, S., K. Johrens, S. Joos, A. Lietz, F. Hummel, M. Janz, F. Jundt, I. Anagnostopoulos, K. Bommert, P. Lichter, H. Stein, C. Scheidereit, and B. Dorken Elevated NF-kappaB p50 complex formation and Bcl-3 expression in classical Hodgkin, anaplastic large-cell, and other peripheral T-cell lymphomas. Blood 106: Mayo, M. W., and A. S. Baldwin The transcription factor NF-kappaB: control of oncogenesis and cancer therapy resistance. Biochim Biophys Acta 1470:M Messeguer, X., R. Escudero, D. Farre, O. Nunez, J. Martinez, and M. M. Alba PROMO: detection of known transcription regulatory elements using species-tailored searches. Bioinformatics 18: Miller, W. E., J. L. Cheshire, A. S. Baldwin, Jr., and N. Raab-Traub The NPC derived C15 LMP1 protein confers enhanced activation of NF-kappa B and induction of the EGFR in epithelial cells. Oncogene 16: Miller, W. E., J. L. Cheshire, and N. Raab-Traub Interaction of tumor necrosis factor receptor-associated factor signaling proteins with the latent membrane protein 1 PXQXT motif is essential for induction of epidermal growth factor receptor expression. Mol Cell Biol 18: Miller, W. E., H. S. Earp, and N. Raab-Traub The Epstein-Barr virus latent membrane protein 1 induces expression of the epidermal growth factor receptor. J Virol 69:

129 43. Miller, W. E., G. Mosialos, E. Kieff, and N. Raab-Traub Epstein-Barr virus LMP1 induction of the epidermal growth factor receptor is mediated through a TRAF signaling pathway distinct from NF-kappaB activation. J Virol 71: Mosialos, G., M. Birkenbach, R. Yalamanchili, T. VanArsdale, C. Ware, and E. Kieff The Epstein-Barr virus transforming protein LMP1 engages signaling proteins for the tumor necrosis factor receptor family. Cell 80: Nakamura, H., C. Ishii, M. Suehiro, A. Iguchi, K. Kuroda, K. Shimizu, N. Shimizu, K. I. Imadome, M. Yajima, and S. Fujiwara The latent membrane protein 1 (LMP1) encoded by Epstein-Barr virus induces expression of the putative oncogene Bcl-3 through activation of the nuclear factor-kappab. Virus Res. 46. Nolan, G. P., T. Fujita, K. Bhatia, C. Huppi, H. C. Liou, M. L. Scott, and D. Baltimore The bcl-3 proto-oncogene encodes a nuclear I kappa B-like molecule that preferentially interacts with NF-kappa B p50 and p52 in a phosphorylation-dependent manner. Mol Cell Biol 13: Ohno, H., M. Nishikori, Y. Maesako, and H. Haga Reappraisal of BCL3 as a molecular marker of anaplastic large cell lymphoma. Int J Hematol 82: Paine, E., R. I. Scheinman, A. S. Baldwin, Jr., and N. Raab-Traub Expression of LMP1 in epithelial cells leads to the activation of a select subset of NF-kappa B/Rel family proteins. J Virol 69: Park, O. K., T. S. Schaefer, and D. Nathans In vitro activation of Stat3 by epidermal growth factor receptor kinase. Proc Natl Acad Sci U S A 93: Plaza-Menacho, I., T. van der Sluis, H. Hollema, O. Gimm, C. H. Buys, A. I. Magee, C. M. Isacke, R. M. Hofstra, and B. J. Eggen Ras/ERK1/2-mediated STAT3 Ser727 phosphorylation by familial medullary thyroid carcinoma-associated RET mutants induces full activation of STAT3 and is required for c-fos promoter activation, cell mitogenicity, and transformation. J Biol Chem 282:

130 51. Raab-Traub, N Epstein-Barr virus in the pathogenesis of NPC. Semin Cancer Biol 12: Sadler, R. H., and N. Raab-Traub The Epstein-Barr virus 3.5-kilobase latent membrane protein 1 mrna initiates from a TATA-Less promoter within the first terminal repeat. J Virol 69: Saito, N., G. Courtois, A. Chiba, N. Yamamoto, T. Nitta, N. Hironaka, M. Rowe, N. Yamamoto, and S. Yamaoka Two carboxyl-terminal activation regions of Epstein-Barr virus latent membrane protein 1 activate NF-kappaB through distinct signaling pathways in fibroblast cell lines. J Biol Chem 278: Salomon, D. S., R. Brandt, F. Ciardiello, and N. Normanno Epidermal growth factor-related peptides and their receptors in human malignancies. Crit Rev Oncol Hematol 19: Shair, K. H., K. M. Bendt, R. H. Edwards, E. C. Bedford, J. N. Nielsen, and N. Raab-Traub EBV Latent Membrane Protein 1 Activates Akt, NFkappaB, and Stat3 in B Cell Lymphomas. PLoS Pathog 3:e Shi, X., B. Franko, C. Frantz, H. M. Amin, and R. Lai JSI-124 (cucurbitacin I) inhibits Janus kinase-3/signal transducer and activator of transcription-3 signalling, downregulates nucleophosmin-anaplastic lymphoma kinase (ALK), and induces apoptosis in ALK-positive anaplastic large cell lymphoma cells. Br J Haematol 135: Soni, V., E. Cahir-McFarland, and E. Kieff LMP1 TRAFficking activates growth and survival pathways. Adv Exp Med Biol 597: Thornburg, N. J., R. Pathmanathan, and N. Raab-Traub Activation of nuclear factor-kappab p50 homodimer/bcl-3 complexes in nasopharyngeal carcinoma. Cancer Res 63: Thornburg, N. J., and N. Raab-Traub INDUCTION OF EGFR EXPRESSION BY EBV LMP1 CTAR1 IS MEDIATED BY NF-{kappa}B p50 HOMODIMER/BCL-3 COMPLEXES. J Virol. 112

131 60. Viatour, P., E. Dejardin, M. Warnier, F. Lair, E. Claudio, F. Bureau, J. C. Marine, M. P. Merville, U. Maurer, D. Green, J. Piette, U. Siebenlist, V. Bours, and A. Chariot GSK3-mediated BCL-3 phosphorylation modulates its degradation and its oncogenicity. Mol Cell 16: Watanabe, N., T. Iwamura, T. Shinoda, and T. Fujita Regulation of NFKB1 proteins by the candidate oncoprotein BCL-3: generation of NF-kappaB homodimers from the cytoplasmic pool of p50-p105 and nuclear translocation. Embo J 16: Wierenga, A. T., I. Vogelzang, B. J. Eggen, and E. Vellenga Erythropoietin-induced serine 727 phosphorylation of STAT3 in erythroid cells is mediated by a MEK-, ERK-, and MSK1-dependent pathway. Exp Hematol 31: Xia, Z. P., and Z. J. Chen TRAF2: a double-edged sword? Sci STKE 2005:pe Yang, J., M. Chatterjee-Kishore, S. M. Staugaitis, H. Nguyen, K. Schlessinger, D. E. Levy, and G. R. Stark Novel roles of unphosphorylated STAT3 in oncogenesis and transcriptional regulation. Cancer Res 65: Yarden, Y., and M. X. Sliwkowski Untangling the ErbB signalling network. Nat Rev Mol Cell Biol 2: Young, L., C. Alfieri, K. Hennessy, H. Evans, C. O'Hara, K. C. Anderson, J. Ritz, R. S. Shapiro, A. Rickinson, E. Kieff, and et al Expression of Epstein-Barr virus transformation-associated genes in tissues of patients with EBV lymphoproliferative disease. N Engl J Med 321: Zancai, P., R. Cariati, M. Quaia, M. Guidoboni, S. Rizzo, M. Boiocchi, and R. Dolcetti Retinoic acid inhibits IL-6-dependent but not constitutive STAT3 activation in Epstein-Barr virus-immortalized B lymphocytes. Int J Oncol 25:

132 68. Zhang, Q., J. A. Didonato, M. Karin, and T. W. McKeithan BCL3 encodes a nuclear protein which can alter the subcellular location of NF-kappa B proteins. Mol Cell Biol 14: Zheng, X., L. Hu, F. Chen, and B. Christensson Expression of Ki67 antigen, epidermal growth factor receptor and Epstein-Barr virus-encoded latent membrane protein (LMP1) in nasopharyngeal carcinoma. Eur J Cancer B Oral Oncol 30B:

133 CHAPTER THREE LMP1 modulates distinctive NF-κB pathways through CTAR1 to regulate EGFR expression Che-Pei Kung and Nancy Raab-Traub

134 ABSTRACT Epstein-Barr Virus (EBV) latent membrane protein 1 (LMP1) is required for EBV B- lymphocyte transformation, transforms rodent fibroblasts, and can induce lymphoma and epithelial hyperplasia in transgenic mice. Two domains have been identified within the intracellular carboxy-terminus that can activate NF-kB, CTAR1 and CTAR2, through interactions with tumor necrosis receptor associated factors (TRAFs). CTAR1 can activate both the canonical and noncanonical NF-κB pathways and has unique effects on cellular gene expression. The epidermal growth factor receptor is highly induced by LMP1-CTAR1 in epithelial cells through activation of a novel NF-κB form containing p50 homodimers and Bcl-3. To further understand the regulation of NF-κB in CTAR1-induced EGFR expression, we evaluated the ability of CTAR1 to induce EGFR in mouse embryonic fibroblasts (MEFs) defective for different NF-κB effectors. CTAR1-mediated EGFR induction required the NFκB Inducing Kinase (NIK) but not the IKK complex components that regulate canonical or noncanonical NF-κB pathways. CTAR1-induction of nuclear p50 occurred in IKKβ-, IKKγ-, and NIK-defective MEFs, indicating that this form is not dependent on the canonical or noncanonical NF-κB pathways. The CTAR1-induction of p50 was proteasome-dependent. EGFR and nuclear p50 were expressed at high levels in TRAF2- fibroblasts and were not induced by LMP1. EGFR was low in TRAF3- fibroblasts and was not induced by LMP1 while in TRAF6- MEFs, EGFR was not expressed but was induced by LMP1-CTAR1. These findings suggest that endogenous EGFR regulation is independent of TRAF2 and that the effects of LMP1-CTAR1 require TRAF3 but are independent of TRAF6. Importantly, this novel NFkB pathway is differentially regulated by TRAF2 and TRAF3. 116

135 INTRODUCTION The Epstein-Barr virus is a human gammaherpesvirus that infects more than 95% of the world population and is associated with multiple malignancies, including Hodgkin s disease (HD), NK or T-cell lymphoma, Burkitt s lymphoma (BL), post-tranplant lymphoproliferative disease (PTLD), gastric carcinoma (GAC), and nasopharyngeal carcinoma (NPC) (44). Latent membrane protein 1 (LMP1) is considered the EBV oncogene and is essential for EBV-mediated B-cell transformation (21). Moreover, LMP1 can transform rodent fibroblast cells and LMP1-transgenic mice develop B-cell lymphoma and epithelial hyperplasia (24, 33, 55, 56). LMP1 is expressed in multiple EBV-associated malignancies and acts as a constitutively active tumor necrosis factor receptor (TNFR) by recruiting TNFR-associated factors (TRAFs) to the cell membrane (22, 51). Numerous cellular genes have been shown to be induced by LMP1, including ICAM-1, TRAF1, A20, Id1, Id3, Bcl-2, Bcl-3, and EGFR (25, 26, 37, 46, 50). LMP1 has two major signaling domains, c-terminal activating region (CTAR) 1 and 2, that bind different TRAFs and activate distinct signaling pathways. CTAR1 recruits TRAF1, 2, 3, and 5, and uniquely activates noncanonical NFkB, phosphatidylinositol 3-kinase (PI3K)-Akt, and the MAPK pathways. CTAR2 recruits TRAF2 and TRAF6 through adaptors TRADD and BS69 to activate canonical NFkB and c-jun N-terminal kinase (JNK) signaling pathway (8, 33, 34, 51). (19, 43). CTAR1 is required LMP1-mediated fibroblast transformation and for B- lymphocyte transformation while CTAR2 is dispensable (19, 33, 34, 43). The nuclear factor-κb (NF-κB) is a transcription-factor family that dimerize and bind to κb sites within the promoter/enhancers to regulate transcription of genes that impact a variety of biological processes, including cell cycle progression, apoptosis, differentiation, 117

136 inflammation, angiogenesis, and cell proliferation (16, 35). The NF-κB family consists of five members, p50, p52, p65 (RelA), RelB, and c-rel, all of which share a Rel homology domain responsible for dimerization and DNA binding. The transcription activation domain required for gene regulation only exists in p65, RelB, and c-rel. The activation of NF-κB is tightly regulated through interactions with inhibitors of NF-κB (IκBs), which include p105 (precursor of p50), p100 (precursor of p52), IκBα, IκBβ, IκBγ, IκBε, IκBζ, and Bcl-3. IκBs mainly function by sequestering inactive NF-κB dimers in the cytoplasm to prevent their activity. Upon receiving an extracellular stimulus, such as binding of TNFα to its receptor, activation of a kinase cascade that includes IκB kinase alpha (IKKα), IKKβ, and IKKγ (NEMO) results in the phosphorylation of IκBs and leads to their ubiquitination and degradation. NF-κB members are then released into the nucleus for transcriptional regulation. In the canonical NF-κB pathway, an IKK complex consisting of IKKα/IKKβ/IKKγ is activated and results in IKKα/IKKβ-mediated phosphorylation and degradation of IκBα. Degradation of IκBα releases multiple NF-κB dimers, primarily p50/p65 into the nucleus. In the noncanonical NF-κB pathway, NF-κB inducing kinase (NIK) phosphorylates and activates IKKα in a IKKβ/γ-independent manner. Activated IKKα phosphorylates p100 and triggers proteasome-mediated processing of p100 to p52, liberating p52-containing NF-κB dimers, such as p52:relb into the nucleus. Due to the very different mechanisms of activation, canonical and noncanonical NF-κB pathways regulate distinctive transcriptional regulation of target genes. In addition to participating in both NF-κB pathways, IKKs/NIK have also been reported to phosphorylate many other proteins besides the IκBs. For example, IKKα and IKKβ can both directly phosphorylate p65 (42). IKKα has also been implicated in the phosphorylation of several nuclear substrates, including SMRT, 118

137 histone H3, and CBP (17, 18, 58). NIK was recently suggested to function as serine kinase of STAT3 (40). Aberrant regulation of NF-κB pathways has been implicated in development of many human cancers (35, 45). Initial studies characterizing LMP1 activation of NFkB showed that although CTAR2 had greater NF-κB activation as determined using reporter assays, CTAR1 induced more complex NF-κB detected by EMSA (20, 36, 52). Subsequent studies revealed that CTAR2 only activates the canonical NF-κB pathway, whereas CTAR1 can activate both the canonical and noncanonical pathways (1, 9, 31, 47). LMP-CTAR1 can transcriptionally activate EGFR expression and this ability was shown to be mediated through a unique NF-κB complex containing p50 homodimers and Bcl-3 (25, 37, 53). The induction of this transcription complex requires activation of STAT3 by CTAR-1 to increase Bcl-3 expression. Although considered a member of the IkB family, Bcl-3 contains a transactivating domain and can bind to p50 and p52 homodimers to induce their transcriptional activating potential (4, 14). To determine if NFkB-regulated EGFR expression was a result of canonical or noncanonical NF-κB, the effects of LMP1-CTAR1 were analyzed in genetically engineered mouse embryonic fibroblasts (MEFs). LMP1-CTAR1 upregulated EGFR was independent of canonical or noncanonical regulation as it did not require IKKα, IKKβ, or IKKχ, but was dependent on NIK. In addition, TRAF2 and TRAF3, but not TRAF6, were required for LMP1-CTAR1-mediated induction of EGFR in MEF cells. These data indicate that in addition to canonical and noncanonical NF-κB pathways, LMP1 manipulates unique NF-κB complexes through CTAR1 to regulate target gene expressions. 119

138 MATERIALS AND METHODS Reagents and Cell Culture C33A cervical carcinoma cells were cultured in Dulbecco s modified Eagle s medium (Gibco) supplemented with 10% fetal bovine serum (Sigma) and antibiotic/antimycotic (Gibco) at 37 C with 5% CO 2. Wild-type, IKKα-/-, IKKβ-/-, IKKγ-/-, NIK aly/aly, TRAF2-/-, and TRAF6-/- mouse embryonic fibroblast (MEF) cells were kindly provided by Elliot Kieff (Harvard university, Boston) and were immortalized by infecting with a human papilloma virus 16 E6/E7 retrovirus to make MEF cells susceptible for transfection or transduction (7, 27, 30-32, 48). TRAF3-/- MEF cells were obtained from Michael Karin (University of California at San Diego) and were spontaneously immortalized by continuous passaging (15). Immortalized MEF cells were maintained in Dulbecco s modified Eagle s medium (Gibco) supplemented with 10% fetal bovine serum (Sigma) and antibiotic/antimycotic (Gibco) at 37 C with 5% CO 2. To inhibit proteasome activity, 1 to 10μM of MG132 (26S inhibitor) or clasto-lactacystin β-lactone (20S inhibitor) (Calbiochem) was added to ~90% confluent cells for 5 hours before preparing cell lysates. Plasmids Generation of plasmid constructs expressing both myc-tagged (pcdna3) and HAtagged (pbabe) full-length LMP1, LMP1-CTAR1 (which contains aa of LMP1), and LMP1-CTAR2 (which has aa of LMP1 deleted) was described previously (11). Myc-tagged and HA-tagged LMP1 constructs contain neomycin- and puromycin-resistant cassette, respectively. HA-tagged LMP1, LMP1-CTAR1, and LMP1-CTAR2 were also 120

139 subcloned into pcdna3 vector with zeocin-resistant cassette by digesting pbabe-lmp1 / CTAR1 / CTAR2 with BamHI / EcoRI and ligated to BamHI / EcoRI-digested pcdna3.1- zeocin vector (Invitrogen). Wild-type and dominant-negative NIK constructs were kindly provided by Christian Jobin (University of North Carolina at Chapel Hill) and Elliot Kieff (Harvard University). Retrovirus production and transduction Recombinant retrovirus production and transduction were performed as previously described to transduce full-length LMP1, CTAR1 (1-231), CTAR2 (d ), or pbabe vector control (25). Briefly, ~60-80% confluent 293T cells in 100mm plates were triply transfected using FuGEGE6 transfection reagent (Roche) according to the manufacturer s instruction with 5µg pbabe (vector), pbabe-ha-lmp1, pbabe-ha-ctar1, or pbabe-ha- CTAR2, and 5µg pvsv-g and 5µg pgag/pol expressing plasmids. After 24 hours of incubation at 37 C, the culture media were replaced with fresh media and the cells were transferred to 33 C for another 24 hours of incubation. Cell supernatants were centrifuged at 1000g for 5 min to remove cell debris and virus-containing supernatant was collected and stored in -80 C if not immediately used. Cells to be transduced were grown to ~70-80% of confluence and then transduced with virus-containing supernatant with 4µg/ml polybrene for hours at 37 C. Generation of stable cell lines C33A stable cell lines expressing CTAR1 (1-231) or vector control pbabe were established by retroviral transduction followed by selection and passages in the presence of 121

140 1µg/ml puromycin (Sigma). IKKβ-/- and NIK aly/aly MEF cells stably expressing CTAR1 were generated by transducing cells with pbabe- and CTAR1-containing retrovirus solution with 4µg/ml polybrene for hours at 37 C, followed by selection and passages in the presence of 1µg/ml puromycin. IKKα-/- and IKKγ-/- MEF cells stably expressing CTAR1 were made by transfecting cells with myc-tagged pcdna3 vector or pcdna3-ctar1 construct using FuGEGE6 transfection reagent for 48 hours at 37 C, followed by selection and passages in the presence of 0.8mg/ml G418 (Mediatech). Stable LMP1-, CTAR1-, and CTAR2-expressing TRAF2-/- and TRAF6 MEF cells were generated by transfecting cells with HA-tagged pcdna3.1 vector, pcdna3.1-lmp1, pcdna3.1-ctar1, or pcdna3.1- CTAR2 construct using FuGEGE6 transfection reagent for 48 hours at 37 C, followed by selection and passages in the presence of 400μg/ml Zeocin (Invitrogen). Fractionation of Cells Cells were fractionated as previously described (25). Briefly, after cultured cells reached ~90% confluence, cells were scrape harvested, washed once with cold phosphatebuffered saline (PBS, Gibco), centrifuged at 1000g for 5-10 min to get cell pellets. Whole cell lysates were made by lysing cells with RIPA buffer (20mM Tris-HCl [ph 7.5], 150mM NaCl, 1mM EDTA, 1% NP-40, 0.1% sodium dodecyl sulfate [SDS], 0.1% deoxycholic acid) supplemented with phenylmethylsulfonyl fluoride (PMSF), sodium orthovanadate (Na 3 VO 4 ), protease and phosphatase inhibitor cocktail (Sigma). After incubation at 4 C for 15min, lysates were then clarified by centrifugation at 13,000 rpm, 4 C for 15 min and supernatants containing whole cell lysates were transferred to new tubes. Nuclear extracts were made by lysing initial cell pellets in a hypotonic buffer (20 mm 122

141 HEPES, 10 mm KCl, 0.1 mm EDTA, 0.1 mm EGTA) supplemented with PMSF, Na 3 VO 4, protease and phosphatase inhibitor cocktail (Sigma) for 15 min on ice. Nonidet P-40 was then added to a final concentration of 1%, followed by 1 min of vortex. Nuclei were pelleted by low-speed centrifugation at 2,000 rpm for 10 min at 4 C and the supernatant were collected as cytoplasmic fraction. The nuclei fraction was purified using the Optiprep reagent (Sigma) as directed by the manufacturer. Nuclei were lysed with nuclear extraction buffer (20 mm Tris-HCl [ph 8.0], 420 mm NaCl, 1.5 mm MgCl 2, 0.2 mm EDTA, 25% glycerol, PMSF, Na 3 VO 4, protease and phosphatase inhibitor cocktail [Sigma]) with the salt concentration adjusted to 400 mm with 5 M NaCl. All lysates were stored at -80 C. Western Blot Analysis Protein concentration of cell lysates was determined using Bio-Rad DC protein assay system according to manufacturer s instruction. Equal amounts of protein were used for SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to Optitran (Schleicher and Schuell) for Western blot analysis. Primary antibodies used include anti-p50 (Abcam), anti-p65 (RelA), anti-nik, anti-relb, anti-gapdh, anti-grp78, anti-parp (Santa Cruz), anti-phospho-stat3 (Ser 727 and Tyr 705) (Cell Signaling), anti-phospho-egfr (Tyr 1068), anti-β-catenin (BD Biosciences), and anti-ha tag (Covance). A rabbit antiserum raised against the carboxyl-terminal 100 amino acids of the EGFR fused to glutathione S- transferase was kindly provided by H. Shelton Earp (University of North Carolina at Chapel Hill) and used to detect total EGFR expression. Secondary antibodies used to detect bound proteins include horseradish peroxidase-conjugated antimouse, antirabbit (Amersham Pharmacia), and antigoat (DAKO). After treatment with secondary antibodies, blots were 123

142 developed using Pierce Supersignal West Pico chemiluminescence system followed by exposure to film (ISCBioexpress). RESULTS LMP1 Effects on EGFR expression in mouse embryonic fibroblast cells. To assess the induction of EGFR expression by LMP1 in mouse embryonic fibroblast (MEF) cells, full length LMP1, LMP1-CTAR1, and LMP1-CTAR2 were expressed using the pbabe retroviral vector and transduced into wild-type MEF cells (11). The expression of LMP1 and deletion mutants and EGFR was determined by immunoblotting (Figure 1). EGFR was WTMEF EGFR HA GRP78 Fig 1. EBV LMP1-CTAR1 mediates mild induction of EGFR expression in mouse embryonic fibroblast (MEF) cells. Control vector pbabe, full length LMP1, truncated LMP1 containing only CTAR1, or truncated LMP1 containing only CTAR2 were transduced into wild-type MEF cells. Expression of EGFR and LMP1 derivatives were analyzed by immunoblotting with EGFR and HA-tag antibodies. Expression of GRP78 was measured by immunoblotting as loading control. 124

143 readily detected in the wt MEFs, and both LMP1 and LMP1-CTAR1 increased EGFR expression while LMP1-CTAR2 alone did not affect it (25, 53). The induction of EGFR by LMP1 was less in the MEF cells than was previously shown in the C33A cells, a difference that likely reflects the higher basal levels of expression in the MEFs. CTAR1-mediated EGFR upregulation is NIK-dependent, but NIK is not sufficient to mimic LMP1-mediated EGFR induction. CTAR1 of LMP1 activates both the canonical and noncanonical NF-κB pathways to activate distinct NF-κB complexes, including p50/65, p52/p50, p52/relb, and p50/50 (36, 43). The activation of canonical or noncanonical NFkB is linked to complexes that contain different members of the inhibitor of NF-κB kinase kinases (IKK). The canonical pathway requires IKKα, IKKβ and in some instances, IKKγ, while the noncanonical pathway requires the activation of IKKα resulting from phosphorylation by the NF-κB inducing kinase, NIK. The effects of expression of LMP1 or CTAR1 on EGFR and serine and tyrosine phosphorylation of STAT3 were evaluated in MEF cells lacking these regulators of NF-κB pathway (Figure 2). The MEFS had differing levels of endogenous EGFR, however, LMP1 or LMP1-CTAR1 induced EGFR protein in IKKα-, IKKβ-, and IKKγ-defective MEF cells. As these IKKs are required for activation of the canonical NF-κB pathway, these data indicate that LMP1-mediated EGFR upregulation is not dependent on the canonical NF-κB pathway. Moreover, since IKKα is the critical regulator in the noncanonical NF-κB pathway, the result also reveals that the noncanonical NF-κB pathway is not required for LMP1-mediated EGFR induction. Interestingly, EGFR expression was not induced by CTAR1 in NIK-defective MEF cells. These results suggest that LMP1 induces EGFR through an IKKα-independent but NIKspecific pathway. 125

144 WTMEF V L1 IKKα-/- IKKβ-/- IKKγ-/- NIK-/- V C1 V C1 V C1 V C1 LMP1/CTAR1 EGFR GRP78 Ser-P-STAT3 Tyr-P-STAT3 Fig 2. LMP1-mediated EGFR upregulation is NIK-dependent. Full-length LMP1 or CTAR1 were transduced into wild-type MEF cells or MEF cells defective for IKKα, IKKβ, IKKγ, or NIK. Expressions of LMP1 or CTAR1 were confirmed by immunoblotting with specific antibody against HA-tag or Myc-tag. Expression levels of EGFR, serinephosphorylated STAT3, or tyrosine-phosphorylated STAT3 were analyzed by immunoblotting. Expression of GRP78 was measured by immunoblotting as loading control. V: vector control; L1: LMP1; C1: CTAR1. Expression of LMP1 increased serine phosphorylation of STAT3 in wild-type MEF cells, IKKα, and IKKγ-defective MEF cells, but not in IKKβ or NIK null mice both of which had high basal levels. Elevated tyrosine phosphorylation was detected in wild-type, IKKγand NIK-defective cells, but not in IKKα- or IKKβ-defective MEF cells. Importantly, the effects of LMP1 on EGFR and STAT3 were not linked to the canonical or noncanonical NFκB pathways but were linked to the presence of NIK. A previous study showed that NIK could function as a serine kinase of STAT3 although the high basal levels of serine phosphorylated STAT3 in NIK null cells indicate that 126

145 other kinases can clearly phosphorylate STAT3 (40). To confirm the requirement for NIK in LMP1-induced EGFR expression, CTAR1-expressing C33A cells were transiently transfected with dominant-negative NIK construct (DNNIK), DNNIK with aly-mutation (G860R; DNNIK aly ), or kinase-dead NIK (NIK(K-A)) for 48 hours and the expression levels of EGFR and serine-phosphorylated STAT3 were analyzed by immunoblotting (Figure 3A). DNNIK and DNNIK aly express the c-terminus of NIK without the kinase domain. NIK (K- A) expresses the full-length NIK with a mutation in the kinase domain that abrogates its kinase activity. Transfection of NIK (K-A), but not DNNIK or DNNIK aly, reduced CTAR1- induced EGFR expression significantly by 35%. Similarly, NIK (K-A) decreased CTAR1- induced serine phosphorylation of STAT3 by 34%, while DNNIK and DNNIK aly did not have significant effects. These findings indicate that NIK contributes to the EGFR upregulation by LMP1 through mediating induction of STAT3 serine phosphorylation. To determine whether NIK itself is sufficient to induce ser-pstat3 and EGFR upregulation, wild-type NIK was transiently transfected into both C33A and 293T cells and EGFR expression and ser-pstat3 were assessed by western blot analysis (Figure 3B). NIK expression was clearly detected in 293T cells, however, overexpression of NIK did not induce ser-pstat3 or EGFR expression. In C33A cells, transfection of 4μg of NIK very slightly increased ser-pstat3, however failed to induce expression of EGFR. To determine whether NIK perhaps requires activation of additional pathways affected by CTAR1 to induce STAT3 activation and EGFR expression, CTAR1-expressing NIK-defective MEF cells were also transfected with increasing amounts of the WT NIK construct. Expression of CTAR1 was confirmed by western blot analysis using antibody to the HA tag and the effects on EGFR and ser-pstat3 were determined (Figure 3C). Similarly to the results observed in 127

146 A) B) CTAR1 C33A C33A WTNIK(ug) 293T EGFR Ser-P-STAT3 Relative level Fold(normalized to GAPDH) NIK GAPDH EGFR level * CTAR1 DMSO CTAR1 DNNIK CTAR1 NIK(K-A) CTAR1 NIKaly EGFR NIK Ser-P-STAT3 GAPDH C) NIK-/- MEF CTAR1 WTNIK(ug) EGFR NIK Ser-P-STAT3 HA(CTAR1) GAPDH Fig 3. Blocking NIK reduces LMP1-induced EGFR expression, but overexpression of NIK is not sufficient to mimic LMP1-mediated EGFR upregulation. A) C33A cells stably expressing CTAR1 was transfected with pcdna3 control vector or dominant-negative NIK construct (DNNIK), DNNIK construct with aly-mutation (G860R; DNNIK aly ), or kinasedead NIK (NIK (K-A)). Expression level of serine-phosphorylated STAT3 and EGFR were analyzed by immunoblotting. Expressions of NIK mutants were detected by immunoblotting using antibody against C-terminus of NIK. Expression of GAPDH was measured by immunoblotting as loading control. Intensity of ser-p-stat3 and EGFR bands were quantitated by Image J software and normalized to the expression level of GAPDH from three independent experiments. *P<0.05. B) C33A and 293T cells were transfected with increasing amount of wild-type NIK expression construct. C) NIKdefective MEF cells stably expressing CTAR1 were transfected with increasing amount of wild-type NIK expression construct. CTAR1 expression was confirmed by immunoblotting with antibody against HA-tag. Expression of NIK, EGFR, and serine-phosphorylated STAT3 were analyzed with immunoblotting. Expression of GAPDH was measured by immunoblotting as loading control. 128

147 293T and C33A cells, overexpression of NIK in NIK-defective MEF cells was not sufficient to induce either ser-pstat3 or EGFR induction, even in the presence of CTAR1. These results suggest that although NIK is required for CTAR1-mediated EGFR upregulation, NIK overexpression alone is not sufficient to induce these pathways and additional factors or processes are required for ser-pstat3 or EGFR expression. CTAR1-mediated p50 activation is not dependent on the canonical or noncanonical NF-κB pathways. LMP1 induction of EGFR transcription is mediated through effects on Bcl-3 and induction of p50-homodimers (25, 52, 53). To determine the requirement for specific IKK complexes on CTAR1-mediated p50 activation, CTAR1- expressing wild-type, IKKβ-, IKKγ-, and NIK-defective MEF cells were fractionated and the nuclear lysates analyzed to detect nuclear expression of p65, p50, and RelB (Figure 4). The expression of PARP was analyzed as a loading control for the nuclear lysates. Nuclear translocation of p65 is characteristic of the canonical pathway and p65 was detected in the nuclear lysates from WT, IKKγ-, and NIK-defective MEFs but not in IKKβ-defective cells. Nuclear RelB is the major form of NF-κB that represents the noncanonical pathway and CTAR1 induced nuclear translocation of RelB in wild-type and IKKβ-defective MEF cells, but not in NIK-defective cells. These findings confirm that CTAR1-mediated translocation of p65 reflects activation of the canonical pathway and that the effects of LMP1 on RelB require the noncanonical pathway. In contrast, the nuclear expression of p50 was significantly induced by CTAR1 in IKKβ-, IKKγ- and NIK-defective MEF cells. This indicates that CTAR1-mediated p50 activation and nuclear translocation are distinct from both the canonical and noncanonical NF-κB pathways. A high basal level of nuclear p50 was 129

148 detected in wild-type MEF cells and may be linked to the higher level of EGFR in wt-mefs and the slight effects of LMP1 on EGFR expression compared to that in C33A cells. Nuclear lysates WTMEF V C1 V C1 V C1 IKKβ-/- NIK-/- IKKγ-/- V C1 p65 p50 PARP RelB Fig 4. CTAR1-mediated p50 activation is not dependent on canonical or noncanonical pathway. Wild-type, IKKβ-/-, IKKγ-/-, and NIK aly/aly MEF cells stably transduced with vector or CTAR1 were fractionated and nuclei lysates were subjected to immunoblot analysis with antibodies specifically against p65 (RelA), p50, and RelB. PARP expression was analyzed by immunoblotting as loading control. LMP1-mediated p50 activation is proteasome-dependent. The mechanisms responsible for p50 activation have not been clearly defined. Several studies have indicated that p50 can be activated by a proteasome-dependent mechanism that either modulates p105 processing or impairs ribosomal progression (23). To determine whether p50 is activated by CTAR1 through proteasome-mediated mechanisms, C33A cells stably transduced with vector or CTAR1 were treated with DMSO or proteasome inhibitors, MG132 (26S inhibitor) or clasto-lactacystin β-lactone (20S inhibitor) (Figure 5). The effects of these inhibitors on p105/50 were assessed by immunoblotting anti-p105/50 antibodies. β-catenin is a known 130

149 target of proteasomal degradation and was analyzed as a positive control for inhibition of proteasome activity. GAPDH and Emerin were analyzed as loading control for whole cell lysates and nuclear lysates, respectively. In CTAR1-expressing C33A cells where nuclear expression of p50 is significantly induced, treatment with 1μM or 10μM of MG132 reduced p50 translocation level by 72% and 64%, respectively (Figure 5A). Similarly, treatment with 1μM or 10μM of clasto-lactacystin β-lactone reduced CTAR1-induced p50 nuclear translocation by 35% and 69%, respectively. Nuclear p50 was not detected in the C33A cells transduced with the pbabe control plasmid, and treatment with proteasome inhibitors did not have a significant effect (data not shown). This result indicates that LMP1-CTAR1 induces p50 activation and nuclear translocation are mediated through effects on proteasome activity. CTAR1 did induced the expression of β-catenin in C33A cells which is consistent with findings that LMP1 affects the expression of junctional proteins (49). In cells treated with proteasome inhibitors, β-catenin levels were increased and a higher molecular weight forms of β-catenin was detected, reflecting its ubiquitination and the successful inhibition of proteasomal activity. The level of p105-to-p50 processing was determined by calculating the ratio of p50 to the total p105/50 complex in whole cell lysates of C33A cells transduced with pbabe control or CTAR1 (Figure 5B). The processing of p105 to p50 was enhanced by approximately 15% in CTAR1-expressing C33A cells compared to pbabe control cells. After MG132 treatment, the percentage of processed p50 was not significantly affected in either vector control or CTAR1-expressing cells. Treatment with 20S proteasomal inhibitor clasto-lactacystin β-lactone did not affect p50 processing in pbabe control cells. However, treatment of 10μM clasto-lactacystin β-lactone reduced p50 processing in CTAR1- expressing cells to approximately 40%, which is similar to the level observed in pbabe 131

150 A) DMSO Nuclear lysates C33A-CTAR1 MG132 1μM MG132 10μM Lactone 1μM Lactone 10μM p50 Relative level Emerin B) DMSO MG132 Lactone p105 Whole cell lysates pbabe CTAR μM 10μM 1μM 10μM 1μM 10μM 1μM 10μM p50 β-catenin GAPDH (p50/p105+p50) X 100 (%) DMSO MG132 Lactone Processing of p105 to p50 in C33A cells + + 1μM 10μM 1μM 10μM pbabe 1μM 10μM CTAR1 Fig 5. CTAR1 mediates p50 activation through proteasome-dependent pathways. C33A cells stably transduced with vector control or CTAR1 were treated with DMSO or proteasome inhibitor MG132 or β-lactone (1 or 10μM) for 5 hours and subjected to fractionation. A) Nuclear lysates and B) Whole cell lysates of these cells were analyzed by immunoblotting. Antibody against p105/50 was used to detect the processing and activation of p50. Expression of GAPDH and Emerin were detected as loading controls for whole cell lysates and nuclear lysates, respectively. Intensity of p105/50 bands were quantitated by Image J software and percentage of processed p50 in whole cell lysates was calculated by [p50 / (p50+p105)] 100%. The level of p50 nuclear expression was quantitated by normalizing p50 to the expression level of Emerin. 1μM 10μM 132

151 control cells. These findings indicate that LMP1-CTAR1 mediates proteasome-dependent mechanisms to induce p50 activation. LMP1-mediated EGFR induction requires TRAF2 and TRAF3, but not TRAF6. Initial studies showed that the TRAF-binding motif of LMP1 was required for CTAR1- induced EGFR expression and NF-κB activation and these effects were decreased by dominant negative TRAF2 and TRAF3 (36, 38). To further evaluate this requirement, LMP1 and LMP1-CTAR1 were expressed in MEF cells deficient for TRAF2, TRAF3, or TRAF6 (Figure 6). The expression levels of EGFR, and LMP1 and deletion mutants were determined using immunoblotting of whole cell lysates (Figure 6A). LMP1 and CTAR1 were detected using antibodies against the HA- or myc-epitope tags. EGFR was expressed at high levels in TRAF2-/- MEFs, intermediate levels in TRAF3-/- MEFs, and was barely detected in TRAF6-/- MEFs. This confirmed that the presence and absence of TRAFs modulate expression of the EGFR. Expression of LMP1 or CTAR1 changed these patterns of expression. In the TRAF2-null and TRAF3-null MEFs, LMP1 or CTAR1 expression did not increase EGFR expression. In contrast, in the TRAF6-null MEFs, LMP1 and CTAR1 clearly induced EGFR expression. The ability of LMP1-CTAR1 to induce EGFR in TRAF6- null MEFs but not in TRAF2- or TRAF3-null MEFS is consistent with previously identified interactions between CTAR1 with TRAF2 and TRAF3 but not with TRAF6. The nuclear level of p50 was also analyzed in TRAF2-/-, TRAF3-/-, and TRAF6-/- MEFs by immunoblotting (Figure 6B). Compared to the vector control cells, CTAR1 induced nuclear expression of p50 in TRAF3-/- and TRAF6-/- cells but did not affect nuclear p50 levels in TRAF2-/- MEF cells that had elevated basal nuclear p50. These results indicate that TRAF3 and TRAF6 are not required for LMP1-CTAR1 effects on p50 activation and 133

152 A) EGFR LMP1 CTAR1 GRP78 B) TRAF2-/- TRAF3-/- TRAF6-/- Nuclear lysates TRAF2-/- TRAF3-/- TRAF6-/- p50 PARP Fig 6. LMP1-mediated EGFR upregulation is TRAF2- and TRAF3-, but not TRAF6- dependent. A) TRAF2-/-, TRAF3-/-, and TRAF6-/- MEF cells were transfected or transduced with vector control, full-length LMP1, CTAR1 or CTAR2, and whole cell lysates of these cells were subject to immunoblotting with EGFR-specific antibodies. Expressions of LMP1 or CTAR1 were confirmed by immunoblotting with specific antibody against full-length LMP1 (S12), HA-tag or Myc-tag. Expression of GRP78 was detected as loading control. B) TRAF2-/-, TRAF3-/-, and TRAF6-/- MEF cells expressing CTAR1 were fractionated and nuclear lysates were analyzed by immunoblotting with p50 antibody. Expression of PARP was detected as loading control. that in the absence of TRAF2, nuclear levels of p50 are elevated and LMP1-CTAR1 did not further increase nuclear p50. TRAF6 was not required for CTAR1-mediated effects on p50 translocation and EGFR upregulation. 134

153 DISCUSSION LMP1 is a member of the TNFR family and potently activates NF-κB transcriptional activity. Early studies identified that two distinct NF-κB activating domains in the carboxy terminus, CTAR1 and CTAR2 and determined that CTAR2 had greater activity in NF-κB reporter assays (19, 43). However, identification of the specific complexes using electrophoretic mobility shifts assay (EMSA) revealed that CTAR1 activated multiple forms of NF-κB while CTAR2 primarily activated a complex containing p65. In addition, it was shown that CTAR1 significantly enhanced processing of p100 to p52. Subsequent studies have further characterized activation of NF-κB and defined the canonical pathway that involves the IKK complex containing IKKα, IKKβ, and IKKγ to phosphorylate and negatively regulate the inhibitor of NFkB, IκBα. It is now known that CTAR2 activates IKKγ (NEMO) / IKKβ-dependent canonical NF-κB pathway through TRAF6 / IRAK1 / TAK1 (30, 47, 57). CTAR1, on the other hand, activates IKKγ (NEMO)-independent but NIK / IKKα-dependent noncanonical NF-κB pathway, in addition to some activation of the canonical pathway (1, 9, 31). An atypical IKKβ-dependent / IKKγ-independent NF-κB activation has also been previously described in LMP1-expressing cell culture models (31). Our previous studies have identified an additional LMP1-mediated activation of NF-κB, in which CTAR1 of LMP1 activates two NF-κB members, p50 and Bcl-3, that are induced to bind to the EGFR promoter by LMP1 and increase EGFR transcription (25, 52, 53). The data in this study indicate that this novel pathway is independent of factors required for activation of the canonical or noncanonical NF-κB pathways. IKKα, IKKβ, and IKKγ, all important components in canonical NF-κB pathway, were not required for CTAR1-induced EGFR expression (Figure 2). This result is consistent with previous data indicating that 135

154 CTAR2 alone was not able to induce EGFR expression despite its ability to activate strong canonical NF-κB signaling (Figure 1) (25, 36). Although the CTAR1-mediated EGFR induction was inhibited in NIK aly/aly cells, perhaps suggesting a requirement for the noncanonical NF-κB pathway, CTAR1-mediated induction of EGFR did not require IKKα, the functional kinase in the noncanonical NF-κB pathway. The decreased EGFR induction by the dominant-negative NIK constructs, kinase-dead NIK (K-A), in CTAR1-expressing C33A cells suggests that NIK does contribute to CTAR1-mediated EGFR induction (Figure 3A). The lack of effect by DNNIK aly on CTAR1-induced EGFR expression suggests that specific protein interactions and functions mediated through the aly residue (G860R) is important for EGFR upregulation. This result is consistent with the observation that CTAR1 could not induce EGFR expression in NIK aly/aly MEF cells. In contrast to NIK (K-A), DNNIK did not significantly reduce CTAR1-induce STAT3 serine phosphorylation and EGFR expression, despite both constructs contain the TRAF/IKK binding domain. This result indicates that N-terminus of NIK also contributes to EGFR upregulation. NIK expression was not sufficient for CTAR1-mediated STAT3 activation and EGFR upregulation in epithelial cells, and overexpression of wild-type NIK in the presence of CTAR1 did not induce ser-pstat3 or EGFR induction in NIK deficient cells (Figure 3B and 3C). These findings suggest that additional potentially NIK-associated factors or NIKmediated effects on other kinases contribute to this pathway and that a balance of expression level between NIK and NIK-associated factors may be required. These findings are similar to the requirement for TRAF3 for LMP1 signaling. Although TRAF3 is required for LMP1- mediated signaling pathways and transformation, overexpression of TRAF3 in LMP1- expression cells impairs CTAR1-mediated NF-κB activation (2, 34, 36, 38). TRAF3 binds 136

155 strongly to CTAR1 and its overexpression likely alters the components in the LMP1/TRAF complexes that activate NF-κB. It is known that both TRAF3 and TRAF2 regulate NIK and it is thought that TRAF3 is required to form a complex containing TRAF2 and ciap that induces NIK turnover (54). This suggests a negative regulatory mechanism between TRAF2/TRAF3 and NIK. However, CTAR1 failed to induce EGFR expression in MEF cells defective for TRAF2, TRAF3, or NIK. It is possible that LMP1-CTAR1 may mediate EGFR upregulation through NIK by sequestering NIK regulators TRAF2 and TRAF3. This hypothesis would be consistent with the ability of LMP1 to modulate formation of TRAF-containing complexes and their effects on various targets. The other important member of EGFR-inducing complex, p50 is activated and translocated into the nucleus in LMP1/CTAR1-expressing C33A cells (25, 43, 53). Several mechanisms have been suggested to mediate p50 activation. This study reveals that CTAR1- induced p50 activation is not dependent on either canonical or noncanonical NF-κB pathway since this occurred in IKKβ-, IKKγ- and NIK-defective MEF cells (Figure 4). Interestingly, CTAR1 did not induce significant p50 activation in wt-mef cells. This may be due to the relatively high level of nuclear p50 in wt-mef cells, and may partially explain why LMP1 only slightly induced EGFR expression in wt-mef cells compared to C33A or other mutant MEF cells. Multiple studies have suggested that p50 can be activated through processing of its precursor, p105. This processing could occur in ubiquitination-dependent or ubiquitinationindependent fashions (3, 5, 23, 39). It was also suggested that p50 could be generated through a mechanism involved cotranslational ribosome halting (28, 29). One consensus 137

156 among these suggested mechanism is that they are all proteasome-dependent. The data presented here indicate that CTAR1 indeed induces processing of p50, which is consistent with previous studies (43). Proteasome inhibition with both 26S and 20S inhibitors reduced p50 activation in CTAR1 expressing cells (Figure 5). These results indicate that CTAR1 activates p50 in part through proteasome-dependent processing of p105 to p50. Interestingly, both 26S inhibitor MG132 and 20S inhibitor clasto-lactacystin β-lactone inhibit CTAR1- induced nuclear translocation of p50, but only clasto-lactacystin β-lactone reduced processing of p105 to p50 in CTAR1 cells to a level similar to that in pbabe control cells. This suggests that while 20S proteasome is responsible for CTAR1-mediated processing of p50, MG132 blocks separate pathways that contribute to CTAR1-induced p50 activation (39). It is possible that both MG132 and clasto-lactacystin β-lactone block CTAR1- mediated nuclear translocation of p50, which only accounts for a small subset of CTAR1- induced p50 processing and the differences may not be detectable in the total cell lysates. It is likely that LMP1 regulates multiple pathways to mediate p50 activation. This is supported by the observation that CTAR1 induced p50 activation in MEF cells defective for IKKβ, which has been suggested as the kinase responsible for p105 processing (5). Moreover, LMP1-CTAR1 could also affect regulatory pathways to induce p50 translocation. Several proteins have been suggested previously to regulate p50 translocation, including Bcl-3 and Importin-3α (12, 59). The fact that LMP1-CTAR1 induces Bcl-3 expression and nuclear localization makes it an attractive candidate (25, 41). It will be of interest to determine if Bcl-3 and Importins contribute to CTAR1-mediated p50 activation and induction of EGFR. LMP1-associated TRAFs are important for LMP1-mediated signaling pathways, including JNK, p38, and NF-κB activation (51). Our initial studies indicated that the TRAF- 138

157 binding motif of CTAR1 was required for LMP1 induction of EGFR expression (36). Expression of CTAR1 in MEF cells defective for different TRAFs revealed that TRAF2 and TRAF3, but not TRAF6, are required for CTAR1-mediated EGFR induction (Figure 6). This result is consistent with the findings that TRAF2 and TRAF3, but not TRAF6, interact with CTAR1 TRAF-binding motif. TRAF2 may contribute to EGFR induction by regulating p50 activation, while TRAF3 may contribute to EGFR induction through independent pathways. It has been suggested that kinase Tpl-2/Cot functions downstream of TRAF2 to modulate p105 degradation (10). It will be interesting to see if Tpl-2/Cot plays a role in LMP1- induced EGFR expression. Although TRAF6 does not interact with CTAR1, it has been shown that TRAF6 can interact with NIK (6). It is possible that the interaction of CTAR2 with TRAF6 modulates the TRAF6 interaction with NIK and NIK-regulated activation of ser-pstat3 or downstream kinases. LMP1 containing CTAR1 but deleted for CTAR2 usually has elevated effects in comparison to full-length LMP1 in C33A cells (25). The effects of the two domains on various TRAF containing complexes are likely the basis for the enhanced activity of CTAR1 in the absence of CTAR2. It is also interesting to note that another potential STAT3 kinase, ERK, has been shown to be regulated by NIK and CTAR1- mediated ERK activation and transformation was also inhibited by dominant-negative TRAF2 or TRAF3, but not TRAF6 (13, 34). The interaction of LMP1 with TRAF2 and TRAF3 likely activates multiple potentially redundant kinases that affect transcription factors that regulate EGFR expression. In conclusion, this study reveals that LMP1-CTAR1 induces EGFR expression through NIK, TRAF2, and TRAF3 independently of traditionally-defined canonical and noncanonical NF-κB pathways. Two important EGFR-inducing factors, STAT3 and p50, are 139

158 regulated distinctively in the presence or absence of various IKK and TRAF molecules. The effects of LMP1 on the ser-pstat3 potentially require NIK, whereas the effects on p50 require TRAF2 but are independent of NIK, TRAF3, and TRAF6. Additionally, LMP1- CTAR1 activates p50 through proteasome-dependent processing of p105 to p50. The data suggest that distinct combinations of LMP1-activated effectors regulate the effects of LMP1 expression and its ability to induce transformation. The further study of LMP1 and its activation of NF-κB and additional pathways will likely clarify the link between specific signal transducing complexes and the downstream effectors, as well as its contribution to EBV-associated cancer development. ACKNOWLEDGEMENTS We thank H. Shelton Earp for providing anti-egfr rabbit antiserum. We thank Dr. Elliot Kieff and Dr. Michael Karin for providing MEF cells. We thank Dr. Elliot Kieff and Dr. Christian Jobin for providing NIK and DNNIK constructs. This work was supported by NIH grants CA32979, CA19014 to N.R.-T. 140

159 REFERENCES 1. Atkinson, P. G., H. J. Coope, M. Rowe, and S. C. Ley Latent membrane protein 1 of Epstein-Barr virus stimulates processing of NF-kappa B2 p100 to p52. J Biol Chem 278: Bishop, G. A., and P. Xie Multiple roles of TRAF3 signaling in lymphocyte function. Immunol Res 39: Ciechanover, A., H. Gonen, B. Bercovich, S. Cohen, I. Fajerman, A. Israel, F. Mercurio, C. Kahana, A. L. Schwartz, K. Iwai, and A. Orian Mechanisms of ubiquitin-mediated, limited processing of the NF-kappaB1 precursor protein p105. Biochimie 83: Cogswell, P. C., D. C. Guttridge, W. K. Funkhouser, and A. S. Baldwin, Jr Selective activation of NF-kappa B subunits in human breast cancer: potential roles for NF-kappa B2/p52 and for Bcl-3. Oncogene 19: Cohen, S., H. Achbert-Weiner, and A. Ciechanover Dual effects of IkappaB kinase beta-mediated phosphorylation on p105 Fate: SCF(beta-TrCP)-dependent degradation and SCF(beta-TrCP)-independent processing. Mol Cell Biol 24: Darnay, B. G., J. Ni, P. A. Moore, and B. B. Aggarwal Activation of NFkappaB by RANK requires tumor necrosis factor receptor-associated factor (TRAF) 6 and NF-kappaB-inducing kinase. Identification of a novel TRAF6 interaction motif. J Biol Chem 274: Delhase, M., M. Hayakawa, Y. Chen, and M. Karin Positive and negative regulation of IkappaB kinase activity through IKKbeta subunit phosphorylation. Science 284: Eliopoulos, A. G., S. M. Blake, J. E. Floettmann, M. Rowe, and L. S. Young Epstein-Barr virus-encoded latent membrane protein 1 activates the JNK pathway through its extreme C terminus via a mechanism involving TRADD and TRAF2. J Virol 73: Eliopoulos, A. G., J. H. Caamano, J. Flavell, G. M. Reynolds, P. G. Murray, J. L. Poyet, and L. S. Young Epstein-Barr virus-encoded latent infection membrane protein 1 regulates the processing of p100 NF-kappaB2 to p52 via an IKKgamma/NEMO-independent signalling pathway. Oncogene 22: Eliopoulos, A. G., C. Davies, S. S. Blake, P. Murray, S. Najafipour, P. N. Tsichlis, and L. S. Young The oncogenic protein kinase Tpl-2/Cot contributes to Epstein-Barr virus-encoded latent infection membrane protein 1-induced NFkappaB signaling downstream of TRAF2. J Virol 76:

160 11. Everly, D. N., Jr., B. A. Mainou, and N. Raab-Traub Induction of Id1 and Id3 by latent membrane protein 1 of Epstein-Barr virus and regulation of p27/kip and cyclin-dependent kinase 2 in rodent fibroblast transformation. J Virol 78: Fagerlund, R., L. Kinnunen, M. Kohler, I. Julkunen, and K. Melen NF- {kappa}b is transported into the nucleus by importin {alpha}3 and importin {alpha}4. J Biol Chem 280: Foehr, E. D., J. Bohuslav, L. F. Chen, C. DeNoronha, R. Geleziunas, X. Lin, A. O'Mahony, and W. C. Greene The NF-kappa B-inducing kinase induces PC12 cell differentiation and prevents apoptosis. J Biol Chem 275: Fujita, T., G. P. Nolan, H. C. Liou, M. L. Scott, and D. Baltimore The candidate proto-oncogene bcl-3 encodes a transcriptional coactivator that activates through NF-kappa B p50 homodimers. Genes Dev 7: Hacker, H., V. Redecke, B. Blagoev, I. Kratchmarova, L. C. Hsu, G. G. Wang, M. P. Kamps, E. Raz, H. Wagner, G. Hacker, M. Mann, and M. Karin Specificity in Toll-like receptor signalling through distinct effector functions of TRAF3 and TRAF6. Nature 439: Hayden, M. S., and S. Ghosh Shared principles in NF-kappaB signaling. Cell 132: Hoberg, J. E., A. E. Popko, C. S. Ramsey, and M. W. Mayo IkappaB kinase alpha-mediated derepression of SMRT potentiates acetylation of RelA/p65 by p300. Mol Cell Biol 26: Huang, W. C., T. K. Ju, M. C. Hung, and C. C. Chen Phosphorylation of CBP by IKKalpha promotes cell growth by switching the binding preference of CBP from p53 to NF-kappaB. Mol Cell 26: Huen, D. S., S. A. Henderson, D. Croom-Carter, and M. Rowe The Epstein-Barr virus latent membrane protein-1 (LMP1) mediates activation of NFkappa B and cell surface phenotype via two effector regions in its carboxy-terminal cytoplasmic domain. Oncogene 10: Kaye, K. M., O. Devergne, J. N. Harada, K. M. Izumi, R. Yalamanchili, E. Kieff, and G. Mosialos Tumor necrosis factor receptor associated factor 2 is a mediator of NF-kappa B activation by latent infection membrane protein 1, the Epstein-Barr virus transforming protein. Proc Natl Acad Sci U S A 93: Kaye, K. M., K. M. Izumi, and E. Kieff Epstein-Barr virus latent membrane protein 1 is essential for B-lymphocyte growth transformation. Proc Natl Acad Sci U S A 90:

161 22. Kieff, E., and A. B. Rickinson Epstein-Barr virus and its replication, p In D. M. Knipe (ed.), Field's virology, 4th ed, vol. 2. Lippincott Williams & Wilkins, Philadelphia. 23. Kravtsova-Ivantsiv, Y., S. Cohen, and A. Ciechanover Modification by single ubiquitin moieties rather than polyubiquitination is sufficient for proteasomal processing of the p105 NF-kappaB precursor. Mol Cell 33: Kulwichit, W., R. H. Edwards, E. M. Davenport, J. F. Baskar, V. Godfrey, and N. Raab-Traub Expression of the Epstein-Barr virus latent membrane protein 1 induces B cell lymphoma in transgenic mice. Proc Natl Acad Sci U S A 95: Kung, C. P., and N. Raab-Traub Epstein-Barr virus latent membrane protein 1 induces expression of the epidermal growth factor receptor through effects on Bcl-3 and STAT3. J Virol 82: Laherty, C. D., H. M. Hu, A. W. Opipari, F. Wang, and V. M. Dixit The Epstein-Barr virus LMP1 gene product induces A20 zinc finger protein expression by activating nuclear factor kappa B. J Biol Chem 267: Li, Z. W., W. Chu, Y. Hu, M. Delhase, T. Deerinck, M. Ellisman, R. Johnson, and M. Karin The IKKbeta subunit of IkappaB kinase (IKK) is essential for nuclear factor kappab activation and prevention of apoptosis. J Exp Med 189: Lin, L., G. N. DeMartino, and W. C. Greene Cotranslational biogenesis of NF-kappaB p50 by the 26S proteasome. Cell 92: Lin, L., G. N. DeMartino, and W. C. Greene Cotranslational dimerization of the Rel homology domain of NF-kappaB1 generates p50-p105 heterodimers and is required for effective p50 production. Embo J 19: Luftig, M., E. Prinarakis, T. Yasui, T. Tsichritzis, E. Cahir-McFarland, J. Inoue, H. Nakano, T. W. Mak, W. C. Yeh, X. Li, S. Akira, N. Suzuki, S. Suzuki, G. Mosialos, and E. Kieff Epstein-Barr virus latent membrane protein 1 activation of NF-kappaB through IRAK1 and TRAF6. Proc Natl Acad Sci U S A 100: Luftig, M., T. Yasui, V. Soni, M. S. Kang, N. Jacobson, E. Cahir-McFarland, B. Seed, and E. Kieff Epstein-Barr virus latent infection membrane protein 1 TRAF-binding site induces NIK/IKK alpha-dependent noncanonical NF-kappaB activation. Proc Natl Acad Sci U S A 101: Luftig, M. A., E. Cahir-McFarland, G. Mosialos, and E. Kieff Effects of the NIK aly mutation on NF-kappaB activation by the Epstein-Barr virus latent 143

162 infection membrane protein, lymphotoxin beta receptor, and CD40. J Biol Chem 276: Mainou, B. A., D. N. Everly, Jr., and N. Raab-Traub Epstein-Barr virus latent membrane protein 1 CTAR1 mediates rodent and human fibroblast transformation through activation of PI3K. Oncogene 24: Mainou, B. A., D. N. Everly, Jr., and N. Raab-Traub Unique signaling properties of CTAR1 in LMP1-mediated transformation. J Virol 81: Mathas, S., K. Johrens, S. Joos, A. Lietz, F. Hummel, M. Janz, F. Jundt, I. Anagnostopoulos, K. Bommert, P. Lichter, H. Stein, C. Scheidereit, and B. Dorken Elevated NF-kappaB p50 complex formation and Bcl-3 expression in classical Hodgkin, anaplastic large-cell, and other peripheral T-cell lymphomas. Blood 106: Mayo, M. W., and A. S. Baldwin The transcription factor NF-kappaB: control of oncogenesis and cancer therapy resistance. Biochim Biophys Acta 1470:M Miller, W. E., J. L. Cheshire, and N. Raab-Traub Interaction of tumor necrosis factor receptor-associated factor signaling proteins with the latent membrane protein 1 PXQXT motif is essential for induction of epidermal growth factor receptor expression. Mol Cell Biol 18: Miller, W. E., H. S. Earp, and N. Raab-Traub The Epstein-Barr virus latent membrane protein 1 induces expression of the epidermal growth factor receptor. J Virol 69: Miller, W. E., G. Mosialos, E. Kieff, and N. Raab-Traub Epstein-Barr virus LMP1 induction of the epidermal growth factor receptor is mediated through a TRAF signaling pathway distinct from NF-kappaB activation. J Virol 71: Moorthy, A. K., O. V. Savinova, J. Q. Ho, V. Y. Wang, D. Vu, and G. Ghosh The 20S proteasome processes NF-kappaB1 p105 into p50 in a translationindependent manner. Embo J 25: Nadiminty, N., J. Y. Chun, Y. Hu, S. Dutt, X. Lin, and A. C. Gao LIGHT, a member of the TNF superfamily, activates Stat3 mediated by NIK pathway. Biochem Biophys Res Commun 359: Nakamura, H., C. Ishii, M. Suehiro, A. Iguchi, K. Kuroda, K. Shimizu, N. Shimizu, K. Imadome, M. Yajima, and S. Fujiwara The latent membrane protein 1 (LMP1) encoded by Epstein-Barr virus induces expression of the putative oncogene Bcl-3 through activation of the nuclear factor-kappab. Virus Res 131:

163 43. Oh, S. M., S. H. Lee, B. J. Lee, C. W. Pyo, N. K. Yoo, S. Y. Lee, J. Kim, and S. Y. Choi A distinct role of neutrophil lactoferrin in RelA/p65 phosphorylation on Ser536 by recruiting TNF receptor-associated factors to IkappaB kinase signaling complex. J Immunol 179: Paine, E., R. I. Scheinman, A. S. Baldwin, Jr., and N. Raab-Traub Expression of LMP1 in epithelial cells leads to the activation of a select subset of NFkappa B/Rel family proteins. J Virol 69: Raab-Traub, N Epstein-Barr virus in the pathogenesis of NPC. Semin Cancer Biol 12: Rayet, B., and C. Gelinas Aberrant rel/nfkb genes and activity in human cancer. Oncogene 18: Rowe, M., M. Peng-Pilon, D. S. Huen, R. Hardy, D. Croom-Carter, E. Lundgren, and A. B. Rickinson Upregulation of bcl-2 by the Epstein-Barr virus latent membrane protein LMP1: a B-cell-specific response that is delayed relative to NFkappa B activation and to induction of cell surface markers. J Virol 68: Saito, N., G. Courtois, A. Chiba, N. Yamamoto, T. Nitta, N. Hironaka, M. Rowe, N. Yamamoto, and S. Yamaoka Two carboxyl-terminal activation regions of Epstein-Barr virus latent membrane protein 1 activate NF-kappaB through distinct signaling pathways in fibroblast cell lines. J Biol Chem 278: Schmidt-Supprian, M., W. Bloch, G. Courtois, K. Addicks, A. Israel, K. Rajewsky, and M. Pasparakis NEMO/IKK gamma-deficient mice model incontinentia pigmenti. Mol Cell 5: Shair, K. H., C. I. Schnegg, and N. Raab-Traub Epstein-Barr virus latent membrane protein-1 effects on junctional plakoglobin and induction of a cadherin switch. Cancer Res 69: Shannon-Lowe, C. D., B. Neuhierl, G. Baldwin, A. B. Rickinson, and H. J. Delecluse Resting B cells as a transfer vehicle for Epstein-Barr virus infection of epithelial cells. Proc Natl Acad Sci U S A 103: Siegler, G., B. Meyer, C. Dawson, E. Brachtel, J. Lennerz, C. Koch, E. Kremmer, E. Niedobitek, R. Gonnella, B. Z. Pilch, L. S. Young, and G. Niedobitek Expression of tumor necrosis factor receptor-associated factor 1 in nasopharyngeal carcinoma: possible upregulation by Epstein-Barr virus latent membrane protein 1. Int J Cancer 112: Soni, V., E. Cahir-McFarland, and E. Kieff LMP1 TRAFficking activates growth and survival pathways. Adv Exp Med Biol 597:

164 54. Thornburg, N. J., R. Pathmanathan, and N. Raab-Traub Activation of nuclear factor-kappab p50 homodimer/bcl-3 complexes in nasopharyngeal carcinoma. Cancer Res 63: Thornburg, N. J., and N. Raab-Traub Induction of epidermal growth factor receptor expression by Epstein-Barr virus latent membrane protein 1 C-terminalactivating region 1 is mediated by NF-kappaB p50 homodimer/bcl-3 complexes. J Virol 81: Vallabhapurapu, S., A. Matsuzawa, W. Zhang, P. H. Tseng, J. J. Keats, H. Wang, D. A. Vignali, P. L. Bergsagel, and M. Karin Nonredundant and complementary functions of TRAF2 and TRAF3 in a ubiquitination cascade that activates NIK-dependent alternative NF-kappaB signaling. Nat Immunol 9: Wang, D., D. Liebowitz, and E. Kieff An EBV membrane protein expressed in immortalized lymphocytes transforms established rodent cells. Cell 43: Wilson, J. B., W. Weinberg, R. Johnson, S. Yuspa, and A. J. Levine Expression of the BNLF-1 oncogene of Epstein-Barr virus in the skin of transgenic mice induces hyperplasia and aberrant expression of keratin 6. Cell 61: Wu, L., H. Nakano, and Z. Wu The C-terminal activating region 2 of the Epstein-Barr virus-encoded latent membrane protein 1 activates NF-kappaB through TRAF6 and TAK1. J Biol Chem 281: Yamamoto, Y., U. N. Verma, S. Prajapati, Y. T. Kwak, and R. B. Gaynor Histone H3 phosphorylation by IKK-alpha is critical for cytokine-induced gene expression. Nature 423: Zhang, Q., J. A. Didonato, M. Karin, and T. W. McKeithan BCL3 encodes a nuclear protein which can alter the subcellular location of NF-kappa B proteins. Mol Cell Biol 14:

165 CHAPTER FOUR EBV Latent Membrane Protein 1 (LMP1) Activates STAT3 and ERK through effects on EGFR and PKCδ Che-Pei Kung and Nancy Raab-Traub

166 ABSTRACT Epstein-Barr virus is a ubiquitous herpesvirus that infects more than 90% of the world s adult population and is linked to multiple malignancies, including Burkitt lymphoma, Hodgkin disease, and nasopharyngeal carcinoma (NPC). The EBV oncoprotein LMP1 induces transcription of the epidermal growth factor receptor (EGFR), which is expressed at high levels in NPC. EGFR transcription is induced by LMP1 through a p50 homodimer-bcl3 complex, and Bcl3 is induced by LMP1 activation of STAT3. This study reveals that LMP1, through its carboxy terminal activation domain 1 (CTAR1), activated both STAT3 and EGFR in a serum-independent manner. LMP1-CTAR1 increased transcription of the EGFR ligand, epiregulin, which could potentially activate the EGFR through an autocrine mechanism. Upon treatment with EGF in serum-free medium, the CTAR1-induced EGFR was additionally phosphorylated and STAT3 became phosphorylated on tyrosine, concomitant with upregulation of selected STAT3 target genes, such as Fos and cyclin D1. The kinase responsible for CTAR1-mediated serine phosphorylation of STAT3 was identified to be PKCδ using the PKCδ specific inhibitor, Rottlerin. Interestingly, Rottlerin also inhibited CTAR1-induced ERK activation while the ERK inhibitor, U0126, inhibited activation of ERK but not STAT3. Inhibition of PKCδ blocked CTAR1-mediated transformation of Rat-1 cells, likely through the inhibition of ERK activation. These data suggest that PKCδ functions as a master regulator of STAT3 and ERK activation by LMP1- CTAR1. These data also reveal that LMP1 can modulate the STAT3 pathway through EGFR activation and PKCδ-mediated signaling to alter cellular gene expression. INTRODUCTION 148

167 Infecting more than 90% of the world s population, the Epstein-Barr virus (EBV) is a ubiquitous human gammaherpesvirus. EBV is transmitted through saliva to infect oral epithelium and B-lymphocytes resulting in a life-long infection (21). Persistent, latent EBV infection is present in several lymphoid and epithelial malignancies, including Burkitt lymphoma, Hodgkin disease, and nasopharyngeal carcinoma (NPC). Viral genes of latent infection are expressed in the malignant cells, which contain a homogeneous clonal form of the EBV episome (41). EBV latent membrane protein 1 (LMP1) is considered the major oncogene as it is essential for B-lymphocyte transformation and can also transform rodent fibroblast cells (20, 56). LMP1 functions as a constitutively active tumor necrosis factor receptor (TNFR) due to aggregation through its six transmembrane domains and interactions with tumor necrosis factor-associated factors (TRAFs) (33, 37). Multiple signaling pathways are activated by LMP1, including mitogen-activated protein kinase (MAPK), c-jun N-terminal kinase (JNK), phosphatidylinositol 3-kinase (PI3K)/Akt, and NF-κB (8, 31, 38, 42). LMP1 induces transcription of multiple genes to affect apoptosis, cell cycle progression, cell proliferation, and migration (10, 11, 46). Two major signaling domains in the C-terminal tail of LMP1, carboxyl-terminal activating regions 1 and 2 (CTAR1 and CTAR2), mediate LMP1- associated signaling pathways by recruiting different TRAFs. CTAR1 recruits TRAF1/2/3/5 through a TRAF-binding motif residing from amino acid (aa) (PQQAT), whereas CTAR2 recruits TRAF2 and TRAF6 through adaptors TRADD and BS69 (50). In addition to distinctive TRAF binding, CTAR1 and CTAR2 also have different effects on signaling activation and cellular transformation. CTAR1 specifically induces MAPK, PI3K/Akt/GSK3β signaling, while CTAR2 activates the JNK pathway (7, 31, 32). 149

168 CTAR2 activates strong canonical NF-κB signaling, whereas CTAR1 induces more complex NF-κB signaling including canonical, noncanonical, and atypical pathways (29, 33). Moreover, CTAR1 has been shown to be required for LMP1-mediated transformation of B- lymphocyte and rodent fibroblast, while CTAR2 is dispensable (17, 31). This information suggests that CTAR1 may have more significant effects in the development of malignancy. The unique properties of CTAR1 were first identified in its ability to induce transcription of the EGFR and subsequently TRAF1, EBI3, Id1, and Id3, repression of p27, and activation of Bcl-3 have been identified (6, 10, 25, 33). EGFR is a member of the ErbB receptor tyrosine kinase family, including EGFR (ErbB-1), HER2/c-neu (ErbB-2), HER3 (ErbB-3), and HER4 (ErbB-4). In the absence of ligand, these receptors are in an inactive tethered conformation (57). Upon ligand binding, the receptors undergo dimerization, autophosphorylation, activation, and subsequently degradation/turnover. Multiple signaling pathways are activated by the EGFR, including Ras/MAPK, Src kinases, JAKs/STATs, and PI3K-AKT (19). EGFR signaling is targeted by proteins of several oncogenic viruses to mediate transformation, including v-erbb, E5, HBVx, and LMP1 (35). NPC has elevated EGFR expression which correlated with the levels of LMP1 and treatment with EGFR tyrosine kinase inhibitors induces cell cycle arrest and inhibits cell proliferation of NPC cell lines (58, 59). These findings suggest that the effect of LMP1 on EGFR is an important factor in EBV carcinogenesis and is a prime target for development of therapeutic strategies. Signal transducers and activators of transcription (STATs) consist of a family of cytoplasmic proteins that, upon stimulation of cytokines or growth factors, translocate into the nucleus and transactivate cellular target genes that are involved with cell proliferation, 150

169 cell cycle regulation, apoptosis, angiogenesis, and differentiation (22). The transcriptional activity of STAT3 is regulated by phosphorylation. Phosphorylation of tyrosine 705 and serine 727 affect dimerization/translocation and the DNA-bindng/transcriptional activity of STAT3, respectively (1). In NPC and B-cell lymphomas that develop in LMP1-transgenic mice, STAT3 is activated (2, 45). A positive autoregulatory loop, in which LMP1-activated STAT3 regulates LMP1 expression through effects on the novel LMP1 promoter residing in the terminal repeats has been described (4). LMP1-mediated STAT3 activation is also responsible for several LMP1-induced cellular genes, including MUC1 and Bcl-3 (23, 25). LMP1-mediated tyrosine phosphorylation of STAT3 has been linked to JAK1 or JAK3, although whether LMP1 interacts directly with JAKs is controversial (13, 15). The mechanism through which LMP1 induces serine phosphorylation of STAT3 is unknown. This study clarifies the mechanisms through which EGFR and STAT3 are activated by EBV LMP1-CTAR1. CTAR1 was found to induce activation of EGFR, STAT3, and Bcl- 3 expression in a serum-independent manner. EGF treatment increased phosphorylation of EGFR, tyrosine phosphorylation of STAT3, and upregulation of STAT3 targets. Transcription of the EGFR ligand, epiregulin, was induced in CTAR1-expressing cells, suggesting that this may promote the continuous activation of the EGFR by LMP1. The data also indicate that the CTAR1-induced serine phosphorylation of STAT3 is dependent on PKCδ, whose inhibition also impaired LMP1-induced ERK activation and CTAR1-mediated transformation of Rat-1 cells. These data reveal that multiple LMP1-mediated signaling pathways, including effects on EGFR, STAT3, and PKCδ contribute to the transforming properties of LMP1. 151

170 MATERIALS AND METHODS Cell Culture, plasmids, and reagents Cervical carcinoma cell line C33A and 293T cells were cultured in Dulbecco s modified Eagle s medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (Sigma) and antibiotic/antimycotic (Gibco) at 37 C with 5% CO 2. Constructs expressing HA-tagged (pbabe) LMP1-CTAR1 (which contains aa of LMP1) and LMP1(1-220) were generated as described previously (10, 32). Small chemical inhibitors, including Rottlerin, Gö6976, U0126, LY294002, and AG1478 were purchased from Calbiochem. To test the effects of inhibitors on CTAR1-mediated pathways, growth medium was replaced with serum-free DMEM supplemented with antibiotic/antimycotic for 24 hours. Inhibitors were added for 5 hr before preparing lysates. Dimethyl sulfoxide (DMSO; Sigma) was added at 1:1000 as the vehicle control. To test the activity of EGFR, serum-starved cells were added with 500ng/ml EGF (Austral Biologicals) and 100μM AG1478 for 10 or 30 min before harvesting cell lysates. Retrovirus production and transduction Recombinant retrovirus production and retroviral transduction were performed as previously described (32). Subconfluent 293T cells in 100mm plates were transfected by FuGENE 6 transfection reagent (Roche) with 5µg pbabe (vector), pbabe-ha-1-231, or pbabe-ha-1-220, and 5µg pvsv-g and 5µg pgag/pol expressing plasmids. After incubating at 37 C for 24 hr, the medium was replaced with fresh medium (DMEM supplemented with 10% FBS and antibiotic/antimycotic) and cells were incubated at 33 C for 24 hr. The cell supernatant was clarified and the virus-containing supernatant was collected. Stable cell lines were produced by transduction with clarified virus supernatant 152

171 with 4µg/ml polybrene for 24 hr at 37 C, followed by selection with 1μg/ml of puromycin (Sigma). Cell lysates harvesting and western blot analysis Cells were harvested at 90% confluence, washed with cold phosphate-buffered saline (PBS, Gibco), scrape harvested in cold PBS, centrifuged at 1000 g for 5 min, and lysed with radioimmunoprecipitation assay (RIPA) buffer (20mM Tris-HCl [ph 7.5], 150mM NaCl, 1mM EDTA, 1% NP-40, 0.1% sodium dodecyl sulfate [SDS], 0.1% deoxycholic acid) supplemented with 0.5mM phenylmethylsulfonyl fluoride (PMSF), 1mM sodium orthovanadate (Na 3 VO 4 ), protease and phosphatase inhibitor cocktail (Sigma). Cell lysates were clarified and the protein concentration was determined using Bio-Rad DC protein assay system. Equal amounts of protein were used for SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to Optitran (Schleicher and Schuell) for Western blot analysis. Membranes were blocked for 1 hr in room temperature in Tris-buffered saline containing 0.1% Tween-20 and 5% nonfat dried milk. Primary antibodies include anti-gapdh, anti- ERK, anti-phospho-erk (Tyr 473) (Santa Cruz), anti-phospho-akt (Ser 473), anti-phospho- STAT3 (Ser 727 and Tyr 705), anti-pkcδ (Cell Signaling), anti-phospho-egfr (Tyr 1068) (BD Biosciences), anti-bcl3 (Millipore), and anti-ha tag (Covance). A rabbit antiserum generated against the carboxyl-terminal 100 amino acids of the EGFR fused to glutathione S- transferase was kindly provided by H. Shelton Earp (University of North Carolina at Chapel Hill) and used to detect expression of total EGFR. Secondary antibodies used to detect Absbound proteins include HRP (horseradish peroxidase)-conjugated anti-mouse, anti-rabbit (Amersham Pharmacia), and anti-goat (DAKO). After incubation with secondary antibodies, 153

172 blots were developed using Pierce Supersignal West Pico chemiluminescence system according to the manufacturer s instructions, followed by exposure to films (ISCBioexpress). Quantitative Real Time Polymerase Chain Reaction (QRT-PCR) Total RNA of cells was isolated using RNAeasy kit (Qiagen). Quantitative real time- PCR (QRT-PCR) was performed using Quantifast SYBR Green RT-PCR kit (Qiagen). PCR products were detected using ABI 7900HT sequence detection system (Applied Biosystems) and analyzed using SDS 2.0 software (Applied Biosystems). The cycle threshold (C T ) was determined as the number of PCR cycles required for reactions to reach an arbitrary fluorescence value within the linear amplification range. The change in C T ( C T ) was determined between the same target gene primer sets and different samples, and the change in C T ( C T ) was determined by adjusting for the difference in the number of cycles required for GAPDH to reach the C T. The fold change was determined as 2 CT since each PCR cycle results in a two-fold amplification of PCR products. Primers used in this study are listed in Table S1. Focus formation assay Focus formation assays were performed as described previously (31). Subconfluent Rat-1 fibroblast cells plated in 6-well plates were transduced with recombinant retrovirus for 24 hr. Fresh medium (DMEM supplemented with 10% fetal bovine serum and antibiotic/antimycotic) were then changed every other day for 10 days. The effect on focus formation by inhibition of PKCδ using Rottlerin was determined using 1μM Rottlerin or vehicle control DMSO added daily with freshly-changed medium. After foci can be clearly identified, cells were stained with 1% crystal violet (dissolved in 50% methanol) and images were taken under a stereomicroscope. 154

173 Data Analysis The quantitative data were presented as the average value of at least triplicate of each experiment ± SE. Statistical significance was evaluated using a computerized, paired 2-tailed Student t test. Differences were considered significant at P < Target genes Forward Primer sequence (from 5 to 3 ) Reverse GAPDH TGCACCACCAACTGCTTAGC GAGGGGCCATCCACAGTCTT EGFR CTGCGTCTCTTGCCGGAATG TTGGCTCACCCTCCAGAAGG TGFα GCCAGCATGTGTCTGCCATT CACCACCAAGGCGGTGA HB-EGF TGGAGAATGCAAATATGTGAAGGA AGGATGGTTGTGTGGTCATAGGTAT Epiregulin TTCCATCATGTATCCCAGGAG ATTGACACTTGAGCCACACG SOCS3 CCTCAAGACCTTCAGCTCCA TCACTGCGCTCCAGTAGAAG Bcl-xL CTTGGATGGCCACTTACCTG TGCTGCATTGTTCCCATAGA Fos AAGGAGAATCCGAAGGGAAA AGTTGGTCTGTCTCCGCTTG CEBPD ATCGACTTCAGCGCCTACAT GCCTTGTGATTGCTGTTGAA Cyclin D1 GATCAAGTGTGACCCGGACT TCCTCCTCTTCCTCCTCCTC Table 1. Quantitative RT-PCR primers 155

174 RESULTS LMP1 induces intrinsic activation of STAT3 and EGFR, as well as EGFRdependent STAT3 phosphorylation. We have shown previously that LMP1, through CTAR1, induces EGFR expression through activation of NF-kB p50 and transcriptional upregulation of Bcl-3 by activated STAT3 (25, 34, 53). To investigate the effects of LMP1 on activation of EGFR and STAT3, C33A cells stably transduced with CTAR1 were cultured in 10% serum or serum-starved for 24 hr and whole cell lysates were analyzed by immunoblotting (Figure 1). In serum-supplemented medium CTAR1 induced expression and activation of EGFR as assessed by EGFR phosphorylation at Tyr1068 (lane 2). CTAR1 also induced expression of Bcl-3 and both tyrosine and serine phosphorylation of the transcriptional activator STAT3 but did not affect the total level of STAT3. Interestingly, EGFR and STAT3 were still phosphorylated and activated in the absence of serum, and expression of Bcl-3 was induced to similar levels as cells grown in 10% FBS (lane 3). These data indicate that CTAR1-mediated EGFR and STAT3 activations are independent of the presence of growth factors in the medium. It has been suggested that EGFR interacts with STAT3 and can function as tyrosine kinase to activate STAT3 (40). To determine whether CTAR1-induced EGFR can be further stimulated to activate STAT3, serum-starved CTAR1-expressing C33A cells were treated with 500ng/ml of EGF with or without EGFR kinase inhibitor, AG1478, and analyzed by Western blotting. Treatment with EGF for 10 minutes greatly increased the tyrosine phosphorylation of STAT3 (lane 4) but did not affect the serine phosphorylation of STAT3 or expression of Bcl-3. The EGF-induced tyrosine phosphorylation of STAT3 was inhibited by the EGFR kinase inhibitor AG1478, indicating that EGF-induced STAT3 tyrosine 156

175 phosphorylation is EGFR-dependent (lane 5). A similar result was observed with a 30 min EGF treatment with slightly lower tyrosine phosphorylation level of STAT3 compared to 10 min EGF treatment, suggesting that EGF-mediated EGFR activation decreases after 30 minutes (lane 6 and 7). Interestingly, the antibody against activated EGFR detected a subtly shifted band in both 10 min and 30 min EGF-treated samples (lane 4 and 6, pointed by arrows) that was not detected with simultaneous AG1478 treatment (lane 5 and 7). Although CTAR1 activated EGFR in the absence of serum, EGF treatment stimulated additional phosphorylation of EGFR to initiate signaling pathways downstream of EGFR, including the tyrosine phosphorylation of STAT3. Overall, the data indicate that LMP1-CTAR1 can induce activation of EGFR, STAT3, and Bcl-3 expression independently of external growth factors. Additionally, EGF treatment further stimulates the CTAR1-induced EGFR to induce tyrosine phosphorylation of STAT3. CTAR1 induces expression of EGFR ligand epiregulin. To determine if CTAR1- mediated serum-independent activation of EGFR reflects effects on EGFR ligands, real-time quantitative RT-PCR was performed to assess expression of TGFα, heparin-bound EGF (HB- EGF), and epiregulin in serum-starved vector control and CTAR1-expressing C33A cells (Figure 2). EGFR expression was analyzed as a positive control and expression levels were normalized to GAPDH. The messenger RNA levels for TGFα and HB-EGF were not affected in CTAR1-expressing cells compared to vector control cells, while the mrna expression of epiregulin was induced by 2.4-fold in CTAR1-expressing cells in the absence of serum compared to vector control cells. This result suggests that epiregulin transcription is induced by LMP1-CTAR1, and this may contribute to CTAR1-mediated EGFR activation. 157

176 CTAR1 10% FBS EGF AG1478 C33A P-EGFR EGFR Tyr-P-STAT3 Ser-P-STAT3 STAT3 Bcl-3 GAPDH HA(CTAR1) Figure 1. LMP1-CTAR1 activates EGFR and STAT3 independent of serum, and CTAR1-induced EGFR further activates STAT3 in response to EGF treatment. C33A cells stably transduced with pbabe or CTAR1 were maintained in DMEM with 10% FBS. CTAR1 cells were then serum-starved for 24 hours and treated with DMSO (lane 3), EGF for 10min (lane 4), EGF/AG1478 for 10min (lane 5), EGF for 30min (lane 6), and EGF/AG1478 for 30min (lane 7). Whole cell protein lysates were prepared for western blot analysis. Activation of EGFR was detected by using antibody against Tyr1068 phosphorylation of EGFR. The solid arrow points at CTAR1-activated EGFR. And the dashed arrow points at the shifted EGFR after EGF treatment. GAPDH was detected as a loading control and HAspecific antibody was used to detect expression of CTAR1. EGF treatment induces expression of STAT3 target genes in CTAR1 cells. To determine if the STAT3 phosphorylation induced by EGF treatment increased expression of known STAT3 target genes, the RNA of EGF-treated CTAR1 cells was isolated and analyzed for expression of several known STAT3 targets, including SOCS3, Bcl-xL, Fos, 158

177 7 QRT-PCR of EGFR ligands 6 pbabe Fold(normalized to GAPDH) CTAR1 p < EGFR TGFalpha HBEGF EREG Figure 2. mrna expression of EGFR ligands in CTAR1 cells. Total RNA of pbabe control and CTAR1-expressing cells were extracted and subject to real-time quantitative RT- PCR using primers for EGFR ligands. Results from RT-PCR were normalized to GAPDH and levels of EGFR ligands in pbabe control cells were set to 1-fold. RT-PCR of each ligand was performed four times, with each one done in triplicate. CEBPD, and Cyclin D1, using real-time quantitative RT-PCR (Figure 3) (48). In the absence of serum CTAR1 induced EGFR expression 5.4-fold and treatment with EGF for 10 min further increased EGFR mrna expression to 7-fold. However, after 30-min treatment of EGF this decreased to 6-fold. The RNA levels of SOCS3 and Bcl-xL were not significantly changed after 10 or 30 min treatment of EGF. Expression of cebpd went up by 2.2-fold with 10 min EGF treatment but decreased down to 1.4-fold after 30 min treatment with EGF. The expression of cyclin D1 increased by 2.7-fold after 10 min EGF treatment and stayed at 3-fold after 30 min treatment of EGF. The mrna of fos changed most dramatically with a 2-fold induction after 10 min EGF treatment and an increase of approximately 15.8-fold following 30 min treatment of EGF. Statistical analysis revealed 159

178 that the changes of Cyclin D1 and Fos were significant with p<0.05. These data indicate that CTAR1-induced EGFR in response to EGF activates STAT3 to increase expression of specific targets of STAT3. PKCδ is responsible for CTAR1-induced serine phosphorylation of STAT3. To identify the potential serine kinase responsible for CTAR1-mediated serine phosphorylation of STAT3, CTAR1-expressing C33A cells were treated with either DMSO or inhibitors of previously identified serine kinases of STAT3, including Rottlerin (PKCδ inhibitor), Gö6976 Fold(normalized to GAPDH) QRT-PCR of STAT3 targets p < 0.05 pbabe CTAR1 CTAR1-EGF 10' CTAR1-EGF 30' p < 0.05 p < EGFR SOCS3 Bcl-xl Fos Cebpd Cyclin D1 Figure 3. Expression level of STAT3 target genes in EGF-treated CTAR1-expressing C33A cells. Total RNA was extracted from serum-starved CTAR1 cells treated with DMSO, EGF for 10min, or EGF for 30min and real-time quantitative RT-PCR was performed with primers against STAT3 target genes. Results from RT-PCR were normalized to GAPDH and expressions of STAT3 targets in pbabe control cells were set to 1-fold. Results are averages of at least three separate experiments, with each one performed in triplicate. 160

179 (PKCα/β inhibitor), U0126 (MEK/ERK inhibitor), and LY (PI3kinase inhibitor) (Figure 4) (5). As previously shown, CTAR1 (lane 2) induced EGFR expression, Bcl-3 expression, and tyrosine / serine phosphorylation of STAT3 compared to parental C33A cells (lane 1). Elevated levels of AKT and ERK phosphorylation were also detected in CTAR1- expressing C33A cells. The PKCδ inhibitor, Rottlerin, inhibited CTAR1-induced serine phosphorylation but not tyrosine phosphorylation of STAT3 at 5μM and more significantly at 40μM (lane 3 and 4). At 40μM, Rottlerin also reduced CTAR1-induced Bcl-3 protein expression. Treatment with Rottlerin slightly decreased the effects of CTAR1 on EGFR. In contrast, inhibition of MEK/ERK with U0126 or PI3kinase with LY effectively decreased CTAR1-induced ERK phosphorylation and AKT phosphorylation, respectively, but did not block CTAR1-induced serine phosphorylation of STAT3 (lane 6 and 7). Treatment of CTAR1-expressing C33A cells with PKCα/β inhibitor, Gö6976, did not decrease serine phosphorylation of STAT3, indicating that CTAR1-induced serine phosphorylation of STAT3 was PKCδ-specific and independent of PKCα/β (lane 5). These results indicate that PKCδ, but not PI3K, ERK, or PKCα/β, is responsible for LMP1-CTAR1- induced serine phosphorylation of STAT3. Importantly, inhibition of PKCδ activity also blocked phosphorylation of ERK (lane 3 and 4) but did not affect activation of PI3kinase/Akt. This suggests that in addition to serine phosphorylation of STAT3, PKCδ is also responsible for the CTAR1-induced and endogenous ERK phosphorylation in C33A cells. PKCδ is important for CTAR1-mediated transformation of Rat-1 cells. To test the requirement for PKCδ in LMP1-mediated transformation, the effect of its inhibition was assessed using a focus formation assay in Rat-1 fibroblast cells (Figure 5A). Subconfluent 161

180 CTAR1 DMSO Rottlerin Gö6976 U0126 LY C33A uM 40uM 5nM 10uM 25uM EGFR Ser-P-STAT3 Tyr-P-STAT3 Bcl-3 GAPDH P-AKT(S473) P-ERK Figure 4. LMP1-induced serine phosphorylation of STAT3 is PKCδ-dependent. C33A cells stably transduced with pbabe or CTAR1 were maintained in DMEM with 10% FBS. The medium were replaced with serum-free medium for 24 hours and both cells were treated with DMSO for 5 hours (lane 1 and 2). CTAR1 cells were also treated with the PKCδ inhibitor (Rottlerin, lane 3 and 4), PKCα/β inhibitor (Gö6976, lane 5), MEK/ERK inhibitor (U0126, lane 6), and PI3K inhibitor (LY294002, lane 7) for 5 hours. Whole cell protein lysates were prepared for western blot analysis. GAPDH was detected as a loading control. Rat-1 cells were transduced with LMP1-CTAR1 (1-220)-containing retrovirus at three different dilutions (10-1, 10-2, and 10-3 ). CTAR1 induced many foci at the 10-1 dilution which 162

181 was decreased with the 10-2 and 10-3 retrovirus dilutions. Treatment with 1μM Rottlerin blocked focus formation at all three dilutions. Western blot analysis indicated that ERK phosphorylation was significantly decreased by Rottlerin treatment in Rat-1 cells transduced with 10-1 or 10-2 dilutions of retrovirus that also had the most significant reduction of focus formation (Figure 5B). Immunoblotting with total-erk antibody indicated that the total A) DMSO Rottlerin 1μM B) DMSO Rottlerin Retrovirus dilution P-ERK Total ERK GAPDH Figure 5. PKCδ inhibitor, Rottlerin, inhibited CTAR1-induced focus formation. A) Rat-1 cells were transduced with pbabe and CTAR1(1-220) at three different dilutions, maintained for 10 days, stained with crystal violet, and observed for focus formation. B) Whole cell protein lysates were prepared from a duplicate focus formation experiment of A). Western blot analysis was performed using antibodies against total ERK and phosphorylated ERK. GAPDH was detected as a loading control. 163