Biologic and Molecular Properties of LMP1: CTARs, Strains, and Beyond. by Bernardo A. Mainou

Transcription

1 Biologic and Molecular Properties of LMP1: CTARs, Strains, and Beyond by Bernardo A. Mainou A dissertation submitted to the faculty of the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Microbiology and Immunology. Chapel Hill 2007 Approved by: Advisor: Nancy Raab-Traub, Ph.D. Reader: Adrienne Cox, Ph. D. Reader: Blossom Damania, Ph.D. Reader: Dirk Dittmer, Ph.D. Reader: Lishan Su, Ph.D.

2 ABSTRACT Bernardo A. Mainou: Biological and Molecular Properties of LMP1: CTARs, Strains, and Beyond (Under the direction of Nancy Raab-Traub) Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus that is associated with the development of lymphoid and epithelial malignancies including Hodgkin lymphoma (HD), post-transplant lymphoproliferative disorder (PTLD), nasopharyngeal carcinoma (NPC), and others. Latent membrane protein 1 (LMP1) is the EBV oncogene as it is necessary for EBV-mediated transformation of B-lymphocytes and can itself transform rodent fibroblasts. LMP1 has a short amino-terminal cytoplasmic end, 6 transmembrane domains, and a long carboxyl-terminal cytoplasmic tail that contains the two signaling domains, the carboxyl-terminal activation regions 1 and 2 (CTAR1 and CTAR2). Through CTAR1 and CTAR2, LMP1 activates several signaling pathways including NFκB, phosphatidylinositol 3-kinase (PI3K), mitogen-activated protein kinase (MAPK), and c-jun N-terminal kinase (JNK) pathways. In this study, CTAR1 was shown to be necessary for Rat-1 fibroblast transformation and activation of the PI3K-Akt pathway, whereas CTAR2 was dispensable. LMP1-mediated rodent fibroblast transformation did not require IκBαdependent activation of NFκB. Seven sequence variants of LMP1 have been identified: Alaskan, B95.8, China 1, China 2, Med+, Med-, and NC. The frequency of detection of these variants differs in various EBV-associated malignancies from different geographic regions. In this study, all the sequence variants were demonstrated to transform Rat-1 fibroblasts, induce increased motility of human foreskin keratinocytes, induce homotypic ii

3 adhesion of BJAB cells and activate the PI3K-Akt signaling pathway. The Alaskan, China 1 and Med+ variants had limited binding to the E3 ubiquitin ligase component HOS and enhanced NFκB signaling. These findings indicate that the signature amino acid changes of the LMP1 variants do not hinder or significantly enhance their in vitro transforming potential or signaling properties. Finally, dominant negative forms of TRAF2 and TRAF3 inhibited LMP1-mediated transformation of rodent fibroblasts. Activation of PI3K-Akt signaling and deregulation of cell-cycle markers were mapped to the TRAF-binding site and residues between CTAR1 and CTAR2. Activation of the MEK1/2-ERK1/2 signaling pathway through the TRAF-binding site was required for LMP1-induced transformation of rodent fibroblasts. These findings identify a signaling pathway that is uniquely activated by CTAR1. iii

4 To my parents and to Natalie. iv

5 ACKNOWLEDGEMENTS I would like to thank my mentor Dr. Nancy Raab-Traub for providing guidance and optimism on a daily basis. I have learned a lot from her and I look forward to applying what I have learned. I would also like to thank my committee members, Dr. Adrienne Cox, Dr. Blossom Damania, Dr. Dirk Dittmer, and Dr. Lishan Su for their time and for pointing me in the right direction. To the current and past members of the Raab-Traub lab for making lab a great place to work. Dr. David Everly and Betsy Edwards for the countless discussions about science, sport, family, the South, life and the millions of laughs that we shared. Our morning talks will be forever missed. David for helping me get started in lab and Betsy for being the glue that keeps the lab together. Dr. Aron Marquitz for being there to discuss experiments and pointing out ways to improve my talks and manuscripts. To Pat Kung, Dr. Kathy Shair, Cathy Siler, and Kat Bendt for providing a good atmosphere to do science. Two previous members of the lab were great influences, Dr. Jenny Morrison and Dr. Diane Sitki-Green. I would also like to thank Dr. Bertram Jacobs. Jake introduced me to virology in his lab at the Arizona State University. Dixie Flannery for addressing every need a graduate student at UNC could have and making the transition to UNC incredibly smooth. v

6 I would like to thank my mom and dad for helping me in pursuing my dreams. Without you I would not be here. To my siblings for providing a fun home to grow up in and for being there when I needed your help. To Emmitt, Stella, and Phoebe. Your wagging tails and incessant meows are a welcoming sight on a daily basis. To my wife and soul mate Natalie, for being there for me at all times. You have been my partner throughout this endeavor. Without you graduate school would not have been as sweet a place. I love coming home to you every day. vi

7 TABLE OF CONTENTS LIST OF TABLES...x LIST OF FIGURES...xi LIST OF ABBREVIATIONS...xiii CHAPTER ONE: Introduction The Epstein-Barr virus...2 Genome Structure...2 EBV Life Cycle...3 Primary Infection...5 Viral Immune Evasion...7 Lytic Replication...8 Establishment of Latency...10 EBNA EBNA2 and EBNALP...11 EBNA3A, EBNA3B, and EBNA3C...12 LMP LMP EBERS...17 BARTs...17 Genetics with EBV...18 EBV-Associated Malignancies vii

8 Infectious Mononucleosis...19 Chronic Active EBV...19 X-Linked Lymphoproliferative Syndrome (XLP)...20 Virus Associated Hemophagocytic Syndrome (VAHS)...20 Hodgkin Lymphoma...20 Nasopharyngeal Carcinoma...21 Gastric Carcinoma...23 Post-Transplant Lymphoproliferative Disorders (PTLD)...23 HIV Associated Lymphomas...24 Congenital Immunodeficiencies...25 Oral Hairy Leukoplakia (HLP)...25 Burkitt s Lymphoma (BL)...26 Therapeutic Approaches...27 OBJECTIVES...29 REFERENCES...31 CHAPTER TWO: Epstein-Barr Virus Latent Membrane Protein CTAR1 Mediates Rodent and Human Fibroblast Transformation through Activation of PI3K ABSTRACT...65 INTRODUCTION...65 RESULTS...67 DISCUSSION...77 MATERIALS AND METHODS...80 ACKNOWLEDGMENTS...84 viii

9 REFERENCES...85 CHAPTER THREE: LMP1 Strain Variants: Biological and Molecular Properties ABSTRACT...92 INTRODUCTION...92 MATERIALS AND METHODS...95 RESULTS DISCUSSION ACKNOWLEDGMENTS REFERENCES CHAPTER FOUR: Unique Signaling Properties of CTAR1 in LMP1-Mediated Transformation ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION ACKNOWLEDGMENTS REFERENCES CHAPTER FIVE: Conclusions REFERENCES ix

10 LIST OF TABLES Table 1 Types of EBV latent gene expression and their associated malignancies...10 x

11 LIST OF FIGURES CHAPTER ONE Figure 1: EBV life cycle...5 Figure 2: Signal transduction pathways associated with LMP CHAPTER TWO Figure 1: LMP1 and LMP1 CTAR1 block contact-inhibited growth in Rat-1 cells...68 Figure 2: LMP1 and LMP1 CTAR1 induce phosphorylation of Akt and GSK3β...70 Figure 3: LY but not BAY inhibits LMP1 and LMP1 CTAR1 induced focus formation...71 Figure 4: Anchorage-independent growth is dependent on LMP1 and LMP1 CTAR1 and is inhibited by LY Figure 5: LY inhibits Akt phosphorylation and BAY inhibits NFκB activation...74 Figure 6: LMP1 and LMP1 CTAR1 induce focus formation and phosphorylation of Akt in human embryo lung fibroblasts...76 CHAPTER THREE Figure 1: LMP1 variants block contact inhibited growth of Rat-1 cells Figure 2: Anchorage-independent growth of Rat-1 fibroblasts is induced by LMP1 variants Figure 3: LMP1 variants increase motility of HFK cells Figure 4: Activation of the PI3K-Akt signaling pathway by LMP1 variants Figure 5: LY blocks LMP1-induced focus formation Figure 6: LMP1 variants regulate cell cycle progression protein markers Figure 7: Homotypic adhesion of BJAB cells is induced by LMP1 variants Figure 8. Differential binding of HOS by LMP1 variants xi

12 Figure 9. All LMP1 variants activate NFκB CHAPTER FOUR Figure 1: TRAF-binding domain is necessary for LMP1-mediated block of contact-inhibited growth Figure 2: LMP1-mediated transformation of Rat-1 fibroblasts is inhibited by dntraf2 and dntraf Figure 3: Graphical representation of LMP1 mutants Figure 4: CTAR1 induces activation of PI3K-Akt signaling and deregulates markers associated with cell-cycle progression Figure 5: Mutation of proline and glutamine residues in CTAR1 impair LMP1- induced transformation Figure 6: Redundancy in LMP1-induced inactivation of GSK3β Figure 7: Redundancy in LMP1-induced deregulation of p27 and plakoglobin levels Figure 8: CTAR1 is necessary for LMP1-induced activation of ERK1/ Figure 9: ERK1/2 activation is necessary for LMP1-mediated block of contactinhibited growth CHAPTER FIVE Figure 1: Signal transduction pathways modulated by LMP xii

13 LIST OF ABBREVIATIONS AIDS BART BCR BL bp CDK cdki cdna CNS Csk Acquired immune deficiency syndrome BamHIA Rightward Transcripts B Cell Receptor Burkitt s Lymphoma Base Pairs Cyclin Dependent Kinase Cyclin Dependent Kinase Inhibitor Complementary DNA Central Nervous System Carboxyl-terminal Src kinase CTAR1 Carboxyl-terminal Activating Region 1 CTAR2 Carboxyl-Terminal Activating Region 2 CTL DN DNA DTT EBER EBNA EBV EGFR ELISA EMSA Cytotoxic T-Lymphocyte Dominant Negative Deoxyribonucleic Acid Dithiothreitol EBV-encoded RNAs Epstein-Barr Virus Nuclear Antigen Epstein-Barr virus Epidermal Growth Factor Receptor Enzyme-Linked Immunoadsorbent Assay Electrophoretic Mobility Shift Assay xiii

14 ER ERK FOXO gp GSK HD HIC HIV HEK HFK HLP HOS HRS htert Id IE IFN Ig IKK IL IM IP ITAM Endoplasmic Reticulum Extracellular Signal Regulated Kinase Forkhead box O-class Glycoprotein Glycogen Synthase Kinase Hodgkin Lymphoma Human I-mfa domain containing protein Human Immune deficiency Virus Human Embryo Kidney Human Foreskin Keratinocyte Oral Hairy Leukoplakia Homologue of Slimb Hodgkin Reed-Sternberg Human Telomerase Reverse Transcriptase Inhibitor of Differentiation Immediate Early Interferon Immunoglobulin IκB kinase Interleukin Infectious Mononucleosis Immunoprecipitation Immunoreceptor tyrosine-based activation motif xiv

15 IκB JNK LCL LEF Inhibitor NF-κB Jun N-terminal Kinase Lymphoblastoid Cell Line Lymphoid Enhancer Factor LMP1 Latent Membrane Protein 1 LMP2 Latent Membrane Protein 2 MDCK MAPK Madin-Darby Canine Kidney Mitogen-Activated Protein Kinase MDM2 Murine Double Minute 2 MEF MEK MHC NF-κB NK NLS NotchIC NPC PAGE PBMC PBS PCR PI3K PKR Mouse Embryo Fibroblast Mitogen-Activated ERK Kinase Major Histocompatibility Complex Nuclear Factor of kappa light chain polypeptide gene enhancer in B-cells Natural Killer Cell Nuclear Localization Sequence Notch Intra-cellular Domain Nasopharyngeal Carcinoma Polyacrylamide Gel Electrophoresis Peripheral Blood Mononuclear Cells Phosphate Buffered Saline Polymerase Chain Reaction Phosphatidylinositol-3 Kinase Double Stranded RNA-activated Protein Kinase xv

16 PTLD RBPJκ RIP RIPA RNA RT-PCR SCC SCID SDS TBS TCF TNF TNFR TRADD TRAF VAHS WHO XLP Post-Transplant Lymphoproliferative Disorder Recombination Signal-Binding Protein-J kappa Receptor Interacting Protein Radioimmunoprecipitation Assay Ribonucleic Acid Reverse Transcriptase PCR Squamous Cell Carcinoma Severe Combined Immunodeficiency Sodium Dodecyl sulfate Tris Buffered Saline T cell factor Tumor Necrosis Factor Tumor Necrosis Factor Receptor Tumor Necrosis Factor Receptor Associated Death Domain Tumor Necrosis Factor Associated Factor Virus-Associated Hemophagocytic Syndrome World Health Organization X-Linked Lymphoproliferative Disorder xvi

17 CHAPTER ONE Introduction

18 Epstein-Barr Virus Starting in the 1940s Denis Burkitt identified a novel extranodal lymphoma occurring in children in equatorial regions of Africa where malaria was also endemic (25-28, 240). Due to the atypical epidemiologic and clinical aspects of the lymphomas Burkitt hypothesized the involvement of an infectious agent (26, 28, 29). Epstein-Barr virus was identified in 1964 by Epstein, Achong, and Barr from electron micrographs of Burkitt s lymphoma cells grown in culture that revealed a herpesvirus-like particle that did not react to antibodies of other known herpesviruses and did not replicate in cells in culture (69). EBV is the prototype member of the gamma herpesvirus subfamily of herpesviruses. All members of this subfamily replicate in lymphoblastoid cells, are usually B or T lymphocyte tropic, and have a limited host range to the family or order of the host (148). The Lymphocryptovirus (LCV), gamma 1, and Rhadinovirus (RDV), gamma 2, genera are found within the gamma herpesvirus subfamily. EBV, a member of the LCV genera, and Kaposi s sarcoma-associated herpesvirus (KSHV), a member of the RDV genera, are the only human members of this subfamily (38). A distinguishing characteristic of EBV is its ability to infect and transform resting B lymphocytes into latently infected lymphoblastoid cell lines (LCLs) in vitro (116, 308). EBV is also capable of infecting epithelial cells in vivo as well as pharyngeal epithelial cells, skin keratinocytes, and gastric carcinoma cells in vitro (148, 169, 210, 266, 306). Genome Structure EBV is an enveloped virus that contains a linear double-stranded DNA genome of 184 kilobase pairs (kbp) in length (13, 51, 95, 229, 234). Interestingly, EBV was the first 2

19 herpesvirus to be completely sequenced and have all of its genome fragments cloned into Escherichia coli (10, 13, 23, 51, 80, 232). EBV and most LCVs have four characteristic features to their genomes: single overall format and gene rearrangement, tandem, reiterated direct repeats of the same sequence at both termini (TR), six to twelve tandem reiterations of internal direct repeats (IR1), and short and long unique sequence domains (U S and U L ) that contain most of the viral coding capacity (40, 41, 51, 96, 148). The fact that RDVs have a broader host range, including several primate species and subprimate mammalian species, as well as increased genomic divergence compared to LCVs, which are restricted to Old World primates and some New World primates, suggests that LCVs evolved after RDVs (3, 74, 148). EBV Life Cycle EBV is transmitted in saliva that contains cell-free virus as well as infected cells that lead to infection of oral epithelial cells (240). An early study suggested that EBV infection of a host began with the fusing of EBV positive B cells to epithelial targets (17). Although this study has not been confirmed or refuted by subsequent studies, infection of epithelial cells is more efficient in close contact with virus-producing B cells than cell-free virus (128, 291). Infection of the oral epithelium can lead to the production of progeny virions through lytic replication in the infected oral epithelial cells (163, 164, 265). The released virions can then infect circulating B lymphocytes in the oral epithelium or in lymphoid organs (11, 196, 208). In vitro, naïve and memory cells are equally susceptible to EBV infection (308). Interestingly, viral attachment and viral entry differs between B lymphocytes and epithelial cells. 3

20 Attachment to B cells requires high affinity binding between the viral envelope glycoprotein gp350/220 and the cellular complement receptor type 2 (CR2), also know as CD21, which results in the endocytosis of the virus (79, 84, 198, 206, 278). Endocytosis of the virus in B-lymphocytes leads to fusion with the endosomal membrane at a low ph (192). In contrast, the role of CR2 in epithelial cells remains elusive and recent data hint at a different mechanism of attachment and entry in epithelial cells. EBV lacking the two viral proteins gh and gl lose the ability to bind to several epithelial cell lines, although the cellular binding partner has yet to be identified (197, 212). More recently the EBV glycoprotein BMRF2 was shown to interact with the integrin α5β1 and antibodies to the inegrins and to BMRF2 partially blocked binding (291). Another difference between B cell entry and epithelial cell entry is that endocytosis is not required for epithelial cell entry and fusion takes place at a neutral ph (240). Interestingly, EBV produced in human leukocyte antigen (HLA) class II negative epithelial cells can infect B cells more readily than virus produced in HLA class II positive B cells and virus produced in B cells can infect epithelial cells more readily than virus produced in epithelial cells (20, 240). Upon viral entry in B lymphocytes the viral genome circularizes to form a viral episome and initiates a limited latency program through transcription from the viral Wp promoter, which requires the cellular RNA polymerase II (251). Latently infected B lymphocytes have restricted expression of viral gene products, thus promoting evasion of immune surveillance (12, 196, 280, 286). Periodically the latently infected B cells undergo reactivation leading to new viral progeny (8, 11). The released virus can infect surrounding B cells, or if reactivation takes place while circulating through the oropharynx, the virus can infect oral epithelial cells and/or be shed through saliva (Figure 1). 4

21 EBV Epithelium Plasma Cell Naïve B cell Memory B cell T cell Memory B cell Compartment Figure 1. EBV Life Cycle. EBV infects the oral epithelium and perhaps circulating B-cells in the oropharynx. Progeny virus then infects naïve or memory B cells in the surrounding lymphoid tissues where the latency program drives the growth and proliferation of the infected B cells. A portion of the proliferating B cells are removed by latent-specific-antigen primary T cell response, with the surviving portion establishing a stable reservoir of infected cells. Periodic reactivation and recruitment of the latently infected B cell to the oropharynx results in infection of the oral epithelium, further viral replication, and shedding of progeny virions into the saliva. Primary Infection Seroconversion surveys, as measured by immunoglobulin G (IgG) antibodies against the viral capsid antigen (VCA), have revealed that most children in developing countries are infected with EBV by age 3 and close to 100% by age 10 (148). These primary infections, which are mostly asymptomatic, likely occur from parent-to-child transmission of saliva (100). In contrast, in developed countries 50% of children remain seronegative by age 10 with most seroconverting during adolescence through intimate oral contact. The delayed primary infection results in about 50% of the infections being symptomatic with a subset 5

22 leading to infectious mononucleosis (IM), of which EBV is the etiologic agent (115, 148, 240). Most studies of EBV primary infection have focused on IM patients but because IM patients do not show symptoms until 4-6 weeks post infection the earliest of events in infection are not well elucidated. By the onset of symptoms, cell-free infectious virus can be isolated from saliva and throat washings but the source of the infectious virus remains controversial. For example, tonsils from IM patients revealed infected B-lymphocytes, but not infected tonsillar epithelial cells (8, 91, 299). Before the onset of symptoms and during acute IM, patients show a generalized infection of their circulating B-lymphocytes, with % of circulating B cells being EBV positive during the peak of acute IM (58, 152, 273). B lymphocytes isolated from IM patients have EBV latency transcripts suggesting that the B lymphocytes that are infected during primary infection are already growth-transformed (148). By the onset of symptoms IM patients have high titers of IgM antibodies to the capsid antigen VCA as well as increasing IgG titers to VCA and early antigen (EA), although neutralizing antibodies against gp350 are relatively low (148, 267). Another characteristic of acute IM is the presence of atypical CD8+ T lymphocytes as a result of a strong cytotoxic T- lymphocyte (CTL) response against EBV (35, 271). The CTL response is directed mainly towards EBV lytic antigens, although this response starts to decrease post-im and is supplanted by a T-lymphocyte response directed against the EBV latent antigens (270). Interestingly, studies have identified a variety of LMP1 sequence variants (59, 60, 195, 263). These sequence variants arise from the onset of primary infection or soon thereafter as patients with IM already show a varied population of LMP1 sequence variants (264). The sequence variants appear to also have compartmentalization differences (e.g. oral cavity and 6

23 peripheral blood or peripheral blood and tumor) suggesting that the sequence variations in LMP1 provide an advantage to the proliferating cell population (262, 263). Viral Immune Evasion Intracellular viral infections are kept in check by the CTL response to infected cells through their recognition of viral antigen being presented by major histocompatibility complex (MHC) class I. The memory T cell response is mainly directed against the EBV nuclear antigens (EBNA) 3A, 3B, and 3C and a lesser response against the latent membrane protein 2 (LMP2). A very weak response has also been detected against an epitope of the BAMHI-A reading frame 0 (BARF0) protein (149). In contrast, responses to EBNA1, EBNA2, EBNA-LP, and latent membrane protein 1 (LMP1) are not common (147, 205). Viral gene expression in memory B cells tends to be limited to EBNA1. A string of glycinealanine repeats that inhibit the proteasome-dependent degradation of EBNA1, a necessary step for proper MHC class I processing, protects EBNA1 from MHC class I presentation (165, 166, 259). It is through this combination of limited viral gene expression and limited presentation of viral antigens through MHC class I that EBV avoids eliciting a strong CTL response. Another strategy of immune evasion by EBV is its ability to suppress HLA class II expression through the viral glycoprotein gp42, which in vitro binds HLA class II in the endoplasmic reticulum and prevents its maturation (20). Also, in B cells one of the three EBV glycoproteins in the ghglgp42 complex binds HLA class II upon gp350-cr2 binding to facilitate viral entry (168). Another method of immune evasion by EBV includes the ability of the secreted viral protein BARF1 to interfere with interferon α (IFNα) (47). The 7

24 EBV early lytic protein BZLF1 blocks the antiviral activities of IFNγ by inhibiting its downstream signaling events (203). The ability of EBV to evade the host immune system while persisting during the larger part of the life span of the host also requires EBV to subtly deregulate B cell behavior using normal B cell biology. Towards this goal, EBV encodes a viral protein, IL10, that induces B cell growth and differentiation while also blocking antigen presentation from monocytes and dendritic cells (174). Lytic Replication The study of lytic replication in EBV infected cells requires the induction of latently infected cells into the lytic program. In vitro studies have focused on inducing lytic replication through the treatment of latently infected cells with phorbol esters. Phorbol esters induce lytic replication through the activation of the protein kinase c (PKC) pathway. The PKC pathway induces lytic replication through the activation of AP-1 sites that are upstream of viral immediate-early (IE) genes and through the activation of the viral IE protein BZLF1 (9, 82, 83). Induction of lytic replication can also be achieved through activation of the B cell receptor with soluble immunoglobulin (277). Following induction, cells undergo various cytopathic changes prior to virion release including margination of nuclear chromatin, inhibition of host macromolecular synthesis, replication of viral DNA, assembly of nucleocapsids, nucleation of nucleocapsids, and envelopment of the virus through the inner nuclear membrane (55, 92, 99, 141, 148, 219, 237, 252). Similar to other herpesviruses, EBV lytic gene expression follows a temporal and sequential order (277). Lytic gene expression can be subdivided into three stages, immediate 8

25 early (IE), early, and late. IE genes are defined by viral mrnas that can be transcribed immediately after infection in the presence of a protein synthesis inhibitor (216). Early genes are those that are expressed prior to DNA replication and late genes require viral DNA synthesis for their transcription. The primary IE genes of EBV are BZLF1 and BRLF1 (216). Because lytic EBV infection in vitro can only be studied through the induction of latently infected cells, it must be noted that the role of the IE genes could be affected by the latency program. With this in mind, BZLF1 and BRLF1 have been identified as potent transactivators of cellular and viral gene expression. Ectopic expression of BZLF1 can activate lytic infection ( ). BZLF1 is a dimerizing DNA binding protein that can bind AP-1-like sites, some found within its own promoter, and can autoregulate its own promoter as well as the BRLF1 promoter (76, 81-83). BZLF1 can associate with NFκB family members and p53, resulting in the inhibition of its transactivating activity, when bound to NFκB, or the inactivation of both proteins, when bound to p53 (107, 124, 140, 311). BRLF1 also contains transactivating activity although its activity has not been as well characterized as the transactivating activities of BZLF1 (112, 113). In addition to BZLF1 and BRLF1, EBV also encodes the early transactivators BSMLF1 and BMRF1 (43, 44). BSMLF1 is a promiscuous transactivator that works synergistically with BZLF1 or BRLF1 (145). The EBV glycoproteins are all late genes and include gp350/220, gp110, gp85, gp42, gp55/80, gp150, gp15, gp84/113, and gp64. gp350/220 mediates binding to the EBV receptor CR2, is the major component of the EBV envelope, and most neutralizing antibodies are directed against gp350/220 (181, ). 9

26 Establishment of Latency The EBV latent program is characterized by the constitutive expression of a subset of viral gene products. These latent viral gene products include six EBV nuclear antigens (EBNAs 1, 2, 3, 3A, 3B, 3C and LP) and three latent membrane proteins (LMPs 1, 2A, and 2B), as well as a family of highly spliced 3 co-terminal transcripts, BamHIA transcripts or BARTs, and a group of small non-polyadenylated RNAs (EBER1 and EBER2). Latency is subdivided into three different types depending on the pattern of gene expression (Table 1). Type I latency is characterized by expression of EBNA1 from the Qp promoter as well as the EBERs and the BARTs. In type II latency, the expression is limited to EBNA1, the EBERs, the BARTs, LMP1 and LMP2A. In type III latency all of the latent proteins, including EBNA-2, -LP, and 3A-C, are expressed in addition to the BARTs and EBERs, and infection of B lymphocytes in vitro results in a type III program (148, 308). A subset of latent proteins are essential for EBV-mediated transformation of B-lymphocytes, and these are EBNA1, EBNA2, EBNA3A, EBNA3C, and LMP1 (47, 235). I II III EBNA1 Qp Qp Wp, Cp EBNA2, EBNA-LP, EBNA3s No No Yes LMP1 No Yes Yes LMP2 No Yes Yes EBERs Yes Yes Yes BARTs Yes Yes Yes Malignancy BL HD, NPC LCL Table 1. Types of EBV latent gene expression and their associated malignancies. The three types of latency associated with EBV (I, II, or III) are listed with the viral products associated with each latency type. The viral promoters used by EBNA1 are listed for each latency type. (Adapted from (148)). 10

27 EBNA1 EBNA1 is expressed in all EBV infected cells where its main role is the maintenance and replication of the viral genome through its sequence-specific binding to the origin of viral replication, Ori P (236, 308). By tethering the viral episome to mitotic chromosomes in dividing cells, each daughter cell retains the viral genome (213, 304, 305). EBNA1 can also regulate the transcription of other EBNAs, including itself, as well as LMP1 through its interaction with viral promoters (308). As mentioned previously, glycine-alanine repeats between the amino- and carboxyl-terminal ends of EBNA1 stabilize the mature protein by preventing its proteasomal breakdown (166). Expression of EBNA1 in murine cells does not induce a CTL response, perhaps as a result of its impaired proteasomal breakdown, which is required for antigen processing into MHC class I (166, 290). These characteristics of EBNA1 allow latently infected cells, in particular those of latency type I, to avoid host immune recognition. EBNA2 and EBNA-LP Although both EBNA2 and EBNA-LP are expressed during type III latency, EBNA2 is essential for the transformation of B-lymphocytes by EBV. Whereas EBNA-LP is not essential, it aids in the outgrowth of LCLs (5, 48, 187). EBNA-LP has two runs of basic amino acids that are responsible for its nuclear localization and EBNA-LP coactivates EBNA2-mediated transcription from the Cp and LMP1 promoter (111, 211, 224). EBNA2 is a potent viral transactivator of both cellular and viral promoters through its interaction with a sequence-specific DNA-binding protein Jκ-recombination-binding protein 11

28 (RBP-Jκ) as well as PU.1 (104, 125, 135). Through its interaction with RBP-Jκ and PU.1 EBNA2 transactivates cellular such as CD21, CD23, and c-myc as well as the EBV genes LMP1 and LMP2A and this interaction is necessary for EBV-mediated B-lymphocyte transformation (1, 49, 71, 72, 296, 303). EBNA3A, EBNA3B, and EBNA3C Similar to EBNA2 and EBNA-LP, the three EBNA3s are only expressed in latency type III. EBNA3B is neither necessary for B-lymphocyte transformation nor required for LCL outgrowth, lytic replication, or cell survival (288). In contrast, EBNA3A and EBNA3C are essential for EBV-mediated B-lymphocyte transformation (289). Although the EBNA3 mrnas are present at very low levels the protein products have a very long half life (148). The EBNA3s negatively modulate the transcriptional activation of EBNA2 and EBNA-LP through competition for RBP-Jκ and Notch (136, 154, 190, 239, 241, 292, 312). EBNA3A represses the viral Cp promoter in both B-lymphocytes and epithelial cells (46). EBNA3C can cooperate with RAS to disrupt cell-cycle checkpoints and induce rodent fibroblast transformation (220, 221). EBNA3C in conjunction with EBNA2 can induce transcription of LMP1 through binding the PU.1 site within the LMP1 promoter (190, 313). LMP1 LMP1 is the main oncogene of EBV as it can transform rodent fibroblasts in vitro and is essential for EBV-mediated transformation of B-lymphocytes (142, 294). Expression of LMP1 in epithelial cells significantly affects cell growth, inhibits differentiation and can induce morphologic transformation (52, 72). Expression of LMP1 in cells has pleiotropic 12

29 effects resulting in the induction of a variety of cellular markers including cell-adhesion molecules (e.g. ICAM1/CD54, E-cadherin), anti-apoptotic proteins (e.g. Bcl-2 and A20), growth factors (e.g. EGFR), and others (64, 65, 86, 114, 194, 295). Although LMP1 is regulated by a weak promoter, LMP1 mrna is significantly more abundant than EBNA mrnas in latently infected B-lymphocytes (78, 250). In epithelial cells, transcription of LMP1 is mediated by multiple TATA-less sites in the nearest terminal repeat (TR), which results in a transcript with a long 5 untranslated exon (94, 247). LMP1 is an integral membrane protein composed of a short 20 amino-acid amino-terminal end, six hydrophobic transmembrane domains, and a 200-amino-acid long carboxyl-terminal tail (Figure 2A) (78, 240). The half-life of LMP1 is less than two hours and post-translational modifications include phosphorylation at multiple serine and threonine residues, but not tyrosine residues (14, 42, 186, 199, 200). LMP1 associates with cellular cytoplasmic cytoskeleton and is present in cholesterol-rich lipid rafts without requiring ligand stimulation (22, 120, 171, 172). Interestingly, only about half of the cellular LMP1 is found in the plasma membrane with the rest being associated with other cellular membranes, suggesting that LMP1 may regulate its signaling activity through its cellular localization (119, 172, 185). The carboxyl-terminal domain of LMP1 contains two main signaling domains, the membrane proximal carboxyl-terminal activating region 1 (CTAR1 or TES1) and the membrane distal carboxyl-terminal activating region 2 (CTAR2 or TES2). Although LMP1 has little sequence homology to any known protein, it is functionally similar to the tumor necrosis factor receptor (TNFR) and CD40 (204). Both LMP1 and CD40 signal through recruiting adapter proteins called TNFR associated-factors (TRAFs) to a PxQxT motif (57, 85). While CTAR1 recruits TRAFs 1, 2, 3, and 5 directly through its PxQxT motif, CTAR2 13

30 indirectly recruits TRAFs 2 and 6 by binding adapter molecules such as the TNFR associated death domain (TRADD), the receptor interacting protein (RIP), and BS69 (130, 131, 293). In contrast to TNFR, LMP1 does not require a ligand to associate with the TRAFs, thus LMP1 is constitutively active (57, 85, 193, 204). Although both CTAR1 and CTAR2 utilize TRAFs to induce signaling, the two domains have distinct signaling properties (Figure 2B). Despite both CTAR1 and CTAR2 being able to activate the NFκB family of transcription factors, when measured by NFκB reporter assay, CTAR2 contributes about 70% of the NFκB activity while CTAR1 contributes the remaining 30% (110, 159, 193). Interestingly, in epithelial cells CTAR1 activates three different NFκB dimer forms (p50/p50, p50/p52, and p52/p65) whereas CTAR2 only activates p52/p65 dimers (193, 217). CTAR1, but not CTAR2, retains the ability to upregulate the epidermal growth factor receptor (EGFR) and this upregulation may be due to the CTAR1-specific activation of p50/p50/bcl-3 complexes, which have been shown to be bound to the NFκB sites within the egfr promoter (194, 285). Furthermore, although CTAR2 is not necessary for LMP1-mediated transformation of B-lymphocytes, LMP1 deleted for CTAR2 cannot support LCL outgrowth (142, 143). In addition to the NFκB signaling pathway LMP1 can activate a myriad of other signaling pathways including Cdc42, p38 pathway, c-jun N-terminal kinase (JNK) pathway, phosphoinositol 3-kinase (PI3K), and mitogen-activated protein kinase (MAPK)/ extracellular signal-regulated kinase (ERK) 1 (MEK1) pathway (53, 66, 67, 173, 238, 249). LMP1 also induces an increase in the cell surface expression of a variety of markers including CD23, CD39, CD40, CD44, CD54 (ICAM1), MHC class II, and LFA3, and it can also induce secretion of the cytokine IL10 and decrease levels of CD10 (148). LMP1 can 14

31 inhibit apoptosis in B-lymphocytes as well as protect epithelial cells from p53-mediated apoptosis, in part through increasing the levels of A20 and Bcl-2 (86, 87, 103, 114, 159, 191, 245). LMP1 can induce expression of the inhibitor of differentiation (Id) family of proteins as well as induce deregulation of a variety of markers associated with cell-cycle progression (70, 167, 240). Expression of LMP1 in epithelial cells blocks epithelial cell differentiation (52). In transgenic mice, expression of LMP1 in skin leads to epidermal hyperplasia and when expressed under control of the immunoglobulin (Ig) heavy chain promoter increases the incidence of B cell lymphomas (155, 302). A N Transmembrane Domains CTAR1 CTAR2 1 2 C B N N PI3K 1 1 TRAFS 1, 2, 3, 5 Akt p52/65 TRAF2/6 TRADD 22 C C p52/50 P50/50 30% NFkB EGFR p52/65 Id1, Id3 JNK MAPK MEK1/2 p27 CDK2 Rb 70% NFkB Figure 2. Signal transduction pathways associated with LMP1. (A) LMP1 is composed of a short amino-terminal cytoplasmic region, 6 transmembrane domains (white bar), and a long carboxyl-terminal tail that contains its two main signaling domains, CTAR1 (1) and CTAR2 (2). (B) CTAR1 directly binds several TRAFs and activates various signaling pathways including PI3K and NFκB signaling pathways. CTAR2 recruits TRAFs through adapter molecules, such as TRADD and RIP, and also activates a variety of signaling pathways including NFκB and JNK. The activation of NFkB leads to several cellular targets 15

32 being induced including the antiapoptotic A20 and Bcl-2, as well as EGFR, ICAM1, CD23, and others. LMP2 LMP2 refers to two integral membrane proteins, LMP2A and LMP2B, expressed during type II and type III latency. LMP2A and LMP2B are not necessary for EBVmediated B cell transformation (175). Also, viral replication is not altered when latently infected cells carrying LMP2A mutants are subjected to viral reactivation (151, ). Interestingly, expression of LMP2A in B-lymphocytes in transgenic mice abrogates normal B-lymphocyte development leading to Ig-negative cell colonization of peripheral lymphoid organs, suggesting that LMP2A can mimic signaling through the B-cell receptor (BCR) (33, 308). In contrast, LMP2A can transform epithelial cells while enhancing their adhesion and motility (256). Although little is known about LMP2B, recent reports suggest that it plays a role in modulating LMP2A activity (244). LMP2A, which is expressed in type II and type III latency, is composed of a long amino-terminal tail that contains an immunoreceptor-tyrosine activation motif (ITAM), 12 transmembrane domains and a short 27-amino acid. In B-lymphocytes LMP2A associates with and is a substrate of the Src family of tyrosine kinases and the ITAM motif plays a key role in the ability of LMP2A to induce survival signals in the absence of BCR signaling (24, 88, 89, 176). In epithelial cells, LMP2A is phosphorylated in response to cell adhesion mediated by carboxyl-terminal Src kinase (Csk) (257). LMP2A expression in telomeraseimmortalized human keratinocytes leads to activation of PI3K and β-catenin signaling pathways, including the inactivation of glycogen synthase kinase β (GSK3β) and a member of the forkhead transcription factor family (201, 202). In HaCaT keratinocytes, ectopic 16

33 expression of LMP2A also activates PI3K and Akt signaling while blocking differentiation and inducing tumor formation in nude mice (256). EBERs EBERs, EBER1 and EBER2, are small non-polyadenylated RNAs that are the most abundant RNAs in latently infected cells. Although they are present in all three forms of latency they are not necessary for EBV-mediated transformation of B cells (274). EBERs assemble into ribonucleoprotein complexes with the La autoantigen and ribosomal protein L22 in the nucleus of infected cells and also bind the double-stranded RNA binding protein kinase (PKR) (98, 276). Both EBERs share sequence and structural homology with the adenovirus protein VA and cellular U6 RNAs, which also associate with La (98). Adenovirus VA blocks PKR activity and the ability of the EBERs to bind PKR suggest a role for the EBERs in countering cellular antiviral mechanisms and promoting persistence (254). Furthermore, expression of the EBERs in BL cell lines promote cell survival, increase tumorigenicity and induce interleukin-10 (IL-10) expression (246, 276). BARTs BamHIA rightward transcripts (BARTs) or complementary strand transcripts (CSTs) are a group of abundantly expressed and highly spliced RNAs that were identified in NPC but have also been found in Burkitt s lymphoma, Hodgkin lymphoma, and nasal T-cell lymphoma, as well as in the peripheral blood of healthy individuals (39, 54, 122). Although the BARTs are found in a variety of EBV-associated malignancies and are expressed in all types of latency, their expression is not necessary for EBV-mediated transformation of B- 17

34 lymphocytes in vitro (242). Distinct splice variants can be identified by PCR and RNase protection assay (247, 268). Three transcripts have been of particular interest as they appear to encode open reading frames, rkbarf0, rb2 (A73), and rk103 (RPMS1), with RK-BARF0 and RB2 mrnas being the most abundant in NPC (248). Yeast-two-hybrid of RK-BARF0, RB2, and RK103 revealed various cellular binding partners and RK-BARF0 has been demonstrated to bind to Notch 1 and Notch4 as well as induce the nuclear translocation of unprocessed Notch (158). Interestingly, RK-BARF0 also induces the proteasomal degradation of Notch which correlates with EBV-positive cell lines having reduced levels of Notch (284). RK103 binds RBPJκ, a Notch downstream target, and inhibits the transactivating activities of both EBNA2 and NotchIC (310). RB2 can bind the receptor for activated protein kinase C (RACK) (268). Another product of a BART, BARF1, has been shown to be a secreted protein and has oncogenic activity when expressed in rodent fibroblasts (56, 260). Recent studies have focused on the finding that EBV encodes at least 17 micro RNAs (mirnas) with 14 of these being found as BARTs (32, 105, 225). The BART mirnas are expressed at high levels in latently infected epithelial cells but lower levels in latently infected B-lymphocytes, with mirnas only expressed in latency III (32, 153). These findings point towards a mechanism through which EBV can regulate gene expression in a host cell without requiring viral gene expression. Genetics with EBV The limited host range of EBV to B-lymphocytes and the nonpermissiveness of these cells for lytic replication have hindered the construction of EBV recombinants. Specifically 18

35 mutated recombinant EBV can be produced by transfecting latently infected lymphocytes with mutated DNA fragments that are cloned and amplified in Escherichia coli followed by lytic program induction where homologous recombination gives rise to recombinant EBV (161, 188, 189, 288, 297). Alternatively, latently infected lymphocytes with the replicationcompetent but transformation-deficient EBV P3HR1 can be used as the source of the parental strain (242, 289). Recently the EBV genome was cloned into a bacterial artificial chromosome (BAC) vector and was shown to yield recombinant EBV (138). The EBV-BAC will likely facilitate the study of specific mutants in the context of EBV infection, establishment of latency, and reactivation. EBV-Associated Malignancies Infectious Mononucleosis (IM) As mentioned previously, primary infection with EBV is usually asymptomatic. Delay of primary infection until adolescence sometimes results in IM. During IM, patients shed high titers of virus from lytic infection at the oropharynx while also maintaining high numbers of latently infected, EBNA2 and LMP1 positive, lymphoblasts in the tonsillar lymph nodes (8, 157). The symptoms associated with IM are the result of an increase in proinflammatory cytokines, such as IL-1, IFN-γ, TNFα, released by T-lymphocytes in response to lytic and latent viral antigens (2, 208). The CD8 + T-cell memory response is then maintained during the life span of the host and it usually constitutes up to 5% of the total circulating CD8 + T-cell population (121). Chronic Active EBV 19

36 Classic IM infections generally result in the infection resolving and the host returning to an asymptomatic state. A few exceptional patients present with chronic fatigue symptoms, and although there is no clear link to EBV, some children suffer from recurrent fever, lymphadenopathy, and hepatosplenomegaly as well as high titers of IgG against VCA and EA for several years after primary infection (4, 117, 214, 258). These patients also have high EBV genome loads in their peripheral blood mononuclear cells (PBMC) (183, 258). X-linked Lymphoproliferative Syndrome (XLP) XLP is a lymphoproliferative disease that afflicts young boys and is characterized by extreme sensitivity to EBV (15, 230) % of patients present with hyperacute-im followed by liver failure as a result of widespread lymphocytic infiltration and hepatic necrosis (237). Virus Associated Hemophagocytic Syndrome (VAHS) VAHS is a T-cell lymphoma that is mainly found in Southeast Asian populations. VAHS arises either after acute primary infection or during chronic active EBV infection with VAHS-like symptoms (137, 139). These CD4 + and CD8 + T-cell lymphomas are of monoclonal origin, have a latency I/II pattern of gene expression and arise from a premalignant pool of EBV-infected T-lymphocytes (150, 308). Symptoms include fever, lymphadenopathy, hepatosplenomegaly, hemophagocytosis in tissues, and pancytopenia often leading to death (237). Hodgkin Lymphoma (HD) 20

37 In Hodgkin Lymphoma malignant mononuclear Hodgkin and multinuclear Reed- Sternberg cells (HRS) are surrounded by very dense non-malignant lymphocytic infiltrate. HD is further classified by the appearance of the infiltrate into nodular sclerosing (NS), mixed cellularity (MC), lymphocyte depleted (LD) and lymphocyte predominant. About 40% of cases of HD in developed countries are EBV-positive with the number of EBVpositive cases being larger in developing nations (126). Most of the EBV-positive cases in developed nations are MC and LD, but only a minority of the NS cases that make up the peak of HD incidence in developed countries are EBV positive (126). In developing countries childhood HD is more prevalent and there is a steady increase of MC incidence with age (237). Individuals with a prior history of IM are at a higher risk of developing HD within three years of primary infection (97). HRS cells, which are of B-cell origin, stain positive for EBV DNA, have a type II pattern of gene expression and show no chromosomal abnormalities (7, 21, 156, 300, 301). Increased levels of Bcl-2, p53, IL-10 and increased NFκB activity are associated with HRS cells (228). NFκB signaling plays a key role in the growth of HD cell lines, and EBV-negative HRS cell lines frequently have mutant IκBα alleles or amplification of the REL gene (16, 30, 68, 128, 156). Nasopharyngeal Carcinoma (NPC) NPC is a subset of gastric adenocarcinomas and certain salivary-gland carcinomas as a result of EBV infection of the epithelium (231). NPC is rare in North America and Europe where its frequency is less than 0.5 incidents per 100,000 cases. In contrast, parts of China and Southeast Asia the incidence is 25 per 100,000 cases per year, with Chinese Cantonese 21

38 males having an increased incidence (309). In addition to genetic factors, environmental factors such as a diet high in salted fish and repeated exposure of the nasopharynx to chemical carcinogens have been suggested to play an important role in the etiology of NPC (237, 309). The World Health Organization subdivides NPC into three types with EBV having the most consistent association with type III NPC, which is EBV positive almost 100% of the time. Type III NPC is non-keratinizing, is often undifferentiated, and contains a large lymphocytic infiltrate that plays an important role in the propagation of the tumor (207, 222, 231, 308). NPC patients have increased EBV antibody titers with tumors indicating monoclonal expansion (215, 233). Although NPC has a type II latency pattern of gene expression only 20-40% of NPC tumors express LMP1 (231). Although antibodies against viral lytic antigens can be identified, only episomal DNA can be detected from tumors and tumors are generally negative for viral lytic antigens. These findings suggest that some fraction of the NPC tumor may be going through lytic reactivation (45, 106, 118, 233). NPC tumor cells express HLA class I and class II antigens process antigens efficiently and also express markers associated with epithelial-lymphocyte interactions such as CD40, CD54/ICAM1, CD70, CD86, CD95/FasR (2, 147, 162, 253). HLA haplotype seems to play a role in NPC pathogenesis as genes closely linked to HLA can be associated with an increased risk for development of NPC (60, 180). Haplotyes HLA-A2, BW46, A19, B17 class I and HLA-DR β10803 class II are associated with an increased risk for NPC, while HLA A11 and B13 class I have decreased risk (60, 237). Although many of the high-risk haplotypes are prevalent in Southeast Asia and certain areas 22

39 of China, Chinese immigrants and second generation Chinese immigrants have a reduced risk for NPC suggesting an important role of environmental factors in NPC oncogenesis (237). The role of EBV in initiating NPC tumor development is not well understood. Although EBV cannot transform epithelial cells, EBV can be detected in pre-malignant lesions of the nasopharynx suggesting that EBV may play a role in the early stages of NPC oncogenesis (223, 302). Genetic mutations, such as those leading to an increase in p53 levels or loss of the cyclin-dependent kinase inhibitor (cdki) p16 INK4a, may be necessary for NPC pathogenesis (61, 106, 272). p53 mutations are frequently detected in NPC tumors passaged in nude mice but are infrequently detected in primary NPC tumors or metastatic tumors, suggesting that p53 mutations are not necessary for NPC oncogenesis (61). Gastric Carcinoma EBV is found in approximately 10% of typical gastric carcinomas, with a pattern of gene expression similar to NPC (127, 261, 287). EBV-positive gastric carcinomas have different characteristics than their EBV-negative counterparts, including loss of expression of p16 INK4a and improved patient survival (160, 255). The absence of EBV infection in premalignant gastric lesions suggests that EBV plays a role in the later stages of oncogenesis (314). Post-Transplant Lymphoproliferative Disorders (PTLD) Sustained immunosuppression of transplant patients can lead to an increased incidence of lymphomas or PTLDs. The major risk factor associated with PTLD is the intensity of T-lymphocyte suppression due to the different kinds of transplantation. For 23

40 example, PTLD has a 1-2% incidence rate in renal and liver transplants, 3-8% incidence in heart and lung transplants due to the need for greater immunosuppression (237). PTLD occurs in only 1% of bone marrow transplants although the incidence increases to 12-24% if the bone marrow is depleted of T-lymphocytes. Because bone marrow transplants usually require total ablation of host lymphoid cells, PTLD are likely to be derived from the EBVinfected donor B cells in the transplanted bone marrow (101, 108). Patients who are EBV seronegative before transplantation are also at a higher risk of PTLD (123). Reduction of immunosuppressive therapy can result in lesion regression, and depletion of the graft of B- and T-lymphocytes can reduce PTLD incidence (108, 269). PTLD usually appears one to two years post transplantation and lesions are subdivided into three categories: early lesions involving plasmacytic hyperplasia and reactive elements similar to that observed in IM tissues, polymorphic lesions of either B-cell hyperplasia or B-cell lymphoma, or monomorphic lesions that are immunoblastic lymphomas (237). 90% of monomorphic lesions are associated with EBV with the lesions showing a type III latency with EBNA1, EBNA2, and LMP1 found in most EBV-positive lesions (170, 279, 307). p53 and c-myc mutations are sometimes associated with PTLD (170, 279, 307). HIV Associated Lymphomas Human immunodeficiency virus (HIV)-associated lymphomas are more prevalent than PTLD and had an incidence of about 10% during the early stages of the acquired immunodeficiency syndrome (AIDS) epidemic amid a larger spectrum of tumor types (19). About 50% of these lymphomas are EBV-associated although the association varies with the type of tumor (90). One major category of AIDS lymphomas, which is EBV-positive in 24

41 about 80% of cases, is very similar to PTLD and appears only in end-stage AIDS. Most lymphomas that present in the central nervous system (CNS) of AIDS patients are of this type (182). There are three other categories of HIV-associated lymphomas. A common small B- cell lymphoma similar to Burkitt s that appears in earlier stages of AIDS when the T-cell population is mostly unaffected has a 30-40% association with EBV. This type of lymphoma lacks EBNA2 and LMP1 expression (109, 146) and is often one of the first signs of AIDS (36, 90). Large B-cell lymphomas similar to PTLD are also EBNA2 and LMP1 negative. They are associated with EBV 30-40% of the time and differ from PTLD in their Bcl-6 expression (36, 109). Primary effusion lymphomas, which are consistently positive for Kaposi s sarcoma associated herpesvirus (KSHV), also contain the EBV genome, but only EBNA1 expression and trace amounts of LMP1 can be detected (34, 37, 275). Congenital Immunodeficiencies Children who are congenitally immunodeficient are susceptible to EBV-associated lymphoproliferative diseases. Lesions tend to be oligoclonal and show a type III pattern of gene expression (73, 279). Children with common variable immunodeficiency or Wiskott- Aldrich syndrome are particularly at risk, due to their inability to mount effective T-cell control of the viral infection (63). Oral Hairy Leukoplakia (HLP) Oral Hairy Leukoplakia (HLP) is the only known malignancy caused by an EBV permissive infection. HLP refers to a lesion, usually found in immunocompromised patients, 25

42 found in the lateral borders of the tongue (102). The lesion is characterized by thickening of the epithelium and shows no viral DNA in the parabasal or basal layers of the epithelium underlying the areas where viral replication is taking place (209). HLP lesions contain no episomal DNA and only traces of the EBERs, but do express lytic antigens (93, 218). Transformation-competent virus can be detected in the HLP lesions (218). Interestingly, latency-associated viral proteins, EBNA1, EBNA2, and LMP1, can be isolated from the upper-layers of the lesion (298). Burkitt s Lymphoma (BL) Burkitt s Lymphoma (BL) can be divided into three categories: endemic, sporadic, and AIDS-associated. Endemic BL is the most common form and is the leading cause of childhood cancer in equatorial Africa, as well as coastal New Guinea, with a very high incidence (5-10 cases/100,000 per year over the first 15 years of life) and a marked geographic distribution determined by climate as well as areas where malaria is holoendemic (25, 26, 28, 184, 227). Endemic BL tumors are 100% EBV positive (18). Endemic BL usually develops during childhood at extranodal sites in the jaw during molar eruption, in the CNS or in the abdomen (237). Tumors are homogeneous, composed of B-lymphocytes that are similar to germinal center B-lymphocytes, and appear to be of monoclonal origin (62, 233). BL tumors have one of three reciprocal chromosomal translocations between chromosome 8, at or near the c-myc locus and either the Ig heavy-chain locus on chromosome 14, or on one of the light-chain loci on chromosomes 2 or 22 (50). Sporadic BL does not have a marked geographical distribution and its association with EBV varies wildly from 15-85%. The incidence of sporadic BL is fold lower 26

43 than endemic BL and the disease peaks at a later age. Sporadic BL also has a different pattern of presentation as it is more frequently associated with an abdominal mass and occasionally presents itself as a leukemia (184). The third form of BL, AIDS associated, was discussed previously. BL tumors have a type I pattern of viral gene expression with only EBNA1 expression and no other viral latency-associated proteins. It has been hypothesized that malaria or HIV infection could induce generalized adenopathy leading to lymphoid hyperplasia and expanded germinal centers (237). The transforming potential of the virus may play an important role in the early expansion of the B-cell population, with EBNA2 and LMP1 perhaps playing an important role in this early transformation event. The subsequent acquisition of a genetic mutation, such as the aforementioned c-myc translocation, could then drive the lesion to a type I pattern of gene expression, as it does not require EBNA2 or LMP1 (227). Therapeutic Approaches Pharmacological agents that induce the EBV lytic cycle in conjunction with the nucleoside analogue gancyclovir as well as demethylating agents, such as 5-azacytidine, have targeted the EBV life-cycle directly (6, 77, 129). Chemical agents targeting individual EBV proteins through single-chain antibodies, RNA interference (RNAi), or by inhibiting the signal transduction pathways targeted by the viral proteins (e.g. NFκB, RBP-Jκ) have had limited success (31, 75, 144, 226). Infusion of effector T-cells prepared from the bone marrow donor by autologous LCL stimulation and expansion in vitro were highly effective in 27

44 bone-marrow transplant patients and similar adoptive-transfer approaches are now being utilized for PTLD cases as well as for solid-organ transplants (243, 308). 28

45 OBJECTIVES Latent membrane protein 1 (LMP1) plays a key role in oncogenesis caused by EBV. LMP1 is the main EBV oncogene as EBV deleted for LMP1 fails to transform B- lymphocytes and LMP1 by itself can transform Rat-1 fibroblasts. LMP1 induces a variety of cellular changes including increased motility and inhibition of differentiation. LMP1 also induces a wide variety of signal transduction pathways that affect cellular growth and promote survival. Several LMP1 sequence variants have been isolated from EBV-positive tumors. Interestingly, none of the sequence variants have mutations in the two main LMP1 signaling domains CTAR1 or CTAR2. The goal of this study is to determine the transforming potential as well as the signal transduction potential of the two main signaling domains of LMP1. A variety of LMP1 mutants encompassing the carboxyl-terminal tail of LMP1, CTAR1, and CTAR2 as well as 6 LMP1 sequence variants were examined. Aim 1. Epstein-Barr virus latent membrane protein 1 CTAR1 mediates rodent fibroblast and human fibroblast transformation through activation of PI3K. The roles of CTAR1 and CTAR2 in LMP1-mediated transformation were analyzed. The role of CTAR1 and CTAR2 in the activation of the PI3K-Akt signaling pathway as well as the role of NFκB and PI3K-Akt signaling in LMP1-mediated transformation were also analyzed using chemical inhibitors. Finally, the role of CTAR1 and CTAR2 in LMP1- induced aberrant growth of human embryo lung cells was analyzed. Aim 2. LMP1 strain variants: biological and molecular properties. 29

46 The transforming and signal transduction properties of six LMP1 sequence variants were analyzed. The sequence variants were analyzed for their ability to block contactinhibited growth and induce anchorage-independent growth in rodent fibroblasts. The sequence variants were also analyzed for their ability to induce cellular migration in human keratinocytes and homotypic adhesion in B-lymphocytes. The activation of the PI3K-Akt and NFκB signaling cascades as well as the deregulation of cellular markers involved in cellcycle progression were evaluated. Aim 3. Unique signaling properties of CTAR1 in LMP1-mediated transformation. The role of CTAR1 and its binding cellular targets (TRAF2, TRAF3, and TRAF6) in transformation and the induction of signal transduction pathways were analyzed. The ability of dominant negative TRAF2 and TRAF3 to inhibit LMP1-mediated transformation of rodent fibroblasts was analyzed. Furthermore, the transformation and signal transduction properties of various LMP1 mutants encompassing the carboxyl-terminal domain were analyzed. The role of the MEK-ERK signaling pathway in LMP1-mediated transformation was analyzed. 30

47 REFERENCES 1. Abbot, S. D., M. Rowe, K. Cadwallader, A. Ricksten, J. Gordon, F. Wang, L. Rymo, and A. B. Rickinson Epstein-Barr virus nuclear antigen 2 induces expression of the virus-encoded latent membrane protein. J Virol 64: Agathanggelou, A., G. Niedobitek, R. Chen, J. Nicholls, W. Yin, and L. S. Young Expression of immune regulatory molecules in Epstein-Barr virusassociated nasopharyngeal carcinomas with prominent lymphoid stroma. Evidence for a functional interaction between epithelial tumor cells and infiltrating lymphoid cells. Am J Pathol 147: Alexander, L., L. Denekamp, A. Knapp, M. R. Auerbach, B. Damania, and R. C. Desrosiers The primary sequence of rhesus monkey rhadinovirus isolate 26-95: sequence similarities to Kaposi's sarcoma-associated herpesvirus and rhesus monkey rhadinovirus isolate J Virol 74: Alfieri, C., and J. H. Joncas Biomolecular analysis of a defective nontransforming Epstein-Barr virus (EBV) from a patient with chronic active EBV infection. J Virol 61: Allan, G. J., G. J. Inman, B. D. Parker, D. T. Rowe, and P. J. Farrell Cell growth effects of Epstein-Barr virus leader protein. J Gen Virol 73 ( Pt 6): Ambinder, R. F., K. D. Robertson, and Q. Tao DNA methylation and the Epstein-Barr virus. Semin Cancer Biol 9: Anagnostopoulos, I., H. Herbst, G. Niedobitek, and H. Stein Demonstration of monoclonal EBV genomes in Hodgkin's disease and Ki-1-positive anaplastic large cell lymphoma by combined Southern blot and in situ hybridization. Blood 74: Anagnostopoulos, I., M. Hummel, C. Kreschel, and H. Stein Morphology, immunophenotype, and distribution of latently and/or productively Epstein-Barr virus-infected cells in acute infectious mononucleosis: implications for the interindividual infection route of Epstein-Barr virus. Blood 85: Angel, P., M. Imagawa, R. Chiu, B. Stein, R. J. Imbra, H. J. Rahmsdorf, C. Jonat, P. Herrlich, and M. Karin Phorbol ester-inducible genes contain a common cis element recognized by a TPA-modulated trans-acting factor. Cell 49:

48 10. Arrand, J. R., L. Rymo, J. E. Walsh, E. Bjorck, T. Lindahl, and B. E. Griffin Molecular cloning of the complete Epstein-Barr virus genome as a set of overlapping restriction endonuclease fragments. Nucleic Acids Res 9: Babcock, G. J., L. L. Decker, M. Volk, and D. A. Thorley-Lawson EBV persistence in memory B cells in vivo. Immunity 9: Babcock, G. J., D. Hochberg, and A. D. Thorley-Lawson The expression pattern of Epstein-Barr virus latent genes in vivo is dependent upon the differentiation stage of the infected B cell. Immunity 13: Baer, R., A. T. Bankier, M. D. Biggin, P. L. Deininger, P. J. Farrell, T. J. Gibson, G. Hatfull, G. S. Hudson, S. C. Satchwell, C. Seguin, and et al DNA sequence and expression of the B95-8 Epstein-Barr virus genome. Nature 310: Baichwal, V. R., and B. Sugden Posttranslational processing of an Epstein- Barr virus-encoded membrane protein expressed in cells transformed by Epstein-Barr virus. J Virol 61: Bar, R. S., C. J. DeLor, K. P. Clausen, P. Hurtubise, W. Henle, and J. F. Hewetson Fatal infectious mononucleosis in a family. N Engl J Med 290: Bargou, R. C., F. Emmerich, D. Krappmann, K. Bommert, M. Y. Mapara, W. Arnold, H. D. Royer, E. Grinstein, A. Greiner, C. Scheidereit, and B. Dorken Constitutive nuclear factor-kappab-rela activation is required for proliferation and survival of Hodgkin's disease tumor cells. J Clin Invest 100: Bayliss, G. J., and H. Wolf Epstein--Barr virus-induced cell fusion. Nature 287: Bell, A., and A. B. Rickinson Epstein-Barr virus, the TCL-1 oncogene and Burkitt's lymphoma. Trends Microbiol 11: Beral, V., T. Peterman, R. Berkelman, and H. Jaffe AIDS-associated non- Hodgkin lymphoma. Lancet 337:

49 20. Borza, C. M., and L. M. Hutt-Fletcher Alternate replication in B cells and epithelial cells switches tropism of Epstein-Barr virus. Nat Med 8: Braeuninger, A., R. Kuppers, J. G. Strickler, H. H. Wacker, K. Rajewsky, and M. L. Hansmann Hodgkin and Reed-Sternberg cells in lymphocyte predominant Hodgkin disease represent clonal populations of germinal center-derived tumor B cells. Proc Natl Acad Sci U S A 94: Brown, K. D., B. S. Hostager, and G. A. Bishop Differential signaling and tumor necrosis factor receptor-associated factor (TRAF) degradation mediated by CD40 and the Epstein-Barr virus oncoprotein latent membrane protein 1 (LMP1). J Exp Med 193: Buell, G. N., D. Reisman, C. Kintner, G. Crouse, and B. Sugden Cloning overlapping DNA fragments from the B95-8 strain of Epstein-Barr virus reveals a site of homology to the internal repetition. J Virol 40: Burkhardt, A. L., J. B. Bolen, E. Kieff, and R. Longnecker An Epstein-Barr virus transformation-associated membrane protein interacts with src family tyrosine kinases. J Virol 66: Burkitt, D A children's cancer dependent on climatic factors. Nauchni Tr Vissh Med Inst Sofiia 194: Burkitt, D A lymphoma syndrome in African children. Ann R Coll Surg Engl 30: Burkitt, D A sarcoma involving the jaws in African children. Br J Surg 46: Burkitt, D A tumour syndrome affecting children in tropical Africa. Postgrad Med J 38: Burkitt, D., and D. Wright Geographical and tribal distribution of the African lymphoma in Uganda. Br Med J 5487: Cabannes, E., G. Khan, F. Aillet, R. F. Jarrett, and R. T. Hay Mutations in the IkBa gene in Hodgkin's disease suggest a tumour suppressor role for IkappaBalpha. Oncogene 18:

50 31. Cahir-McFarland, E. D., D. M. Davidson, S. L. Schauer, J. Duong, and E. Kieff NF-kappa B inhibition causes spontaneous apoptosis in Epstein-Barr virustransformed lymphoblastoid cells. Proc Natl Acad Sci U S A 97: Cai, X., A. Schafer, S. Lu, J. P. Bilello, R. C. Desrosiers, R. Edwards, N. Raab- Traub, and B. R. Cullen Epstein-Barr virus micrornas are evolutionarily conserved and differentially expressed. PLoS Pathog 2:e Caldwell, R. G., J. B. Wilson, S. J. Anderson, and R. Longnecker Epstein- Barr virus LMP2A drives B cell development and survival in the absence of normal B cell receptor signals. Immunity 9: Callahan, J., S. Pai, M. Cotter, and E. S. Robertson Distinct patterns of viral antigen expression in Epstein-Barr virus and Kaposi's sarcoma-associated herpesvirus coinfected body-cavity-based lymphoma cell lines: potential switches in latent gene expression due to coinfection. Virology 262: Callan, M. F., L. Tan, N. Annels, G. S. Ogg, J. D. Wilson, C. A. O'Callaghan, N. Steven, A. J. McMichael, and A. B. Rickinson Direct visualization of antigen-specific CD8+ T cells during the primary immune response to Epstein-Barr virus In vivo. J Exp Med 187: Carbone, A., G. Gaidano, A. Gloghini, L. M. Larocca, D. Capello, V. Canzonieri, A. Antinori, U. Tirelli, B. Falini, and R. Dalla-Favera Differential expression of BCL-6, CD138/syndecan-1, and Epstein-Barr virus-encoded latent membrane protein-1 identifies distinct histogenetic subsets of acquired immunodeficiency syndrome-related non-hodgkin's lymphomas. Blood 91: Cesarman, E., Y. Chang, P. S. Moore, J. W. Said, and D. M. Knowles Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related bodycavity-based lymphomas. N Engl J Med 332: Chang, Y., E. Cesarman, M. S. Pessin, F. Lee, J. Culpepper, D. M. Knowles, and P. S. Moore Identification of herpesvirus-like DNA sequences in AIDSassociated Kaposi's sarcoma. Science 266: Chen, H., P. Smith, R. F. Ambinder, and S. D. Hayward Expression of Epstein-Barr virus BamHI-A rightward transcripts in latently infected B cells from peripheral blood. Blood 93:

51 40. Cheung, A., and E. Kieff Epstein-Barr virus DNA. X. Direct repeat within the internal direct repeat of Epstein-Barr virus DNA. J Virol 40: Cheung, A., and E. Kieff Long internal direct repeat in Epstein-Barr virus DNA. J Virol 44: Chien, K. Y., Y. S. Chang, J. S. Yu, L. W. Fan, C. W. Lee, and L. M. Chi Identification of a new in vivo phosphorylation site in the cytoplasmic carboxyl terminus of EBV-LMP1 by tandem mass spectrometry. Biochem Biophys Res Commun 348: Cho, M. S., K. T. Jeang, and S. D. Hayward Localization of the coding region for an Epstein-Barr virus early antigen and inducible expression of this 60- kilodalton nuclear protein in transfected fibroblast cell lines. J Virol 56: Cho, M. S., G. Milman, and S. D. Hayward A second Epstein-Barr virus early antigen gene in BamHI fragment M encodes a 48- to 50-kilodalton nuclear protein. J Virol 56: Clarke, P. A., N. A. Sharp, and M. J. Clemens Translational control by the Epstein-Barr virus small RNA EBER-1. Reversal of the double-stranded RNAinduced inhibition of protein synthesis in reticulocyte lysates. Eur J Biochem 193: Cludts, I., and P. J. Farrell Multiple functions within the Epstein-Barr virus EBNA-3A protein. J Virol 72: Cohen, J. I., and K. Lekstrom Epstein-Barr virus BARF1 protein is dispensable for B-cell transformation and inhibits alpha interferon secretion from mononuclear cells. J Virol 73: Cohen, J. I., F. Wang, J. Mannick, and E. Kieff Epstein-Barr virus nuclear protein 2 is a key determinant of lymphocyte transformation. Proc Natl Acad Sci U S A 86: Cordier, M., A. Calender, M. Billaud, U. Zimber, G. Rousselet, O. Pavlish, J. Banchereau, T. Tursz, G. Bornkamm, and G. M. Lenoir Stable transfection of Epstein-Barr virus (EBV) nuclear antigen 2 in lymphoma cells containing the EBV P3HR1 genome induces expression of B-cell activation molecules CD21 and CD23. J Virol 64:

52 50. Dalla-Favera, R., M. Bregni, J. Erikson, D. Patterson, R. C. Gallo, and C. M. Croce Human c-myc onc gene is located on the region of chromosome 8 that is translocated in Burkitt lymphoma cells. Proc Natl Acad Sci U S A 79: Dambaugh, T., C. Beisel, M. Hummel, W. King, S. Fennewald, A. Cheung, M. Heller, N. Raab-Traub, and E. Kieff Epstein-Barr virus (B95-8) DNA VII: molecular cloning and detailed mapping. Proc Natl Acad Sci U S A 77: Dawson, C. W., A. B. Rickinson, and L. S. Young Epstein-Barr virus latent membrane protein inhibits human epithelial cell differentiation. Nature 344: Dawson, C. W., G. Tramountanis, A. G. Eliopoulos, and L. S. Young Epstein-Barr virus latent membrane protein 1 (LMP1) activates the phosphatidylinositol 3-kinase/Akt pathway to promote cell survival and induce actin filament remodeling. J Biol Chem 278: Deacon, E. M., G. Pallesen, G. Niedobitek, J. Crocker, L. Brooks, A. B. Rickinson, and L. S. Young Epstein-Barr virus and Hodgkin's disease: transcriptional analysis of virus latency in the malignant cells. J Exp Med 177: Decaussin, G., V. Leclerc, and T. Ooka The lytic cycle of Epstein-Barr virus in the nonproducer Raji line can be rescued by the expression of a 135-kilodalton protein encoded by the BALF2 open reading frame. J Virol 69: Decaussin, G., F. Sbih-Lammali, M. de Turenne-Tessier, A. Bouguermouh, and T. Ooka Expression of BARF1 gene encoded by Epstein-Barr virus in nasopharyngeal carcinoma biopsies. Cancer Res 60: Devergne, O., E. Hatzivassiliou, K. M. Izumi, K. M. Kaye, M. F. Kleijnen, E. Kieff, and G. Mosialos Association of TRAF1, TRAF2, and TRAF3 with an Epstein-Barr virus LMP1 domain important for B-lymphocyte transformation: role in NF-kappaB activation. Mol Cell Biol 16: Diehl, V., G. Henle, W. Henle, and G. Kohn Demonstration of a herpes group virus in cultures of peripheral leukocytes from patients with infectious mononucleosis. J Virol 2:

53 59. Edwards, R. H., F. Seillier-Moiseiwitsch, and N. Raab-Traub Signature amino acid changes in latent membrane protein 1 distinguish Epstein-Barr virus strains. Virology 261: Edwards, R. H., D. Sitki-Green, D. T. Moore, and N. Raab-Traub Potential selection of LMP1 variants in nasopharyngeal carcinoma. J Virol 78: Effert, P., R. McCoy, M. Abdel-Hamid, K. Flynn, Q. Zhang, P. Busson, T. Tursz, E. Liu, and N. Raab-Traub Alterations of the p53 gene in nasopharyngeal carcinoma. J Virol 66: Ehlin-Henriksson, B., A. Manneborg-Sandlund, and G. Klein Expression of B-cell-specific markers in different Burkitt lymphoma subgroups. Int J Cancer 39: Elenitoba-Johnson, K. S., and E. S. Jaffe Lymphoproliferative disorders associated with congenital immunodeficiencies. Semin Diagn Pathol 14: Eliopoulos, A. G., N. J. Gallagher, S. M. Blake, C. W. Dawson, and L. S. Young Activation of the p38 mitogen-activated protein kinase pathway by Epstein- Barr virus-encoded latent membrane protein 1 coregulates interleukin-6 and interleukin-8 production. J Biol Chem 274: Eliopoulos, A. G., M. Stack, C. W. Dawson, K. M. Kaye, L. Hodgkin, S. Sihota, M. Rowe, and L. S. Young Epstein-Barr virus-encoded LMP1 and CD40 mediate IL-6 production in epithelial cells via an NF-kappaB pathway involving TNF receptor-associated factors. Oncogene 14: Eliopoulos, A. G., and L. S. Young Activation of the cjun N-terminal kinase (JNK) pathway by the Epstein-Barr virus-encoded latent membrane protein 1 (LMP1). Oncogene 16: Eliopoulos, A. G., and L. S. Young LMP1 structure and signal transduction. Semin Cancer Biol 11: Emmerich, F., M. Meiser, M. Hummel, G. Demel, H. D. Foss, F. Jundt, S. Mathas, D. Krappmann, C. Scheidereit, H. Stein, and B. Dorken Overexpression of I kappa B alpha without inhibition of NF-kappaB activity and mutations in the I kappa B alpha gene in Reed-Sternberg cells. Blood 94:

54 69. Epstein, M. A., B. G. Achong, and Y. M. Barr Virus Particles in Cultured Lymphoblasts from Burkitt's Lymphoma. Lancet 15: Everly, D. N., Jr., B. A. Mainou, and N. Raab-Traub Induction of Id1 and Id3 by latent membrane protein 1 of Epstein-Barr virus and regulation of p27/kip and cyclin-dependent kinase 2 in rodent fibroblast transformation. J Virol 78: Fahraeus, R., A. Jansson, A. Ricksten, A. Sjoblom, and L. Rymo Epstein- Barr virus-encoded nuclear antigen 2 activates the viral latent membrane protein promoter by modulating the activity of a negative regulatory element. Proc Natl Acad Sci U S A 87: Fahraeus, R., A. Jansson, A. Sjoblom, T. Nilsson, G. Klein, and L. Rymo Cell phenotype-dependent control of Epstein-Barr virus latent membrane protein 1 gene regulatory sequences. Virology 195: Falk, K., I. Ernberg, R. Sakthivel, J. Davis, B. Christensson, J. Luka, M. Okano, H. L. Grierson, G. Klein, and D. T. Purtilo Expression of Epstein-Barr virus-encoded proteins and B-cell markers in fatal infectious mononucleosis. Int J Cancer 46: Falk, L., F. Deinhardt, M. Nonoyama, L. G. Wolfe, and C. Bergholz Properties of a baboon lymphotropic herpesvirus related to Epstein-Barr virus. Int J Cancer 18: Farrell, C. J., J. M. Lee, E. C. Shin, M. Cebrat, P. A. Cole, and S. D. Hayward Inhibition of Epstein-Barr virus-induced growth proliferation by a nuclear antigen EBNA2-TAT peptide. Proc Natl Acad Sci U S A 101: Farrell, P. J., D. T. Rowe, C. M. Rooney, and T. Kouzarides Epstein-Barr virus BZLF1 trans-activator specifically binds to a consensus AP-1 site and is related to c-fos. Embo J 8: Feng, W. H., G. Hong, H. J. Delecluse, and S. C. Kenney Lytic induction therapy for Epstein-Barr virus-positive B-cell lymphomas. J Virol 78: Fennewald, S., V. van Santen, and E. Kieff Nucleotide sequence of an mrna transcribed in latent growth-transforming virus infection indicates that it may encode a membrane protein. J Virol 51:

55 79. Fingeroth, J. D., J. J. Weis, T. F. Tedder, J. L. Strominger, P. A. Biro, and D. T. Fearon Epstein-Barr virus receptor of human B lymphocytes is the C3d receptor CR2. Proc Natl Acad Sci U S A 81: Fischer, D. K., G. Miller, L. Gradoville, L. Heston, M. W. Westrate, W. Maris, J. Wright, J. Brandsma, and W. C. Summers Genome of a mononucleosis Epstein-Barr virus contains DNA fragments previously regarded to be unique to Burkitt's lymphoma isolates. Cell 24: Flemington, E., and S. H. Speck Autoregulation of Epstein-Barr virus putative lytic switch gene BZLF1. J Virol 64: Flemington, E., and S. H. Speck Identification of phorbol ester response elements in the promoter of Epstein-Barr virus putative lytic switch gene BZLF1. J Virol 64: Flemington, E. K., A. M. Borras, J. P. Lytle, and S. H. Speck Characterization of the Epstein-Barr virus BZLF1 protein transactivation domain. J Virol 66: Frade, R., M. Barel, B. Ehlin-Henriksson, and G. Klein gp140, the C3d receptor of human B lymphocytes, is also the Epstein-Barr virus receptor. Proc Natl Acad Sci U S A 82: Franken, M., O. Devergne, M. Rosenzweig, B. Annis, E. Kieff, and F. Wang Comparative analysis identifies conserved tumor necrosis factor receptorassociated factor 3 binding sites in the human and simian Epstein-Barr virus oncogene LMP1. J Virol 70: Fries, K. L., W. E. Miller, and N. Raab-Traub The A20 protein interacts with the Epstein-Barr virus latent membrane protein 1 (LMP1) and alters the LMP1/TRAF1/TRADD complex. Virology 264: Fries, K. L., W. E. Miller, and N. Raab-Traub Epstein-Barr virus latent membrane protein 1 blocks p53-mediated apoptosis through the induction of the A20 gene. J Virol 70: Fruehling, S., S. K. Lee, R. Herrold, B. Frech, G. Laux, E. Kremmer, F. A. Grasser, and R. Longnecker Identification of latent membrane protein 2A 39

56 (LMP2A) domains essential for the LMP2A dominant-negative effect on B- lymphocyte surface immunoglobulin signal transduction. J Virol 70: Fruehling, S., R. Swart, K. M. Dolwick, E. Kremmer, and R. Longnecker Tyrosine 112 of latent membrane protein 2A is essential for protein tyrosine kinase loading and regulation of Epstein-Barr virus latency. J Virol 72: Gaidano, G., A. Carbone, and R. Dalla-Favera Pathogenesis of AIDSrelated lymphomas: molecular and histogenetic heterogeneity. Am J Pathol 152: Gerber, P., S. Lucas, M. Nonoyama, E. Perlin, and L. I. Goldstein Oral excretion of Epstein-Barr virus by healthy subjects and patients with infectious mononucleosis. Lancet 2: Gergely, L., G. Klein, and I. Ernberg Host cell macromolecular synthesis in cells containing EBV-induced early antigens, studied by combined immunofluorescence and radioautography. Virology 45: Gilligan, K., P. Rajadurai, L. Resnick, and N. Raab-Traub Epstein-Barr virus small nuclear RNAs are not expressed in permissively infected cells in AIDSassociated leukoplakia. Proc Natl Acad Sci U S A 87: Gilligan, K., H. Sato, P. Rajadurai, P. Busson, L. Young, A. Rickinson, T. Tursz, and N. Raab-Traub Novel transcription from the Epstein-Barr virus terminal EcoRI fragment, DIJhet, in a nasopharyngeal carcinoma. J Virol 64: Given, D., and E. Kieff DNA of Epstein-Barr virus. IV. Linkage map of restriction enzyme fragments of the B95-8 and W91 strains of Epstein-Barr Virus. J Virol 28: Given, D., D. Yee, K. Griem, and E. Kieff DNA of Epstein-Barr virus. V. Direct repeats of the ends of Epstein-Barr virus DNA. J Virol 30: Glaser, S. L., and R. F. Jarrett The epidemiology of Hodgkin's disease. Baillieres Clin Haematol 9:

57 98. Glickman, J. N., J. G. Howe, and J. A. Steitz Structural analyses of EBER1 and EBER2 ribonucleoprotein particles present in Epstein-Barr virus-infected cells. J Virol 62: Gong, M., and E. Kieff Intracellular trafficking of two major Epstein-Barr virus glycoproteins, gp350/220 and gp110. J Virol 64: Gratama, J. W., M. A. Oosterveer, G. Klein, and I. Ernberg EBNA size polymorphism can be used to trace Epstein-Barr virus spread within families. J Virol 64: Gratama, J. W., M. A. Oosterveer, F. E. Zwaan, J. Lepoutre, G. Klein, and I. Ernberg Eradication of Epstein-Barr virus by allogeneic bone marrow transplantation: implications for sites of viral latency. Proc Natl Acad Sci U S A 85: Greenspan, J. S., D. Greenspan, E. T. Lennette, D. I. Abrams, M. A. Conant, V. Petersen, and U. K. Freese Replication of Epstein-Barr virus within the epithelial cells of oral "hairy" leukoplakia, an AIDS-associated lesion. N Engl J Med 313: Gregory, C. D., C. Dive, S. Henderson, C. A. Smith, G. T. Williams, J. Gordon, and A. B. Rickinson Activation of Epstein-Barr virus latent genes protects human B cells from death by apoptosis. Nature 349: Grossman, S. R., E. Johannsen, X. Tong, R. Yalamanchili, and E. Kieff The Epstein-Barr virus nuclear antigen 2 transactivator is directed to response elements by the J kappa recombination signal binding protein. Proc Natl Acad Sci U S A 91: Grundhoff, A., C. S. Sullivan, and D. Ganem A combined computational and microarray-based approach identifies novel micrornas encoded by human gamma-herpesviruses. Rna 12: Gulley, M. L., M. P. Burton, D. C. Allred, J. M. Nicholls, M. B. Amin, J. Y. Ro, and B. G. Schneider Epstein-Barr virus infection is associated with p53 accumulation in nasopharyngeal carcinoma. Hum Pathol 29: Gutsch, D. E., E. A. Holley-Guthrie, Q. Zhang, B. Stein, M. A. Blanar, A. S. Baldwin, and S. C. Kenney The bzip transactivator of Epstein-Barr virus, 41

58 BZLF1, functionally and physically interacts with the p65 subunit of NF-kappa B. Mol Cell Biol 14: Hale, G., and H. Waldmann Risks of developing Epstein-Barr virus-related lymphoproliferative disorders after T-cell-depleted marrow transplants. CAMPATH Users. Blood 91: Hamilton-Dutoit, S. J., G. Pallesen, M. B. Franzmann, J. Karkov, F. Black, P. Skinhoj, and C. Pedersen AIDS-related lymphoma. Histopathology, immunophenotype, and association with Epstein-Barr virus as demonstrated by in situ nucleic acid hybridization. Am J Pathol 138: Hammarskjold, M. L., and M. C. Simurda Epstein-Barr virus latent membrane protein transactivates the human immunodeficiency virus type 1 long terminal repeat through induction of NF-kappa B activity. J Virol 66: Harada, S., and E. Kieff Epstein-Barr virus nuclear protein LP stimulates EBNA-2 acidic domain-mediated transcriptional activation. J Virol 71: Hardwick, J. M., P. M. Lieberman, and S. D. Hayward A new Epstein-Barr virus transactivator, R, induces expression of a cytoplasmic early antigen. J Virol 62: Hardwick, J. M., L. Tse, N. Applegren, J. Nicholas, and M. A. Veliuona The Epstein-Barr virus R transactivator (Rta) contains a complex, potent activation domain with properties different from those of VP16. J Virol 66: Henderson, S., M. Rowe, C. Gregory, D. Croom-Carter, F. Wang, R. Longnecker, E. Kieff, and A. Rickinson Induction of bcl-2 expression by Epstein-Barr virus latent membrane protein 1 protects infected B cells from programmed cell death. Cell 65: Henle, G., W. Henle, and V. Diehl Relation of Burkitt's tumor-associated herpes-ytpe virus to infectious mononucleosis. Proc Natl Acad Sci U S A 59: Henle, W., V. Diehl, G. Kohn, H. Zur Hausen, and G. Henle Herpes-type virus and chromosome marker in normal leukocytes after growth with irradiated Burkitt cells. Science 157:

59 117. Henle, W., G. Henle, J. Andersson, I. Ernberg, G. Klein, C. A. Horwitz, G. Marklund, L. Rymo, C. Wellinder, and S. E. Straus Antibody responses to Epstein-Barr virus-determined nuclear antigen (EBNA)-1 and EBNA-2 in acute and chronic Epstein-Barr virus infection. Proc Natl Acad Sci U S A 84: Henle, W., G. Henle, H. C. Ho, P. Burtin, Y. Cachin, P. Clifford, A. de Schryver, G. de-the, V. Diehl, and G. Klein Antibodies to Epstein-Barr virus in nasopharyngeal carcinoma, other head and neck neoplasms, and control groups. J Natl Cancer Inst 44: Hennessy, K., S. Fennewald, M. Hummel, T. Cole, and E. Kieff A membrane protein encoded by Epstein-Barr virus in latent growth-transforming infection. Proc Natl Acad Sci U S A 81: Higuchi, M., K. M. Izumi, and E. Kieff Epstein-Barr virus latent-infection membrane proteins are palmitoylated and raft-associated: protein 1 binds to the cytoskeleton through TNF receptor cytoplasmic factors. Proc Natl Acad Sci U S A 98: Hislop, A. D., N. E. Annels, N. H. Gudgeon, A. M. Leese, and A. B. Rickinson Epitope-specific evolution of human CD8(+) T cell responses from primary to persistent phases of Epstein-Barr virus infection. J Exp Med 195: Hitt, M. M., M. J. Allday, T. Hara, L. Karran, M. D. Jones, P. Busson, T. Tursz, I. Ernberg, and B. E. Griffin EBV gene expression in an NPC-related tumour. Embo J 8: Ho, M., G. Miller, R. W. Atchison, M. K. Breinig, J. S. Dummer, W. Andiman, T. E. Starzl, R. Eastman, B. P. Griffith, R. L. Hardesty, and et al Epstein- Barr virus infections and DNA hybridization studies in posttransplantation lymphoma and lymphoproliferative lesions: the role of primary infection. J Infect Dis 152: Hong, Y., E. Holley-Guthrie, and S. Kenney The bzip dimerization domain of the Epstein-Barr virus BZLF1 (Z) protein mediates lymphoid-specific negative regulation. Virology 229: Hsieh, J. J., and S. D. Hayward Masking of the CBF1/RBPJ kappa transcriptional repression domain by Epstein-Barr virus EBNA2. Science 268:

60 126. Hsu, J. L., and S. L. Glaser Epstein-barr virus-associated malignancies: epidemiologic patterns and etiologic implications. Crit Rev Oncol Hematol 34: Imai, S., S. Koizumi, M. Sugiura, M. Tokunaga, Y. Uemura, N. Yamamoto, S. Tanaka, E. Sato, and T. Osato Gastric carcinoma: monoclonal epithelial malignant cells expressing Epstein-Barr virus latent infection protein. Proc Natl Acad Sci U S A 91: Imai, S., J. Nishikawa, and K. Takada Cell-to-cell contact as an efficient mode of Epstein-Barr virus infection of diverse human epithelial cells. J Virol 72: Israel, B. F., and S. C. Kenney Virally targeted therapies for EBV-associated malignancies. Oncogene 22: Izumi, K. M., E. D. Cahir McFarland, A. T. Ting, E. A. Riley, B. Seed, and E. D. Kieff The Epstein-Barr virus oncoprotein latent membrane protein 1 engages the tumor necrosis factor receptor-associated proteins TRADD and receptorinteracting protein (RIP) but does not induce apoptosis or require RIP for NF-kappaB activation. Mol Cell Biol 19: Izumi, K. M., and E. D. Kieff The Epstein-Barr virus oncogene product latent membrane protein 1 engages the tumor necrosis factor receptor-associated death domain protein to mediate B lymphocyte growth transformation and activate NFkappaB. Proc Natl Acad Sci U S A 94: Jenson, H. B., P. J. Farrell, and G. Miller Sequences of the Epstein-Barr Virus (EBV) large internal repeat form the center of a 16-kilobase-pair palindrome of EBV (P3HR-1) heterogeneous DNA. J Virol 61: Jenson, H. B., and G. Miller Polymorphisms of the region of the Epstein-Barr virus genome which disrupts latency. Virology 165: Jenson, H. B., M. S. Rabson, and G. Miller Palindromic structure and polypeptide expression of 36 kilobase pairs of heterogeneous Epstein-Barr virus (P3HR-1) DNA. J Virol 58: Johannsen, E., E. Koh, G. Mosialos, X. Tong, E. Kieff, and S. R. Grossman Epstein-Barr virus nuclear protein 2 transactivation of the latent membrane protein 1 promoter is mediated by J kappa and PU.1. J Virol 69:

61 136. Johannsen, E., C. L. Miller, S. R. Grossman, and E. Kieff EBNA-2 and EBNA-3C extensively and mutually exclusively associate with RBPJkappa in Epstein-Barr virus-transformed B lymphocytes. J Virol 70: Jones, J. F., S. Shurin, C. Abramowsky, R. R. Tubbs, C. G. Sciotto, R. Wahl, J. Sands, D. Gottman, B. Z. Katz, and J. Sklar T-cell lymphomas containing Epstein-Barr viral DNA in patients with chronic Epstein-Barr virus infections. N Engl J Med 318: Kanda, T., M. Yajima, N. Ahsan, M. Tanaka, and K. Takada Production of high-titer Epstein-Barr virus recombinants derived from Akata cells by using a bacterial artificial chromosome system. J Virol 78: Kanegane, H., K. Nomura, T. Miyawaki, and G. Tosato Biological aspects of Epstein-Barr virus (EBV)-infected lymphocytes in chronic active EBV infection and associated malignancies. Crit Rev Oncol Hematol 44: Katz, D. A., R. P. Baumann, R. Sun, J. L. Kolman, N. Taylor, and G. Miller Viral proteins associated with the Epstein-Barr virus transactivator, ZEBRA. Proc Natl Acad Sci U S A 89: Kawanishi, M Epstein-Barr virus induces fragmentation of chromosomal DNA during lytic infection. J Virol 67: Kaye, K. M., K. M. Izumi, and E. Kieff Epstein-Barr virus latent membrane protein 1 is essential for B-lymphocyte growth transformation. Proc Natl Acad Sci U S A 90: Kaye, K. M., K. M. Izumi, H. Li, E. Johannsen, D. Davidson, R. Longnecker, and E. Kieff An Epstein-Barr virus that expresses only the first 231 LMP1 amino acids efficiently initiates primary B-lymphocyte growth transformation. J Virol 73: Kenney, J. L., M. E. Guinness, T. Curiel, and J. Lacy Antisense to the epstein-barr virus (EBV)-encoded latent membrane protein 1 (LMP-1) suppresses LMP-1 and bcl-2 expression and promotes apoptosis in EBV-immortalized B cells. Blood 92:

62 145. Kenney, S., E. Holley-Guthrie, E. C. Mar, and M. Smith The Epstein-Barr virus BMLF1 promoter contains an enhancer element that is responsive to the BZLF1 and BRLF1 transactivators. J Virol 63: Kersten, M. J., S. de Jong, L. M. Evers, H. R. Koene, and M. H. van Oers Addition of granulocyte colony-stimulating factor to chemotherapy in patients with AIDS-related lymphoma: effects on neutrophil Fc gamma receptor expression and soluble Fc gammariii plasma levels. Br J Haematol 99: Khanna, R., P. Busson, S. R. Burrows, C. Raffoux, D. J. Moss, J. M. Nicholls, and L. Cooper Molecular characterization of antigen-processing function in nasopharyngeal carcinoma (NPC): evidence for efficient presentation of Epstein-Barr virus cytotoxic T-cell epitopes by NPC cells. Cancer Res 58: Kieff, E., and A. B. Rickinson Epstein-Barr Virus and Its Replication, p In B. N. Fields, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman, S. E. Straus, and D. M. Knipe (ed.), Field's Virology, Fourth ed, vol. 2. Lippincott Williams & Wilkins Publishers, Philadelphia, PA Kienzle, N., M. Buck, S. Greco, K. Krauer, and T. B. Sculley Epstein-Barr virus-encoded RK-BARF0 protein expression. J Virol 73: Kikuta, H., Y. Taguchi, K. Tomizawa, K. Kojima, N. Kawamura, A. Ishizaka, Y. Sakiyama, S. Matsumoto, S. Imai, T. Kinoshita, and et al Epstein-Barr virus genome-positive T lymphocytes in a boy with chronic active EBV infection associated with Kawasaki-like disease. Nature 333: Kim, O. J., and J. L. Yates Mutants of Epstein-Barr virus with a selective marker disrupting the TP gene transform B cells and replicate normally in culture. J Virol 67: Klein, G., E. Svedmyr, M. Jondal, and P. O. Persson EBV-determined nuclear antigen (EBNA)-positive cells in the peripheral blood of infectious mononucleosis patients. Int J Cancer 17: Kluiver, J., E. Haralambieva, D. de Jong, T. Blokzijl, S. Jacobs, B. J. Kroesen, S. Poppema, and A. van den Berg Lack of BIC and microrna mir-155 expression in primary cases of Burkitt lymphoma. Genes Chromosomes Cancer 45:

63 154. Krauer, K. G., N. Kienzle, D. B. Young, and T. B. Sculley Epstein-Barr nuclear antigen-3 and -4 interact with RBP-2N, a major isoform of RBP-J kappa in B lymphocytes. Virology 226: Kulwichit, W., R. H. Edwards, E. M. Davenport, J. F. Baskar, V. Godfrey, and N. Raab-Traub Expression of the Epstein-Barr virus latent membrane protein 1 induces B cell lymphoma in transgenic mice. Proc Natl Acad Sci U S A 95: Kuppers, R., and K. Rajewsky The origin of Hodgkin and Reed/Sternberg cells in Hodgkin's disease. Annu Rev Immunol 16: Kurth, J., T. Spieker, J. Wustrow, G. J. Strickler, L. M. Hansmann, K. Rajewsky, and R. Kuppers EBV-infected B cells in infectious mononucleosis: viral strategies for spreading in the B cell compartment and establishing latency. Immunity 13: Kusano, S., and N. Raab-Traub An Epstein-Barr virus protein interacts with Notch. J Virol 75: Laherty, C. D., H. M. Hu, A. W. Opipari, F. Wang, and V. M. Dixit The Epstein-Barr virus LMP1 gene product induces A20 zinc finger protein expression by activating nuclear factor kappa B. J Biol Chem 267: Lee, H. S., M. S. Chang, H. K. Yang, B. L. Lee, and W. H. Kim Epsteinbarr virus-positive gastric carcinoma has a distinct protein expression profile in comparison with epstein-barr virus-negative carcinoma. Clin Cancer Res 10: Lee, M. A., O. J. Kim, and J. L. Yates Targeted gene disruption in Epstein- Barr virus. Virology 189: Lee, S. P., A. T. Chan, S. T. Cheung, W. A. Thomas, D. CroomCarter, C. W. Dawson, C. H. Tsai, S. F. Leung, P. J. Johnson, and D. P. Huang CTL control of EBV in nasopharyngeal carcinoma (NPC): EBV-specific CTL responses in the blood and tumors of NPC patients and the antigen-processing function of the tumor cells. J Immunol 165:

64 163. Lemon, S. M., L. M. Hutt, J. E. Shaw, J. L. Li, and J. S. Pagano Replication of EBV in epithelial cells during infectious mononucleosis. Nature 268: Lemon, S. M., L. M. Hutt, J. E. Shaw, J. L. Li, and J. S. Pagano Replication of Epstein-Barr virus DNA in epithelial cells in vivo. IARC Sci Publ: Levitskaya, J., M. Coram, V. Levitsky, S. Imreh, P. M. Steigerwald-Mullen, G. Klein, M. G. Kurilla, and M. G. Masucci Inhibition of antigen processing by the internal repeat region of the Epstein-Barr virus nuclear antigen-1. Nature 375: Levitskaya, J., A. Sharipo, A. Leonchiks, A. Ciechanover, and M. G. Masucci Inhibition of ubiquitin/proteasome-dependent protein degradation by the Gly- Ala repeat domain of the Epstein-Barr virus nuclear antigen 1. Proc Natl Acad Sci U S A 94: Li, H. M., Z. H. Zhuang, Q. Wang, J. C. Pang, X. H. Wang, H. L. Wong, H. C. Feng, D. Y. Jin, M. T. Ling, Y. C. Wong, A. G. Eliopoulos, L. S. Young, D. P. Huang, and S. W. Tsao Epstein-Barr virus latent membrane protein 1 (LMP1) upregulates Id1 expression in nasopharyngeal epithelial cells. Oncogene 23: Li, Q., M. K. Spriggs, S. Kovats, S. M. Turk, M. R. Comeau, B. Nepom, and L. M. Hutt-Fletcher Epstein-Barr virus uses HLA class II as a cofactor for infection of B lymphocytes. J Virol 71: Li, Q. X., L. S. Young, G. Niedobitek, C. W. Dawson, M. Birkenbach, F. Wang, and A. B. Rickinson Epstein-Barr virus infection and replication in a human epithelial cell system. Nature 356: Liebowitz, D Epstein-Barr virus and a cellular signaling pathway in lymphomas from immunosuppressed patients. N Engl J Med 338: Liebowitz, D., R. Kopan, E. Fuchs, J. Sample, and E. Kieff An Epstein-Barr virus transforming protein associates with vimentin in lymphocytes. Mol Cell Biol 7: Liebowitz, D., D. Wang, and E. Kieff Orientation and patching of the latent infection membrane protein encoded by Epstein-Barr virus. J Virol 58:

65 173. Liu, L. T., J. P. Peng, H. C. Chang, and W. C. Hung RECK is a target of Epstein-Barr virus latent membrane protein 1. Oncogene 22: Liu, Y., R. de Waal Malefyt, F. Briere, C. Parham, J. M. Bridon, J. Banchereau, K. W. Moore, and J. Xu The EBV IL-10 homologue is a selective agonist with impaired binding to the IL-10 receptor. J Immunol 158: Longnecker, R Epstein-Barr virus latency: LMP2, a regulator or means for Epstein-Barr virus persistence? Adv Cancer Res 79: Longnecker, R., B. Druker, T. M. Roberts, and E. Kieff An Epstein-Barr virus protein associated with cell growth transformation interacts with a tyrosine kinase. J Virol 65: Longnecker, R., C. L. Miller, X. Q. Miao, A. Marchini, and E. Kieff The only domain which distinguishes Epstein-Barr virus latent membrane protein 2A (LMP2A) from LMP2B is dispensable for lymphocyte infection and growth transformation in vitro; LMP2A is therefore nonessential. J Virol 66: Longnecker, R., C. L. Miller, X. Q. Miao, B. Tomkinson, and E. Kieff The last seven transmembrane and carboxy-terminal cytoplasmic domains of Epstein-Barr virus latent membrane protein 2 (LMP2) are dispensable for lymphocyte infection and growth transformation in vitro. J Virol 67: Longnecker, R., C. L. Miller, B. Tomkinson, X. Q. Miao, and E. Kieff Deletion of DNA encoding the first five transmembrane domains of Epstein-Barr virus latent membrane proteins 2A and 2B. J Virol 67: Lu, S. J., N. E. Day, L. Degos, V. Lepage, P. C. Wang, S. H. Chan, M. Simons, B. McKnight, D. Easton, Y. Zeng, and et al Linkage of a nasopharyngeal carcinoma susceptibility locus to the HLA region. Nature 346: Mackett, M., M. J. Conway, J. R. Arrand, R. S. Haddad, and L. M. Hutt- Fletcher Characterization and expression of a glycoprotein encoded by the Epstein-Barr virus BamHI I fragment. J Virol 64: MacMahon, E. M., J. D. Glass, S. D. Hayward, R. B. Mann, P. S. Becker, P. Charache, J. C. McArthur, and R. F. Ambinder Epstein-Barr virus in AIDS-related primary central nervous system lymphoma. Lancet 338:

66 183. Maeda, A., H. Wakiguchi, W. Yokoyama, H. Hisakawa, T. Tomoda, and T. Kurashige Persistently high Epstein-Barr virus (EBV) loads in peripheral blood lymphocytes from patients with chronic active EBV infection. J Infect Dis 179: Magrath, I The pathogenesis of Burkitt's lymphoma. Adv Cancer Res 55: Mann, K. P., D. Staunton, and D. A. Thorley-Lawson Epstein-Barr virusencoded protein found in plasma membranes of transformed cells. J Virol 55: Mann, K. P., and D. Thorley-Lawson Posttranslational processing of the Epstein-Barr virus-encoded p63/lmp protein. J Virol 61: Mannick, J. B., J. I. Cohen, M. Birkenbach, A. Marchini, and E. Kieff The Epstein-Barr virus nuclear protein encoded by the leader of the EBNA RNAs is important in B-lymphocyte transformation. J Virol 65: Marchini, A., J. I. Cohen, F. Wang, and E. Kieff A selectable marker allows investigation of a nontransforming Epstein-Barr virus mutant. J Virol 66: Marchini, A., E. Kieff, and R. Longnecker Marker rescue of a transformation-negative Epstein-Barr virus recombinant from an infected Burkitt lymphoma cell line: a method useful for analysis of genes essential for transformation. J Virol 67: Marshall, D., and C. Sample Epstein-Barr virus nuclear antigen 3C is a transcriptional regulator. J Virol 69: Martin, J. M., D. Veis, S. J. Korsmeyer, and B. Sugden Latent membrane protein of Epstein-Barr virus induces cellular phenotypes independently of expression of Bcl-2. J Virol 67: Miller, N., and L. M. Hutt-Fletcher Epstein-Barr virus enters B cells and epithelial cells by different routes. J Virol 66: Miller, W. E., J. L. Cheshire, and N. Raab-Traub Interaction of tumor necrosis factor receptor-associated factor signaling proteins with the latent membrane 50

67 protein 1 PXQXT motif is essential for induction of epidermal growth factor receptor expression. Mol Cell Biol 18: Miller, W. E., H. S. Earp, and N. Raab-Traub The Epstein-Barr virus latent membrane protein 1 induces expression of the epidermal growth factor receptor. J Virol 69: Miller, W. E., R. H. Edwards, D. M. Walling, and N. Raab-Traub Sequence variation in the Epstein-Barr virus latent membrane protein 1. J Gen Virol 75 ( Pt 10): Miyashita, E. M., B. Yang, G. J. Babcock, and D. A. Thorley-Lawson Identification of the site of Epstein-Barr virus persistence in vivo as a resting B cell. J Virol 71: Molesworth, S. J., C. M. Lake, C. M. Borza, S. M. Turk, and L. M. Hutt- Fletcher Epstein-Barr virus gh is essential for penetration of B cells but also plays a role in attachment of virus to epithelial cells. J Virol 74: Moore, M. D., R. G. DiScipio, N. R. Cooper, and G. R. Nemerow Hydrodynamic, electron microscopic, and ligand-binding analysis of the Epstein-Barr virus/c3dg receptor (CR2). J Biol Chem 264: Moorthy, R., and D. A. Thorley-Lawson Processing of the Epstein-Barr virus-encoded latent membrane protein p63/lmp. J Virol 64: Moorthy, R. K., and D. A. Thorley-Lawson Biochemical, genetic, and functional analyses of the phosphorylation sites on the Epstein-Barr virus-encoded oncogenic latent membrane protein LMP-1. J Virol 67: Morrison, J. A., A. J. Klingelhutz, and N. Raab-Traub Epstein-Barr virus latent membrane protein 2A activates beta-catenin signaling in epithelial cells. J Virol 77: Morrison, J. A., and N. Raab-Traub Roles of the ITAM and PY motifs of Epstein-Barr virus latent membrane protein 2A in the inhibition of epithelial cell differentiation and activation of {beta}-catenin signaling. J Virol 79:

68 203. Morrison, T. E., A. Mauser, A. Wong, J. P. Ting, and S. C. Kenney Inhibition of IFN-gamma signaling by an Epstein-Barr virus immediate-early protein. Immunity 15: Mosialos, G., M. Birkenbach, R. Yalamanchili, T. VanArsdale, C. Ware, and E. Kieff The Epstein-Barr virus transforming protein LMP1 engages signaling proteins for the tumor necrosis factor receptor family. Cell 80: Murray, R. J., M. G. Kurilla, J. M. Brooks, W. A. Thomas, M. Rowe, E. Kieff, and A. B. Rickinson Identification of target antigens for the human cytotoxic T cell response to Epstein-Barr virus (EBV): implications for the immune control of EBV-positive malignancies. J Exp Med 176: Nemerow, G. R., R. Wolfert, M. E. McNaughton, and N. R. Cooper Identification and characterization of the Epstein-Barr virus receptor on human B lymphocytes and its relationship to the C3d complement receptor (CR2). J Virol 55: Nicholls, J. M., A. Agathanggelou, K. Fung, X. Zeng, and G. Niedobitek The association of squamous cell carcinomas of the nasopharynx with Epstein-Barr virus shows geographical variation reminiscent of Burkitt's lymphoma. J Pathol 183: Niedobitek, G., A. Agathanggelou, H. Herbst, L. Whitehead, D. H. Wright, and L. S. Young Epstein-Barr virus (EBV) infection in infectious mononucleosis: virus latency, replication and phenotype of EBV-infected cells. J Pathol 182: Niedobitek, G., L. S. Young, R. Lau, L. Brooks, D. Greenspan, J. S. Greenspan, and A. B. Rickinson Epstein-Barr virus infection in oral hairy leukoplakia: virus replication in the absence of a detectable latent phase. J Gen Virol 72 ( Pt 12): Nishikawa, J., S. Imai, T. Oda, T. Kojima, K. Okita, and K. Takada Epstein-Barr virus promotes epithelial cell growth in the absence of EBNA2 and LMP1 expression. J Virol 73: Nitsche, F., A. Bell, and A. Rickinson Epstein-Barr virus leader protein enhances EBNA-2-mediated transactivation of latent membrane protein 1 expression: a role for the W1W2 repeat domain. J Virol 71:

69 212. Oda, T., S. Imai, S. Chiba, and K. Takada Epstein-Barr virus lacking glycoprotein gp85 cannot infect B cells and epithelial cells. Virology 276: Ohno, S., J. Luka, T. Lindahl, and G. Klein Identification of a purified complement-fixing antigen as the Epstein-Barr-virus determined nuclear antigen (EBNA) by its binding to metaphase chromosomes. Proc Natl Acad Sci U S A 74: Okano, M., S. Matsumoto, T. Osato, Y. Sakiyama, G. M. Thiele, and D. T. Purtilo Severe chronic active Epstein-Barr virus infection syndrome. Clin Microbiol Rev 4: Old, L. J., and E. A. Boyse Specific antigens of tumors and leukemias of experimental animals. Med Clin North Am 50: Packham, G., M. Brimmell, D. Cook, A. J. Sinclair, and P. J. Farrell Strain variation in Epstein-Barr virus immediate early genes. Virology 192: Paine, E., R. I. Scheinman, A. S. Baldwin, Jr., and N. Raab-Traub Expression of LMP1 in epithelial cells leads to the activation of a select subset of NFkappa B/Rel family proteins. J Virol 69: Palefsky, J. M., J. Berline, M. E. Penaranda, E. T. Lennette, D. Greenspan, and J. S. Greenspan Sequence variation of latent membrane protein-1 of Epstein- Barr virus strains associated with hairy leukoplakia. J Infect Dis 173: Papworth, M. A., A. A. Van Dijk, G. R. Benyon, T. D. Allen, J. R. Arrand, and M. Mackett The processing, transport and heterologous expression of Epstein- Barr virus gp110. J Gen Virol 78 ( Pt 9): Parker, G. A., T. Crook, M. Bain, E. A. Sara, P. J. Farrell, and M. J. Allday Epstein-Barr virus nuclear antigen (EBNA)3C is an immortalizing oncoprotein with similar properties to adenovirus E1A and papillomavirus E7. Oncogene 13: Parker, G. A., R. Touitou, and M. J. Allday Epstein-Barr virus EBNA3C can disrupt multiple cell cycle checkpoints and induce nuclear division divorced from cytokinesis. Oncogene 19:

70 222. Pathmanathan, R., U. Prasad, G. Chandrika, R. Sadler, K. Flynn, and N. Raab- Traub Undifferentiated, nonkeratinizing, and squamous cell carcinoma of the nasopharynx. Variants of Epstein-Barr virus-infected neoplasia. Am J Pathol 146: Pathmanathan, R., U. Prasad, R. Sadler, K. Flynn, and N. Raab-Traub Clonal proliferations of cells infected with Epstein-Barr virus in preinvasive lesions related to nasopharyngeal carcinoma. N Engl J Med 333: Peng, R., J. Tan, and P. D. Ling Conserved regions in the Epstein-Barr virus leader protein define distinct domains required for nuclear localization and transcriptional cooperation with EBNA2. J Virol 74: Pfeffer, S., M. Zavolan, F. A. Grasser, M. Chien, J. J. Russo, J. Ju, B. John, A. J. Enright, D. Marks, C. Sander, and T. Tuschl Identification of virus-encoded micrornas. Science 304: Piche, A., K. Kasono, F. Johanning, T. J. Curiel, and D. T. Curiel Phenotypic knock-out of the latent membrane protein 1 of Epstein-Barr virus by an intracellular single-chain antibody. Gene Ther 5: Pope, J. H., B. G. Achong, M. A. Epstein, and J. Biddulph Burkitt lymphoma in New Guinea: establishment of a line of lymphoblasts in vitro and description of their fine structure. J Natl Cancer Inst 39: Poppema, S., and A. van den Berg Interaction between host T cells and Reed-Sternberg cells in Hodgkin lymphomas. Semin Cancer Biol 10: Pritchett, R. F., S. D. Hayward, and E. D. Kieff DNA of Epstein-Barr virus. I. Comparative studies of the DNA of Epstein-Barr virus from HR-1 and B95-8 cells: size, structure, and relatedness. J Virol 15: Purtilo, D. T., C. K. Cassel, J. P. Yang, and R. Harper X-linked recessive progressive combined variable immunodeficiency (Duncan's disease). Lancet 1: Raab-Traub, N Epstein-Barr virus in the pathogenesis of NPC. Semin Cancer Biol 12:

71 232. Raab-Traub, N., T. Dambaugh, and E. Kieff DNA of Epstein-Barr virus VIII: B95-8, the previous prototype, is an unusual deletion derivative. Cell 22: Raab-Traub, N., and K. Flynn The structure of the termini of the Epstein- Barr virus as a marker of clonal cellular proliferation. Cell 47: Raab-Traub, N., R. Pritchett, and E. Kieff DNA of Epstein-Barr virus. III. Identification of restriction enzyme fragments that contain DNA sequences which differ among strains of Epstein-Barr virus. J Virol 27: Rabson, M., L. Gradoville, L. Heston, and G. Miller Non-immortalizing P3J-HR-1 Epstein-Barr virus: a deletion mutant of its transforming parent, Jijoye. J Virol 44: Reedman, B. M., and G. Klein Cellular localization of an Epstein-Barr virus (EBV)-associated complement-fixing antigen in producer and non-producer lymphoblastoid cell lines. Int J Cancer 11: Rickinson, A. B., and E. Kieff Epstein-Barr Virus, p In B. N. Fields, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman, S. E. Straus, and D. M. Knipe (ed.), Fields Virology, Fourth ed, vol. 2. Lippincott Williams & Wilkins Publishers, Philadelphia, PA Roberts, M. L., and N. R. Cooper Activation of a ras-mapk-dependent pathway by Epstein-Barr virus latent membrane protein 1 is essential for cellular transformation. Virology 240: Robertson, E., and E. Kieff Reducing the complexity of the transforming Epstein-Barr virus genome to 64 kilobase pairs. J Virol 69: Robertson, E. S Epstein-Barr virus. Caister Academic Press, Wymondham, Norfolk, England Robertson, E. S., J. Lin, and E. Kieff The amino-terminal domains of Epstein-Barr virus nuclear proteins 3A, 3B, and 3C interact with RBPJ(kappa). J Virol 70:

72 242. Robertson, E. S., B. Tomkinson, and E. Kieff An Epstein-Barr virus with a 58-kilobase-pair deletion that includes BARF0 transforms B lymphocytes in vitro. J Virol 68: Rooney, C. M., C. A. Smith, C. Y. Ng, S. Loftin, C. Li, R. A. Krance, M. K. Brenner, and H. E. Heslop Use of gene-modified virus-specific T lymphocytes to control Epstein-Barr-virus-related lymphoproliferation. Lancet 345: Rovedo, M., and R. Longnecker Epstein-barr virus latent membrane protein 2B (LMP2B) modulates LMP2A activity. J Virol 81: Rowe, M., M. Peng-Pilon, D. S. Huen, R. Hardy, D. Croom-Carter, E. Lundgren, and A. B. Rickinson Upregulation of bcl-2 by the Epstein-Barr virus latent membrane protein LMP1: a B-cell-specific response that is delayed relative to NFkappa B activation and to induction of cell surface markers. J Virol 68: Ruf, I. K., P. W. Rhyne, C. Yang, J. L. Cleveland, and J. T. Sample Epstein-Barr virus small RNAs potentiate tumorigenicity of Burkitt lymphoma cells independently of an effect on apoptosis. J Virol 74: Sadler, R. H., and N. Raab-Traub The Epstein-Barr virus 3.5-kilobase latent membrane protein 1 mrna initiates from a TATA-Less promoter within the first terminal repeat. J Virol 69: Sadler, R. H., and N. Raab-Traub Structural analyses of the Epstein-Barr virus BamHI A transcripts. J Virol 69: Saito, N., G. Courtois, A. Chiba, N. Yamamoto, T. Nitta, N. Hironaka, M. Rowe, and S. Yamaoka Two carboxyl-terminal activation regions of Epstein-Barr virus latent membrane protein 1 activate NF-kappaB through distinct signaling pathways in fibroblast cell lines. J Biol Chem 278: Sample, J., E. B. Henson, and C. Sample The Epstein-Barr virus nuclear protein 1 promoter active in type I latency is autoregulated. J Virol 66: Sample, J., M. Hummel, D. Braun, M. Birkenbach, and E. Kieff Nucleotide sequences of mrnas encoding Epstein-Barr virus nuclear proteins: a probable transcriptional initiation site. Proc Natl Acad Sci U S A 83:

73 252. Savard, M., C. Belanger, M. Tardif, P. Gourde, L. Flamand, and J. Gosselin Infection of primary human monocytes by Epstein-Barr virus. J Virol 74: Sbih-Lammali, F., B. Clausse, H. Ardila-Osorio, R. Guerry, M. Talbot, S. Havouis, L. Ferradini, J. Bosq, T. Tursz, and P. Busson Control of apoptosis in Epstein Barr virus-positive nasopharyngeal carcinoma cells: opposite effects of CD95 and CD40 stimulation. Cancer Res 59: Schepers, A., D. Pich, and W. Hammerschmidt A transcription factor with homology to the AP-1 family links RNA transcription and DNA replication in the lytic cycle of Epstein-Barr virus. Embo J 12: Schneider, B. G., M. L. Gulley, P. Eagan, J. C. Bravo, R. Mera, and J. Geradts Loss of p16/cdkn2a tumor suppressor protein in gastric adenocarcinoma is associated with Epstein-Barr virus and anatomic location in the body of the stomach. Hum Pathol 31: Scholle, F., K. M. Bendt, and N. Raab-Traub Epstein-Barr virus LMP2A transforms epithelial cells, inhibits cell differentiation, and activates Akt. J Virol 74: Scholle, F., R. Longnecker, and N. Raab-Traub Epithelial cell adhesion to extracellular matrix proteins induces tyrosine phosphorylation of the Epstein-Barr virus latent membrane protein 2: a role for C-terminal Src kinase. J Virol 73: Schwarzmann, F., R. von Baehr, M. Jager, N. Prang, S. Bohm, U. Reischl, H. Wolf, and W. P. Bieger A case of severe chronic active infection with Epstein-Barr virus: immunologic deficiencies associated with a lytic virus strain. Clin Infect Dis 29: Sharipo, A., M. Imreh, A. Leonchiks, S. Imreh, and M. G. Masucci A minimal glycine-alanine repeat prevents the interaction of ubiquitinated I kappab alpha with the proteasome: a new mechanism for selective inhibition of proteolysis. Nat Med 4: Sheng, W., G. Decaussin, S. Sumner, and T. Ooka N-terminal domain of BARF1 gene encoded by Epstein-Barr virus is essential for malignant transformation of rodent fibroblasts and activation of BCL-2. Oncogene 20:

74 261. Shibata, D., and L. M. Weiss Epstein-Barr virus-associated gastric adenocarcinoma. Am J Pathol 140: Sitki-Green, D., M. Covington, and N. Raab-Traub Compartmentalization and transmission of multiple epstein-barr virus strains in asymptomatic carriers. J Virol 77: Sitki-Green, D., R. H. Edwards, J. Webster-Cyriaque, and N. Raab-Traub Identification of Epstein-Barr virus strain variants in hairy leukoplakia and peripheral blood by use of a heteroduplex tracking assay. J Virol 76: Sitki-Green, D. L., R. H. Edwards, M. M. Covington, and N. Raab-Traub Biology of Epstein-Barr virus during infectious mononucleosis. J Infect Dis 189: Sixbey, J. W., J. G. Nedrud, N. Raab-Traub, R. A. Hanes, and J. S. Pagano Epstein-Barr virus replication in oropharyngeal epithelial cells. N Engl J Med 310: Sixbey, J. W., E. H. Vesterinen, J. G. Nedrud, N. Raab-Traub, L. A. Walton, and J. S. Pagano Replication of Epstein-Barr virus in human epithelial cells infected in vitro. Nature 306: Sixbey, J. W., and Q. Y. Yao Immunoglobulin A-induced shift of Epstein- Barr virus tissue tropism. Science 255: Smith, P. R., O. de Jesus, D. Turner, M. Hollyoake, C. E. Karstegl, B. E. Griffin, L. Karran, Y. Wang, S. D. Hayward, and P. J. Farrell Structure and coding content of CST (BART) family RNAs of Epstein-Barr virus. J Virol 74: Starzl, T. E., M. A. Nalesnik, K. A. Porter, M. Ho, S. Iwatsuki, B. P. Griffith, J. T. Rosenthal, T. R. Hakala, B. W. Shaw, Jr., R. L. Hardesty, and et al Reversibility of lymphomas and lymphoproliferative lesions developing under cyclosporin-steroid therapy. Lancet 1: Steven, N. M., N. E. Annels, A. Kumar, A. M. Leese, M. G. Kurilla, and A. B. Rickinson Immediate early and early lytic cycle proteins are frequent targets of the Epstein-Barr virus-induced cytotoxic T cell response. J Exp Med 185:

75 271. Strang, G., and A. B. Rickinson Multiple HLA class I-dependent cytotoxicities constitute the "non-hla-restricted" response in infectious mononucleosis. Eur J Immunol 17: Sun, Y., A. Hildesheim, A. E. Lanier, Y. Cao, K. T. Yao, N. Raab-Traub, and C. S. Yang No point mutation but decreased expression of the p16/mts1 tumor suppressor gene in nasopharyngeal carcinomas. Oncogene 10: Svedmyr, E., I. Ernberg, J. Seeley, O. Weiland, G. Masucci, K. Tsukuda, R. Szigeti, M. G. Masucci, H. Blomogren, and W. Berthold Virologic, immunologic, and clinical observations on a patient during the incubation, acute, and convalescent phases of infectious mononucleosis. Clin Immunol Immunopathol 30: Swaminathan, S., B. Tomkinson, and E. Kieff Recombinant Epstein-Barr virus with small RNA (EBER) genes deleted transforms lymphocytes and replicates in vitro. Proc Natl Acad Sci U S A 88: Szekely, L., F. Chen, N. Teramoto, B. Ehlin-Henriksson, K. Pokrovskaja, A. Szeles, A. Manneborg-Sandlund, M. Lowbeer, E. T. Lennette, and G. Klein Restricted expression of Epstein-Barr virus (EBV)-encoded, growth transformation-associated antigens in an EBV- and human herpesvirus type 8- carrying body cavity lymphoma line. J Gen Virol 79 ( Pt 6): Takada, K., and A. Nanbo The role of EBERs in oncogenesis. Semin Cancer Biol 11: Takada, K., and Y. Ono Synchronous and sequential activation of latently infected Epstein-Barr virus genomes. J Virol 63: Tanner, J., J. Weis, D. Fearon, Y. Whang, and E. Kieff Epstein-Barr virus gp350/220 binding to the B lymphocyte C3d receptor mediates adsorption, capping, and endocytosis. Cell 50: Thomas, J. A., N. A. Hotchin, M. J. Allday, P. Amlot, M. Rose, M. Yacoub, and D. H. Crawford Immunohistology of Epstein-Barr virus-associated antigens in B cell disorders from immunocompromised individuals. Transplantation 49:

76 280. Thorley-Lawson, D. A Epstein-Barr virus: exploiting the immune system. Nat Rev Immunol 1: Thorley-Lawson, D. A., and C. M. Edson Polypeptides of the Epstein-Barr virus membrane antigen complex. J Virol 32: Thorley-Lawson, D. A., and K. Geilinger Monoclonal antibodies against the major glycoprotein (gp350/220) of Epstein-Barr virus neutralize infectivity. Proc Natl Acad Sci U S A 77: Thorley-Lawson, D. A., and C. A. Poodry Identification and isolation of the main component (gp350-gp220) of Epstein-Barr virus responsible for generating neutralizing antibodies in vivo. J Virol 43: Thornburg, N. J., S. Kusano, and N. Raab-Traub Identification of Epstein- Barr virus RK-BARF0-interacting proteins and characterization of expression pattern. J Virol 78: Thornburg, N. J., R. Pathmanathan, and N. Raab-Traub Activation of nuclear factor-kappab p50 homodimer/bcl-3 complexes in nasopharyngeal carcinoma. Cancer Res 63: Tierney, R. J., N. Steven, L. S. Young, and A. B. Rickinson Epstein-Barr virus latency in blood mononuclear cells: analysis of viral gene transcription during primary infection and in the carrier state. J Virol 68: Tokunaga, M., C. E. Land, Y. Uemura, T. Tokudome, S. Tanaka, and E. Sato Epstein-Barr virus in gastric carcinoma. Am J Pathol 143: Tomkinson, B., and E. Kieff Second-site homologous recombination in Epstein-Barr virus: insertion of type 1 EBNA 3 genes in place of type 2 has no effect on in vitro infection. J Virol 66: Tomkinson, B., E. Robertson, and E. Kieff Epstein-Barr virus nuclear proteins EBNA-3A and EBNA-3C are essential for B-lymphocyte growth transformation. J Virol 67:

77 290. Trivedi, P., M. G. Masucci, G. Winberg, and G. Klein The epstein-barrvirus-encoded membrane protein LMP but not the nuclear antigen EBNA-1 induces rejection of transfected murine mammary carcinoma cells. Int J Cancer 48: Tugizov, S. M., J. W. Berline, and J. M. Palefsky Epstein-Barr virus infection of polarized tongue and nasopharyngeal epithelial cells. Nat Med 9: Waltzer, L., M. Perricaudet, A. Sergeant, and E. Manet Epstein-Barr virus EBNA3A and EBNA3C proteins both repress RBP-J kappa-ebna2-activated transcription by inhibiting the binding of RBP-J kappa to DNA. J Virol 70: Wan, J., W. Zhang, L. Wu, T. Bai, M. Zhang, K. W. Lo, Y. L. Chui, Y. Cui, Q. Tao, M. Yamamoto, S. Akira, and Z. Wu BS69, a specific adaptor in the latent membrane protein 1-mediated c-jun N-terminal kinase pathway. Mol Cell Biol 26: Wang, D., D. Liebowitz, and E. Kieff An EBV membrane protein expressed in immortalized lymphocytes transforms established rodent cells. Cell 43: Wang, F., C. Gregory, C. Sample, M. Rowe, D. Liebowitz, R. Murray, A. Rickinson, and E. Kieff Epstein-Barr virus latent membrane protein (LMP1) and nuclear proteins 2 and 3C are effectors of phenotypic changes in B lymphocytes: EBNA-2 and LMP1 cooperatively induce CD23. J Virol 64: Wang, F., H. Kikutani, S. F. Tsang, T. Kishimoto, and E. Kieff Epstein- Barr virus nuclear protein 2 transactivates a cis-acting CD23 DNA element. J Virol 65: Wang, F., A. Marchini, and E. Kieff Epstein-Barr virus (EBV) recombinants: use of positive selection markers to rescue mutants in EBV-negative B-lymphoma cells. J Virol 65: Webster-Cyriaque, J., J. Middeldorp, and N. Raab-Traub Hairy leukoplakia: an unusual combination of transforming and permissive Epstein-Barr virus infections. J Virol 74: Weiss, L. M., and L. A. Movahed In situ demonstration of Epstein-Barr viral genomes in viral-associated B cell lymphoproliferations. Am J Pathol 134:

78 300. Weiss, L. M., L. A. Movahed, R. A. Warnke, and J. Sklar Detection of Epstein-Barr viral genomes in Reed-Sternberg cells of Hodgkin's disease. N Engl J Med 320: Weiss, L. M., J. G. Strickler, R. A. Warnke, D. T. Purtilo, and J. Sklar Epstein-Barr viral DNA in tissues of Hodgkin's disease. Am J Pathol 129: Wilson, J. B., W. Weinberg, R. Johnson, S. Yuspa, and A. J. Levine Expression of the BNLF-1 oncogene of Epstein-Barr virus in the skin of transgenic mice induces hyperplasia and aberrant expression of keratin 6. Cell 61: Yalamanchili, R., X. Tong, S. Grossman, E. Johannsen, G. Mosialos, and E. Kieff Genetic and biochemical evidence that EBNA 2 interaction with a 63- kda cellular GTG-binding protein is essential for B lymphocyte growth transformation by EBV. Virology 204: Yates, J., N. Warren, D. Reisman, and B. Sugden A cis-acting element from the Epstein-Barr viral genome that permits stable replication of recombinant plasmids in latently infected cells. Proc Natl Acad Sci U S A 81: Yates, J. L., N. Warren, and B. Sugden Stable replication of plasmids derived from Epstein-Barr virus in various mammalian cells. Nature 313: Yoshiyama, H., S. Imai, N. Shimizu, and K. Takada Epstein-Barr virus infection of human gastric carcinoma cells: implication of the existence of a new virus receptor different from CD21. J Virol 71: Young, L., C. Alfieri, K. Hennessy, H. Evans, C. O'Hara, K. C. Anderson, J. Ritz, R. S. Shapiro, A. Rickinson, E. Kieff, and J. Cohen Expression of Epstein-Barr virus transformation-associated genes in tissues of patients with EBV lymphoproliferative disease. N Engl J Med 321: Young, L. S., and A. B. Rickinson Epstein-Barr virus: 40 years on. Nat Rev Cancer 4: Yu, M. C., and J. M. Yuan Epidemiology of nasopharyngeal carcinoma. Semin Cancer Biol 12:

79 310. Zhang, J., H. Chen, G. Weinmaster, and S. D. Hayward Epstein-Barr virus BamHi-a rightward transcript-encoded RPMS protein interacts with the CBF1- associated corepressor CIR to negatively regulate the activity of EBNA2 and NotchIC. J Virol 75: Zhang, Q., L. Brooks, P. Busson, F. Wang, D. Charron, E. Kieff, A. B. Rickinson, and T. Tursz Epstein-Barr virus (EBV) latent membrane protein 1 increases HLA class II expression in an EBV-negative B cell line. Eur J Immunol 24: Zhao, B., D. R. Marshall, and C. E. Sample A conserved domain of the Epstein-Barr virus nuclear antigens 3A and 3C binds to a discrete domain of Jkappa. J Virol 70: Zhao, B., and C. E. Sample Epstein-barr virus nuclear antigen 3C activates the latent membrane protein 1 promoter in the presence of Epstein-Barr virus nuclear antigen 2 through sequences encompassing an spi-1/spi-b binding site. J Virol 74: Zur Hausen, A., B. P. van Rees, J. van Beek, M. E. Craanen, E. Bloemena, G. J. Offerhaus, C. J. Meijer, and A. J. van den Brule Epstein-Barr virus in gastric carcinomas and gastric stump carcinomas: a late event in gastric carcinogenesis. J Clin Pathol 57:

80 CHAPTER TWO EPSTEIN-BARR VIRUS LATENT MEMBRANE PROTEIN CTAR1 MEDIATES RODENT AND HUMAN FIBROBLAST TRANSFORMATION THROUGH ACTIVATION OF PI3K Bernardo A. Mainou, David N. Everly Jr., and Nancy Raab-Traub This work was originally published in Oncogene (2005), 24:

81 ABSTRACT Epstein-Barr Virus (EBV) is a ubiquitous herpesvirus associated with a variety of malignancies including nasopharyngeal carcinoma (NPC). The EBV-encoded latent membrane protein 1 (LMP1) is considered the EBV oncogene as it is necessary for EBVinduced B-lymphocyte transformation and has been shown to transform rodent fibroblasts. LMP1 contains two signaling domains, the carboxy-terminal activating region 1 and 2 (CTAR 1 and CTAR2), by which NFκB, phosphatidylinositol 3-kinase (PI3K), mitogen-activated protein kinase (MAP kinase), and c-jun N-terminal kinase (JNK) are activated. In this study, the role of CTAR1 and CTAR2 in LMP1-mediated transformation of rodent fibroblasts was analyzed. CTAR1 was found to be necessary for rodent fibroblast transformation whereas CTAR2 was dispensable. Activation of the PI3K pathway in Rat-1 cells by LMP1 and LMP1-CTAR1 in transformed cells resulted in phosphorylated Akt and phosphorylated glycogen synthase kinase 3β (GSK3β). The role of PI3K and NFκB activation in LMP1-mediated transformation was further analyzed using the chemical inhibitors LY and BAY LY inhibited CTAR1-induced focus formation and anchorage-independent growth whereas BAY did not inhibit focus formation or anchorage-independent growth. Similar studies in human fibroblasts confirmed that LMP1-CTAR1 also mediates aberrant growth, phosphorylation of Akt, and decreased levels of p27. These findings indicate that LMP1-mediated rodent fibroblast transformation is dependent upon activation of PI3K and Akt and is independent of activation of NFκB. INTRODUCTION 65

82 Epstein-Barr virus (EBV) is a ubiquitous herpesvirus that is commonly associated with a variety of malignancies including nasopharyngeal carcinoma (NPC), posttransplant lymphoma, Hodgkin s disease, and others (20, 35, 44). The EBV encoded latent membrane protein 1 (LMP1) is considered the EBV oncogene as it is essential for EBV-induced B-lymphocyte transformation (18) and transforms NIH3T3 and Rat-1 fibroblasts (2, 20, 43). LMP1 is frequently expressed in EBV-induced malignancies including Hodgkin s lymphoma and nasopharyngeal carcinoma (11, 44). LMP1 contains 386 amino acids, with a short 23 amino acid amino-terminal cytoplasmic tail, a transmembrane domain, and a long carboxy-terminal tail that contains two signaling domains, carboxy-terminal activating region (CTAR) 1 and 2. Through self clustering in the membrane LMP1 acts as a constitutively active tumor necrosis factor receptor (TNFR), mediating signaling by directly interacting with TNFRassociated factors (TRAF) through CTAR1, as well as by interacting with TNFRassociated death domain (TRADD) through CTAR2 (15, 31). Signaling through the CTAR domains activates a variety of signaling pathways including NFκB, the mitogenactivated protein kinase (MAP kinase), c-jun N-terminal kinase (JNK), and phosphatidylinositol 3-kinase (PI3K). (4, 8, 16, 32, 37). CTAR1 and CTAR2 have differing effects in the activation of various signaling pathways. CTAR2 is not required for EBV-mediated B-lymphocyte transformation, has stronger NFκB activity in reporter assays and can induce JNK signaling (8, 17). CTAR1 is necessary for B-lymphocyte transformation by EBV (15). CTAR1 also has unique effects in cellular gene expression as it is required for induction of EGFR and TRAF1 expression, has recently been shown to activate PI3K (4, 5, 26, 27), decreases levels of 66

83 p27/kip (10), and activates distinct forms of NFκB including p50/p50 and p50/p52 dimers (25, 42). In this report the role of CTAR1 and CTAR2 in LMP1-mediated transformation in rat and human fibroblasts as well as the role of NFκB and PI3K-signaling in LMP1- mediated transformation was analyzed. CTAR1 was required for transformation of Rat-1 cells as analyzed by loss of contact inhibition as well as anchorage independent growth while CTAR2 was dispensable. CTAR1, but not CTAR2, was required for phosphorylation of the PI3K target Akt as well as the Akt kinase target glycogen synthase kinase 3β (GSK3β). Inhibition of PI3K signaling with LY blocked CTAR1- mediated focus formation and anchorage-independent growth, while the NFκB inhibitor BAY did not inhibit focus formation or anchorage-independent growth. In human embryo lung (HEL) fibroblasts CTAR1 was also necessary for inducing aberrant growth, phosphorylation of Akt, and decreasing p27 levels. These data indicate that in both human and rat cells signaling from CTAR1 induces the activity of PI3K and that this property affects growth regulation in fibroblasts. RESULTS CTAR1 is required for focus formation. To determine the contribution of the two primary domains of LMP1 in cellular transformation, focus formation in Rat-1 cells was assessed by retroviral transduction with vector control (pbabe), HA-tagged full-length LMP1 (LMP1), HA-tagged LMP1 deleted for CTAR2 (1-231), and HA-tagged LMP1 deleted for CTAR1 (del ). Cells were analyzed for focus formation (Figure 1) using phase contrast (left and middle 67

84 panels) and immunofluorescent microscopy for expression of LMP1 using anti-ha antibody (right panel). Focus formation was only observed in cells transduced with LMP1 and but not pbabe or del transduced cells. Examination of the cells at low magnification after crystal violet staining indicated that the number of foci were relatively equivalent between LMP1 and although foci formed by LMP1 were larger than those observed with Foci formation was correspondingly decreased by serial dilutions of LMP1 and (data not shown). Phase Contrast Phase Contrast αha del LMP1 pbabe Figure 1. LMP1 and LMP1 CTAR1 block contact-inhibited growth in Rat1 cells. Rat-1 fibroblasts were transduced with pbabe, LMP1, 1-231, or del retrovirus, incubated for days, stained with crystal violet observed with phase contrast at 10X magnification (left panel), observed for focus formation with phase contrast at 50X magnification (center panel) and the same field under immunofluorescence microscopy using anti-ha antibody (right panel). 68

85 Immunofluorescence staining for LMP1 and revealed that expression was restricted to foci indicating that all cells that were transduced and expressed LMP1 formed foci. However, cells transduced with del revealed a diffuse staining pattern indicating transduction and protein expression without focus formation. Vectortransduced cells did not form foci and were negative for staining. Western blot analysis of parallel-transduced cells confirmed expression of LMP1 and LMP1 deletion mutants (data not shown). These data indicate that CTAR1 is necessary for LMP1-mediated repression of contact inhibition whereas CTAR2 is dispensable. CTAR1 induces phosphorylation of the PI3K targets Akt and GSK3β As CTAR1 and CTAR2 have been shown to activate distinct signaling events, the signaling pathways that could be involved in LMP1-induced transformation were analyzed. Previous studies revealed that of the LMP1 domains, CTAR1 specifically activated PI3K (4). To determine if PI3K signaling was activated by CTAR1 during Rat- 1 transformation, Rat-1 stable cell lines expressing LMP1, 1-231, del , or vector control (pbabe) were examined for phosphorylation of the PI3K target Akt and the Akt kinase target GSK3β (Figure 2). Phosphorylation of Akt (Serine 473) was detected with LMP1 and at slightly lower levels with LMP1 deleted for CTAR 2 (1-231) but not LMP1 deleted of CTAR1 (del ) or pbabe (Figure 2, 2 nd panel). The activated Akt kinase target, GSK3β, was phosphorylated and inactivated in the Rat-1 stable cell lines expressing LMP1 and 1-231, but not in pbabe or del , even though LMP1 del was expressed at higher levels than LMP1 and (Figure 2). Expression of del did not appear to be toxic as the cells looked healthy and continued to 69

86 proliferate. These data indicate that PI3K signaling mediated by CTAR1 in Rat-1 fibroblasts is able to activate Akt and that such activation leads to the phosphorylation of the Akt target GSK3β. pbabe LMP LMP1 αha del p-akt Total Akt p-gsk3β Total GSK3 α β Actin Figure 2. LMP1 and LMP1 CTAR1 induce phosphorylation of Akt and GSK3β. Cell lysates from Rat-1 fibroblast stable cell lines expressing pbabe, LMP1, 1-231, and del were assayed by western blot analysis for expression of the corresponding constructs with anti-ha (top panel), as well as phospho and total levels of Akt and GSK3β (middle panels), and actin (loading control). PI3K signaling contributes to LMP1-induced transformation LMP1 activates PI3K as well as distinct forms of NFκB from both CTAR1 and CTAR2 (4, 25, 42). To evaluate the contribution of PI3K and NFκB signaling to LMP1- induced rodent fibroblast transformation, Rat-1 cells were transduced with pbabe, LMP1, 1-231, or del and upon reaching 100% confluency were treated with the PI3K inhibitor LY (LY), the NFκB inhibitor BAY (BAY 11), or DMSO as 70

87 vehicle control (Figure 3). In DMSO treated cells (left column), LMP1 and formed foci while pbabe and del did not, with generally forming smaller foci. Treatment with LY inhibited focus formation in both LMP1 and (middle columns), indicating that activation of the PI3K signaling pathway is required for LMP1- induced transformation. Treatment with BAY 11 (right column), on the other hand, did not inhibit focus formation induced by LMP1 or DMSO LY BAY del LMP1 pbabe Figure 3. LY but not BAY inhibits LMP1 and LMP1 CTAR1-induced focus formation. Rat-1 cells were transduced with pbabe, LMP1, 1-231, and del , incubated for days, stained with crystal violet and observed for focus formation at 10X magnification with phase contrast. Fresh media containing DMSO, 25µM LY294002, or 10µM BAY was replaced every 48 hours. However, BAY 11 treatment resulted in smaller foci as well as a slightly decreased number of foci in comparison to the DMSO-treated cells. These findings 71

88 suggest that while LMP1-mediated NFκB activation is not necessary for focus formation it likely contributes to enhanced cell growth. These data indicate that activation of PI3Ksignaling, but not NFκB, is required for focus formation in Rat-1 cells. CTAR1 induces anchorage independence To further evaluate the role of CTAR1 and CTAR2 in LMP1-mediated transformation, induction of anchorage independent growth was assessed in soft agar growth assays performed with cell lines stably expressing pbabe, LMP1, 1-231, and del (Figure 4). As in focus formation, cells expressing LMP1 and formed colonies in soft agar that continued to grow, whereas cells expressing del and pbabe formed small colonies that did not expand (Figure 4A). The efficiency of to induce anchorage independent growth appeared equivalent to that of LMP1 as equal number of colonies formed from equivalent numbers of cells. However the colonies were somewhat smaller than those in LMP1-expressing cells. These data confirm that CTAR1 signaling is required and suggest that CTAR2 enhances cell growth but is not required for blocking contact inhibition or inducing anchorage independence. Colony formation was completely inhibited by LY treatment but not by treatment with BAY 11. To ensure that LY and BAY 11 treatment did not affect expression of LMP1, 1-231, and del , western blot analysis was performed on the stable Rat-1 cell lines (Figure 4B). Expression levels of LMP1, and del were not affected by treatment with DMSO or LY, while BAY 11 appeared to slightly decrease del levels but did not affect LMP1 and levels. 72

89 A DMSO LY BAY del LMP1 pbabe B DMSO LY BAY pbabe LMP del187 pbabe LMP del187 pbabe LMP del187 LMP del Figure 4. Anchorage-independent growth is dependent on LMP1 and LMP1 CTAR1 and is inhibited by LY (A) Rat1 stable cell lines expressing pbabe, LMP1, and del were suspended in soft agar and incubated for days to assay for anchorage-independent growth. Fresh media containing DMSO, 25µM LY294002, or 10µM BAY was added to the soft agar suspensions every other day for the duration of the time course. (B) Western blot analysis of Rat1 stables expressing pbabe, LMP1, 1-231, and del using anti-ha to confirm expression when cells were treated with DMSO, LY294002, or BAY To assess the effects of the chemical inhibitors on PI3K and NFκB signaling, Rat1 cells expressing pbabe, LMP1, 1-231, or del were analyzed by immunoblotting for phosphorylated Akt, and EMSA for effects on NFκB (Figure 5A). LY treatment inhibited Akt phosphorylation (middle 4 lanes) compared to DMSO (leftmost 4 lanes) BAY 11 has been shown to inhibit the TNFα-dependent 73

90 phosphorylation and subsequent degradation of the NFκB negative regulatory subunit IκBα (33). Treatment with BAY 11 treatment (rightmost 4 lanes) reduced the levels of phospho-akt in LMP1, and del but not pbabe. This effect may reflect that Akt is also a target of NFκB activation (24). A DMSO LY BAY pbabe LMP del pbabe LMP del pbabe LMP del p-akt Total Akt Actin B Recombinant p50 LMP1 DMSO + p65 Ab BAY LMP1 pbabe LMP1 DMSO pbabe Probe Supershift p65 Complexes Figure 5. LY inhibits Akt phosphorylation and BAY inhibits NFκB activation. (A) Rat-1 stable cell lines expressing pbabe, LMP1, 1-231, and del were incubated with DMSO, 25µM LY294002, or 10µM BAY were assayed for phosphorylated and total Akt, and β-actin (loading control) by western blot analysis. (B) Stable Rat1 cells expressing pbabe or LMP1 were incubated with DMSO or 10µM BAY and EMSA was carried out. Recombinant p50 (left lane) and probe alone (right lane) are positive and negative controls respectively. Long arrows indicate complexes supershifted with anti-p65 antibody. Short arrows indicate the position of p65-containing LMP1-induced NFκB complexes. To confirm that BAY 11 treatment blocked LMP1-mediated NFκB activation, vector control and LMP1 Rat-1 stable cells were analyzed by EMSA using a consensus 74

91 NFκB site (Figure 5B). Multiple NFκB complexes were detected in the LMP1- expressing cells that were not present in pbabe or with probe alone. The two strongest complexes, indicated by short arrows, were significantly reduced by addition of p65 antibody which produced two supershifted complexes, indicated by long arrows. These complexes were significantly reduced by treatment with BAY 11. These data confirm the inhibition of the PI3K and NFκB by treatment with the inhibitors. Thus, inhibition of PI3K with LY blocked Akt phosphorylation and focus formation induced by LMP1 and LMP1-CTAR1 while inhibition of NFκB signaling by BAY 11 did not affect focus formation induced by LMP1 and LMP1-CTAR1. LMP1 induces aberrant growth in human fibroblasts To determine if LMP1 signaling affects the growth of human cell lines, human embryo lung (HEL) fibroblasts were transduced with pbabe, LMP1, 1-231, or del (Figure 6). Transduced cells were maintained in media with serum, stained with crystal violet, and observed for morphological changes in LMP1-expressing HEL cells. LMP1 and induced aberrant growth with large swirled foci, whereas pbabe and del maintained the normal growth pattern (Figure 6A). Western blot analysis of the HEL extracts indicated that LMP1 and were expressed at equivalent levels (Figure 6). Interestingly, expression of del was decreased compared to that observed in Rat1 cells. This may reflect that del remains contact inhibited while the LMP1 and transduced cells continue to grow. Similarly to the effects observed in Rat-1 cells, LMP1 and activated and phosphorylated Akt to higher levels than pbabe and 75

92 del Rat-1 cells expressing LMP1 and have been shown to have decreased levels of the cyclin dependent kinase inhibitor (cdki) p27/kip (10). Expression of LMP1 and in HEL cells also had reduced the p27 protein levels compared to pbabe and del (Figure 6B). These data also suggest that downregulation of p27 is a factor in LMP1-mediated deregulation of cellular growth. The ability for LMP1 to induce focus formation in conjunction with similar effects on signaling and cell cycle regulation in Rat-1 and HEL cells suggests that LMP1 affects both rodent and human fibroblast cell growth through similar molecular mechanisms. A B del LMP1 pbabe CS1-4 HA p-akt Total Akt p27 Actin pbabe LMP del LMP del Figure 6. LMP1 and LMP1 CTAR1 induce focus formation and phosphorylation of Akt in human embryo lung fibroblasts. (A) HEL fibroblasts were transduced with pbabe, LMP1, 1-231, and del , incubated for days, stained with crystal violet, and observed for morphological changes with phase contrast at 15X magnification. Arrows point at LMP1, and del (B) Transduced HEL fibroblasts were harvested and assayed for expression of LMP1 and the two mutants (top two panels), phosphorylation and total levels of Akt, p27 levels, and Actin (loading control) by western blot analysis. 76

93 DISCUSSION In this study, LMP1-mediated transformation of rat and human fibroblasts was analyzed. The data indicate that CTAR1 is necessary for focus formation and anchorageindependent growth whereas CTAR2 is dispensable. CTAR1 and CTAR2 were originally identified by their ability to activate NFκB, although CTAR2 is the stronger activator in reporter assays (17, 23, 38). CTAR1 interacts with several TRAF molecules including TRAFs 1, 2, 3, and 5 while CTAR2 interacts with TRADD and receptorinteracting protein (RIP) and is thought to activate NFκB primarily through TRAF2 (14, 20, 31). However, CTAR1 has several unique properties and activates distinct forms of NFκB through canonical and noncanonical pathways (1, 22, 28, 39). Only LMP1 containing CTAR1 can induce expression of the EGFR, TRAF1, and the ID proteins and recent studies indicate that only CTAR1 activates PI3K and inhibits expression of p27 (6, 10, 17, 25, 27, 28). Importantly, LMP1 containing CTAR1 is required for transformation of B-lymphocytes while CTAR2 is not necessary if the lymphocytes are cultivated on fibroblast feeder layers (19). A previous study indicated that TRADD binding, mediated by CTAR2, was required for transformation of Rat-1 cells and for inducing tumor formation in nude mice (12). However, the study did not analyze the transforming potential of a CTAR1 mutant in comparison to the TRADD binding mutant. It has also been reported that Rat-1 cells that are not morphologically transformed can still form tumors in nude mice (36). Similarly, the control Rat1 cells used in this study also form tumors (data not shown). 77

94 The unique ability of CTAR1 to induce focus formation and anchorage independent growth required the activation of PI3K. In contrast, the NFκB inhibitor BAY did not inhibit focus formation or colony formation in soft agar, although the foci and colonies were generally smaller in expressing cells than in LMP1- expressing cells, suggesting that NFκB activation provides enhanced growth. Activation of NFκB signaling is required for the continued growth of EBV-transformed B- lymphocytes and inhibition of NFκB signaling with a constitutively active IκB kinase, or treatment with BAY 11, induces massive apoptotic death (22). However, EBV transformation of B-lymphocytes reflects immortalization and transformation of primary cells. In contrast, rodent fibroblast transformation identifies altered morphology and growth properties in an established cell line. These findings indicate that activation of PI3K is required for the morphologic changes and deregulated growth of fibroblasts including loss of contact inhibition and anchorage dependence while activation of NFκB can enhance the growth of the deregulated cells. Thus, deletion of CTAR2 or treatment with BAY 11 results in smaller foci. The requirement of PI3K-Akt signaling for EBV transformation of B- lymphocytes is as yet unknown. However, the data presented in this study indicates that activation of PI3K is an important aspect of CTAR1 signaling and is likely also required for lymphocyte transformation. In this study, the transformation properties of LMP1 were also demonstrated in HEL fibroblasts. Similarly to Rat-1 cells, in the HEL cells full-length LMP1 and CTAR1 but not CTAR2 induced focus formation as well as phosphorylation of Akt. Furthermore, CTAR1 but not CTAR2 decreased the levels of the cdki p27/kip. The ability for LMP1 to decrease p27 in HEL cells as well as previous 78

95 data in Rat1 cells indicating decreased p27 levels, suggests that p27 downregulation contributes to LMP1-induced transformation (10). LMP1 has long been known to associate with vimentin and the cytoskeleton (21). This property has been mapped to the CTAR1 domain and mutated forms of CTAR1 that do not interact with the TRAF molecules do not associate with the cytoskeleton (13). PI3K activation by CTAR1 has also been shown to induce actin stress fiber-formation (4, 34). The requirement for CTAR1, the activation of PI3K and the link between CTAR1 and the cytoskeleton suggests that the morphologic transformation of rodent fibroblasts induced by CTAR1 is induced by activation of PI3K and by LMP1 induced interactions between TRAFs and the cytoskeleton. The PI3K target Akt is known to phosphorylate and inactivate GSK3β (3), however the role of LMP1-mediated GSK3β inactivation remains to be elucidated. The EBV latent membrane protein 2A also activates the PI3K-Akt signaling pathway resulting in inactivation of GSK3β and subsequent activation of the proto-oncogene β- catenin in epithelial cells (30). β-catenin acts by interacting with members of the T-cell factor/lymphoid enhancer factor (TCF/LEF) family of transcription factors (41). Interestingly, a comparison of EBV positive and negative lymphoid cell lines revealed higher levels of cytoplasmic, but not nuclear β-catenin (9). The presence of high levels of cytoplasmic β-catenin but not nuclear levels indicated that in EBV-transformed lymphocytes the effects of LMP1 and LMP2 activation on PI3K and phosphorylation of GSK3β resulted in β-catenin accumulation but did not affect β-catenin localization. The targets of Akt or GSK3β may be distinct in lymphoid and epithelial cells. Potential differences in the targets of activated Akt in lymphocytes and epithelial cells have also 79

96 been observed in EBV-associated tumors. Activated Akt was detected in NPC and in the Reed Steinberg cells of Hodgkin's Disease, however, nuclear β-catenin was only detected in the malignant epithelial cells of NPC (29). It is also possible that LMP1 and LMP2 affect distinct pools of cellular GSK3β. GSK3β can be phosphorylated by different kinases in various intracellular locations and it has been shown that GSK3β phosphorylation induced by wnt signaling but not insulin signaling results in activated β- catenin (7). Thus, LMP1 and LMP2A may be affecting phosphorylation of different pools of GSK3β that results in activation of different signaling pathways in different cell backgrounds. The induction of focus formation, phosphorylation of Akt, and decreased expression of the cdki p27/kip by LMP1 in HEL cells reveal new properties of CTAR1. The downregulation of p27 in Rat1 cells and HEL cells by CTAR1 suggests that deregulation of the cell cycle is a component of LMP1-mediated growth transformation (10). Importantly, these findings indicate that the ability of LMP1 to transform rodent fibroblasts requires some but not all of the biochemical properties of LMP1. The full effects of LMP1 including activation of NFκB and perhaps other pathways are likely required for transformation of primary lymphocytes and the oncogenic properties of LMP1 in EBV-associated tumors. MATERIALS AND METHODS Retrovirus production and transduction Plasmid constructs expressing HA-tagged full-length LMP1, LMP(1-231), LMP(del ), pbabe, pvsvg, and pgag/pol and recombinant retrovirus production was described previously (10). Briefly, subconfluent 293T s were triple-transfected using 80

97 FuGENE 6 transfection reagent (Roche) according to manufacturer s directions with 5µg pbabe (vector), pbabe-ha-lmp1, pbabe-ha-1-231, or pbabe-ha-del , and 5µg pvsv-g and 5µg pgag/pol expressing plasmids. Following overnight incubation at 37 C, media was replaced with fresh media and cells were incubated at 33 C. The following day cell supernatant was centrifuged at 1,000 x g for 5 minutes to remove cell debris. Rat-1 or HEL cells were then transduced with clarified supernatant with 4µg/ml polybrene overnight. Cell culture and stable cell lines Rat-1 fibroblasts and human embryo kidney 293T s were maintained in Dulbecco s modified Eagle s medium (DMEM) supplemented with heat inactivated 10% fetal bovine serum (FBS) and antibiotic/antimycotic (GIBCO). Human Embryo Lung 299 (HEL) cells were maintained in Minimum Essential Medium (MEM) alpha and the additives mentioned for DMEM as well as non-essential amino acids. Rat-1 stable cell lines expressing full-length LMP1, LMP(1-231), LMP(del ), or vector control (pbabe) were established by transduction with recombinant retrovirus followed by selection with 5µg/ml puromycin (SIGMA). Western blotting and densitometry analysis Cell lines were grown to confluency and harvested as described previously (10). Briefly, post harvesting, cells were washed with ice-cold phosphate buffered saline (PBS, GIBCO), centrifuged at 1,000 x g, lysed with RIPA buffer (20mM Tris-HCl ph 7.5, 150mM NaCl, 1mM EDTA, 1% NP40, 0.1% SDS, 0.1% deoxycholate, protease and 81

98 phosphatase inhibitors). Lysates were clarified by centrifugation and protein concentration was determined using Bio-Rad DC protein assay system. Lysates were boiled in SDS-sample buffer and 25µg of protein were separated by SDS-PAGE and transferred to Optitran (Schleicher & Schuell) for western blot analysis. Primary antibodies used include β-actin (Santa Cruz), CS1-4 (DAKO), HA-probe (Santa Cruz); phospho-akt (Ser 473), total Akt, phospho-gsk3β (Ser 9), p27 (Calbiochem); total GSK3 (Upstate Biotechnology). Bound proteins were detected with horseradish peroxidase-conjugated secondary antibodies (Amersham Parmacia and Dako) and Pierce Supersignal West Pico System followed by exposure to film. Immunofluorescent labeling and phase contrast microscopy Rat-1 cells stably expressing LMP1, 1-231, del or pbabe were seeded in 6-well plates and maintained from days, changing the media every other day, under puromycin selection for foci formation. Wells were then washed once with PBS, fixed with methanol for 5 minutes at room temperature, and washed three times with PBS. Cells were blocked for 20 minutes with PBS containing 20% normal goat serum (NGS), incubated with primary antibody in PBS-20% NGS for 1 hour, washed 3 times with PBS, incubated with rhodamine-conjugated secondary (Jackson Laboratories) in PBS-20% NGS for 1 hour, and washed 3 times with PBS. Stained cells were examined with phase contrast and fluorescence microscopy. Focus formation and soft agars 82

99 Subconfluent Rat-1 or HEL cells were transduced with recombinant retrovirus in 6-well plates overnight. Cells were then maintained by changing the media every other day for days. To assay focus formation in the presence of chemical inhibitors, stable cell lines were seeded in 6-well plates. Upon cells reaching confluency, and every other day thereafter, fresh media containing 25µM LY (Calbiochem), 10µM BAY (Calbiochem) or vehicle control (dimethyl sulphoxide, DMSO, Sigma) used at 1:1000 was added to the cells. Cells were then stained with 1% crystal violet in 50% ethanol and imaged with a stereo microscope. Soft agars were carried out as described previously (40). Briefly, Bacto agar medium (1ml 5% Bacto Agar and 9ml DMEM with 10% FBS and antibiotic/antimycotic) was poured into a 12-well plate and allowed to solidify. 1.0x10 4 cells/well were resuspended in Bacto agar medium, overlaid the initial layer of Bacto agar medium and allowed to solidify. The media changed every other day with containing 1:1000 DMSO, 25 µm LY294002, or 10µM BAY was changed every other. Cells were then imaged by phase contrast or a dissecting microscope. Electrophoretic mobility shift assay (EMSA) Nuclear fractionations and EMSAs were performed as previously described (42). Rat-1 cells stably transduced with pbabe or LMP1 retrovirus were treated with Bay (10µM) or vehicle control (DMSO) for 24 hours and fractionated. DNA-protein complexes were formed by mixing 10µg of nuclear extract with 100,000 counts of the UV21 double-stranded oligonucleotide probe (CAGGGCTGGGGATTCCCCATCTCCCACAGTTTCACTTC), which is based on the H-2K b gene containing a consensus NFκB binding site (underlined) labeled with [α-32p] 83

100 dctp. After allowing the complexes to form for 15 minutes at room temperature, DNAprotein complexes were resolved on 5% PAGE and imaged using a PhosphorImager (Molecular Dynamics). Probe alone and positive control, recombinant p50 (Promega), were included and p65 containing complexes were determined by supershifting with antip65 antibody (Rockland). ACKNOWLEDGEMENTS The authors would like to thank Dr. Eng-Shang Huang s lab for the HEL cells. This work was supported by NIH grants CA and CA to N.R.T. 84

101 REFERENCES 1. Atkinson, P. G., H. J. Coope, M. Rowe, and S. C. Ley Latent membrane protein 1 of Epstein-Barr virus stimulates processing of NF-kappa B2 p100 to p52. J Biol Chem 278: Baichwal, V. R., and B. Sugden Transformation of Balb 3T3 cells by the BNLF-1 gene of Epstein-Barr virus. Oncogene 2: Cross, D. A., D. R. Alessi, P. Cohen, M. Andjelkovich, and B. A. Hemmings Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature 378: Dawson, C. W., G. Tramountanis, A. G. Eliopoulos, and L. S. Young Epstein-Barr virus latent membrane protein 1 (LMP1) activates the phosphatidylinositol 3-kinase/Akt pathway to promote cell survival and induce actin filament remodeling. J Biol Chem 278: Devergne, O., E. D. Cahir McFarland, G. Mosialos, K. M. Izumi, C. F. Ware, and E. Kieff Role of the TRAF binding site and NF-kappaB activation in Epstein-Barr virus latent membrane protein 1-induced cell gene expression. J Virol 72: Devergne, O., E. Hatzivassiliou, K. M. Izumi, K. M. Kaye, M. F. Kleijnen, E. Kieff, and G. Mosialos Association of TRAF1, TRAF2, and TRAF3 with an Epstein-Barr virus LMP1 domain important for B-lymphocyte transformation: role in NF-kappaB activation. Mol Cell Biol 16: Ding, V. W., R. H. Chen, and F. McCormick Differential regulation of glycogen synthase kinase 3beta by insulin and Wnt signaling. J Biol Chem 275: Eliopoulos, A. G., and L. S. Young Activation of the cjun N-terminal kinase (JNK) pathway by the Epstein-Barr virus-encoded latent membrane protein 1 (LMP1). Oncogene 16: Everly, D. N., Jr., S. Kusano, and N. Raab-Traub Accumulation of cytoplasmic beta-catenin and nuclear glycogen synthase kinase 3beta in Epstein- Barr virus-infected cells. J Virol 78:

102 10. Everly, D. N., Jr., B. A. Mainou, and N. Raab-Traub Induction of Id1 and Id3 by Latent Membrane Protein 1 of Epstein-Barr Virus and Regulation of p27/kip and Cyclin-Dependent Kinase 2 in Rodent Fibroblast Transformation. J Virol 78: Fahraeus, R., H. L. Fu, I. Ernberg, J. Finke, M. Rowe, G. Klein, K. Falk, E. Nilsson, M. Yadav, P. Busson, T. Tursz, and B. Kallin Expression of Epstein-Barr virus-encoded proteins in nasopharyngeal carcinoma. Int J Cancer 42: He, Z., B. Xin, X. Yang, C. Chan, and L. Cao Nuclear factor-kappab activation is involved in LMP1-mediated transformation and tumorigenesis of rat- 1 fibroblasts. Cancer Res 60: Higuchi, M., K. M. Izumi, and E. Kieff Epstein-Barr virus latentinfection membrane proteins are palmitoylated and raft-associated: protein 1 binds to the cytoskeleton through TNF receptor cytoplasmic factors. Proc Natl Acad Sci U S A 98: Izumi, K. M., E. D. Cahir McFarland, A. T. Ting, E. A. Riley, B. Seed, and E. D. Kieff The Epstein-Barr virus oncoprotein latent membrane protein 1 engages the tumor necrosis factor receptor-associated proteins TRADD and receptor-interacting protein (RIP) but does not induce apoptosis or require RIP for NF-kappaB activation. Mol Cell Biol 19: Izumi, K. M., K. M. Kaye, and E. D. Kieff The Epstein-Barr virus LMP1 amino acid sequence that engages tumor necrosis factor receptor associated factors is critical for primary B lymphocyte growth transformation. Proc Natl Acad Sci U S A 94: Izumi, K. M., and E. D. Kieff The Epstein-Barr virus oncogene product latent membrane protein 1 engages the tumor necrosis factor receptor-associated death domain protein to mediate B lymphocyte growth transformation and activate NF-kappaB. Proc Natl Acad Sci U S A 94: Kaye, K. M., O. Devergne, J. N. Harada, K. M. Izumi, R. Yalamanchili, E. Kieff, and G. Mosialos Tumor necrosis factor receptor associated factor 2 is a mediator of NF-kappa B activation by latent infection membrane protein 1, the Epstein-Barr virus transforming protein. Proc Natl Acad Sci U S A 93:

103 18. Kaye, K. M., K. M. Izumi, and E. Kieff Epstein-Barr virus latent membrane protein 1 is essential for B-lymphocyte growth transformation. Proc Natl Acad Sci U S A 90: Kaye, K. M., K. M. Izumi, G. Mosialos, and E. Kieff The Epstein-Barr virus LMP1 cytoplasmic carboxy terminus is essential for B-lymphocyte transformation; fibroblast cocultivation complements a critical function within the terminal 155 residues. J Virol 69: Kieff, E., and A. B. Rickinson Epstein-Barr Virus and Its Replication, p In B. N. Fields, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman, S. E. Straus, and D. M. Knipe (ed.), Field's Virology, Fourth ed, vol. 2. Lippincott Williams & Wilkins Publishers, Philadelphia, PA. 21. Liebowitz, D., and E. Kieff Epstein-Barr virus latent membrane protein: induction of B-cell activation antigens and membrane patch formation does not require vimentin. J Virol 63: Luftig, M., T. Yasui, V. Soni, M. S. Kang, N. Jacobson, E. Cahir-McFarland, B. Seed, and E. Kieff Epstein-Barr virus latent infection membrane protein 1 TRAF-binding site induces NIK/IKK alpha-dependent noncanonical NF-kappaB activation. Proc Natl Acad Sci U S A 101: Mehl, A. M., J. E. Floettmann, M. Jones, P. Brennan, and M. Rowe Characterization of intercellular adhesion molecule-1 regulation by Epstein-Barr virus-encoded latent membrane protein-1 identifies pathways that cooperate with nuclear factor kappa B to activate transcription. J Biol Chem 276: Meng, F., L. Liu, P. C. Chin, and S. R. D'Mello Akt is a downstream target of NF-kappa B. J Biol Chem 277: Miller, W. E., J. L. Cheshire, A. S. Baldwin, Jr., and N. Raab-Traub The NPC derived C15 LMP1 protein confers enhanced activation of NF-kappa B and induction of the EGFR in epithelial cells. Oncogene 16: Miller, W. E., J. L. Cheshire, and N. Raab-Traub Interaction of tumor necrosis factor receptor-associated factor signaling proteins with the latent membrane protein 1 PXQXT motif is essential for induction of epidermal growth factor receptor expression. Mol Cell Biol 18:

104 27. Miller, W. E., H. S. Earp, and N. Raab-Traub The Epstein-Barr virus latent membrane protein 1 induces expression of the epidermal growth factor receptor. J Virol 69: Miller, W. E., G. Mosialos, E. Kieff, and N. Raab-Traub Epstein-Barr virus LMP1 induction of the epidermal growth factor receptor is mediated through a TRAF signaling pathway distinct from NF-kappaB activation. J Virol 71: Morrison, J. A., M. L. Gulley, R. Pathmanathan, and N. Raab-Traub Differential signaling pathways are activated in the Epstein-Barr virus-associated malignancies nasopharyngeal carcinoma and Hodgkin lymphoma. Cancer Res 64: Morrison, J. A., A. J. Klingelhutz, and N. Raab-Traub Epstein-Barr virus latent membrane protein 2A activates beta-catenin signaling in epithelial cells. J Virol 77: Mosialos, G., M. Birkenbach, R. Yalamanchili, T. VanArsdale, C. Ware, and E. Kieff The Epstein-Barr virus transforming protein LMP1 engages signaling proteins for the tumor necrosis factor receptor family. Cell 80: Paine, E., R. I. Scheinman, A. S. Baldwin, Jr., and N. Raab-Traub Expression of LMP1 in epithelial cells leads to the activation of a select subset of NF-kappa B/Rel family proteins. J Virol 69: Pierce, J. W., R. Schoenleber, G. Jesmok, J. Best, S. A. Moore, T. Collins, and M. E. Gerritsen Novel inhibitors of cytokine-induced IkappaBalpha phosphorylation and endothelial cell adhesion molecule expression show antiinflammatory effects in vivo. J Biol Chem 272: Puls, A., A. G. Eliopoulos, C. D. Nobes, T. Bridges, L. S. Young, and A. Hall Activation of the small GTPase Cdc42 by the inflammatory cytokines TNF(alpha) and IL-1, and by the Epstein-Barr virus transforming protein LMP1. J Cell Sci 112 ( Pt 17): Raab-Traub, N Epstein-Barr virus in the pathogenesis of NPC. Semin Cancer Biol 12:

105 36. Reynolds, V. L., M. DiPietro, R. M. Lebovitz, and M. W. Lieberman Inherent tumorigenic and metastatic properties of rat-1 and rat-2 cells. Cancer Res 47: Roberts, M. L., and N. R. Cooper Activation of a ras-mapk-dependent pathway by Epstein-Barr virus latent membrane protein 1 is essential for cellular transformation. Virology 240: Rowe, M., M. Peng-Pilon, D. S. Huen, R. Hardy, D. Croom-Carter, E. Lundgren, and A. B. Rickinson Upregulation of bcl-2 by the Epstein- Barr virus latent membrane protein LMP1: a B-cell-specific response that is delayed relative to NF-kappa B activation and to induction of cell surface markers. J Virol 68: Saito, N., G. Courtois, A. Chiba, N. Yamamoto, T. Nitta, N. Hironaka, M. Rowe, and S. Yamaoka Two carboxyl-terminal activation regions of Epstein-Barr virus latent membrane protein 1 activate NF-kappaB through distinct signaling pathways in fibroblast cell lines. J Biol Chem 278: Scholle, F., K. M. Bendt, and N. Raab-Traub Epstein-Barr virus LMP2A transforms epithelial cells, inhibits cell differentiation, and activates Akt. J Virol 74: Shtutman, M., J. Zhurinsky, I. Simcha, C. Albanese, M. D'Amico, R. Pestell, and A. Ben-Ze'ev The cyclin D1 gene is a target of the beta-catenin/lef-1 pathway. Proc Natl Acad Sci U S A 96: Thornburg, N. J., R. Pathmanathan, and N. Raab-Traub Activation of nuclear factor-kappab p50 homodimer/bcl-3 complexes in nasopharyngeal carcinoma. Cancer Res 63: Wang, D., D. Liebowitz, and E. Kieff An EBV membrane protein expressed in immortalized lymphocytes transforms established rodent cells. Cell 43: Young, L., C. Alfieri, K. Hennessy, H. Evans, C. O'Hara, K. C. Anderson, J. Ritz, R. S. Shapiro, A. Rickinson, E. Kieff, and J. Cohen Expression of Epstein-Barr virus transformation-associated genes in tissues of patients with EBV lymphoproliferative disease. N Engl J Med 321:

106 90

107 CHAPTER THREE LMP1 STRAIN VARIANTS: BIOLOGICAL AND MOLECULAR PROPERTIES Bernardo A. Mainou and Nancy Raab-Traub This work was originally published in Journal of Virology (2006), Vol. 80 No 13:

108 ABSTRACT The ubiquitous herpesvirus Epstein-Barr virus (EBV) is linked to the development of several malignancies including nasopharyngeal carcinoma. Latent membrane protein 1 (LMP1) is considered the EBV oncogene as it is necessary for EBV-induced transformation of B-lymphocytes and is able to transform Rat-1 fibroblasts. LMP1 can activate a wide array of signaling pathways including PI3K-Akt and NFκB. Seven sequence variants of LMP1; Alaskan, B95.8, China 1, China 2, Med+, Med-, and NC; have been identified and individuals are infected with multiple variants. The frequency of detection of these variants differs in various EBV-associated malignancies from different geographic regions. In this study, the biological and signaling properties of the LMP1 variants have been characterized. All of the LMP1 variants transformed Rat-1 fibroblasts, induced increased motility of HFK cells, and induced increased homotypic adhesion of BJAB cells. While all the variants activated the PI3K-Akt signaling pathway to a similar extent, the Alaskan, China 1, and Med+ variants had limited binding to the E3 ubiquitin ligase component HOS and had slightly enhanced NFκB signaling. These findings indicate that the signature amino acid changes of the LMP1 variants do not hinder or enhance their in vitro transforming potential or affect their signaling properties. INTRODUCTION Epstein-Barr Virus is a ubiquitous herpesvirus that infects greater than 90% of the world's population. EBV infection is associated with a wide array of malignancies including nasopharyngeal carcinoma (NPC), Hodgkin lymphoma (HD), post-transplant lymphoma, Hairy Leukoplakia (HLP), Burkitt s lymphoma, and others (24, 45, 62). EBV primary 92

109 infection is usually asymptomatic, although at times it results in the benign lymphoproliferative disease infectious mononucleosis (40). Viral reactivation may occur in latently infected memory B cells and virus can frequently be detected in saliva (3, 49, 50). Viral infection is considered latent in EBV malignancies and in NPC and HD viral expression is restricted to EBNA1, LMP1, LMP2 and the EBER and BART RNAs (24). Latent membrane protein 1 (LMP1) is considered the EBV oncogene as it transforms NIH3T3 and Rat-1 fibroblasts. It is essential for EBV-induced B-lymphocyte transformation (22, 24, 32, 52, 58) and is frequently expressed in EBV-malignancies (15, 62). LMP1 consists of 386 amino acids with a short 23 amino-terminal cytoplasmic tail, 6 transmembrane domains, and a long carboxyl-terminal tail that contains the two signaling domains carboxyl-terminal activating region (CTAR) 1 and 2. LMP1 selfassociates in the plasma membrane due to its hydrophobic transmembrane domains and thus acts as a constitutively active growth factor receptor that does not require a ligand for its activation. The tumor necrosis factor receptor (TNFR)-associated factors (TRAF) associates with LMP1 which signals similarly to CD40 and the type II TNFR (9, 21, 39). As such, LMP1 activates a wide array of signaling pathways through CTAR1 and CTAR2, including NFκB, mitogen-activated protein kinase (MAPK), c-jun N-terminal kinase (JNK), and phosphatidylinositol 3-kinase (PI3K)-Akt pathways (7, 12, 14, 20, 32, 42, 46). LMP1 also induces the deregulation of the cell cycle through manipulation of various cell cycle regulatory molecules including the cyclin dependent kinase inhibitor (cdki) p27 Kip1, p16, inhibitor of differentiation (Id) 1 and 3, retinoblastoma (Rb), and cyclin dependent kinase 2 (CDK2) (14, 27, 41). 93

110 Six LMP1 sequence variants, termed Alaskan, China 1, China 2, Mediterranean+ (Med+), Mediterranean- (Med-), North Carolina (NC) have been isolated from clinical specimens (10, 35). These variants are distinguished by various signature amino acid changes from the prototypic LMP1 (B95.8), although changes are not found in CTAR1 or CTAR2. In addition China 1 and Med+ have a 10 amino acid deletion between CTAR1 and CTAR2 (10). Although this 10 amino acid deletion has been linked to augmented transforming ability (28), several studies have indicated that LMP1-contained CTAR1 is essential and sufficient for Rat-1 fibroblast and Madin-Darby Canine Kidney (MDCK) cell transformation (25, 32). NFκB activation and the transforming properties of the B95, Med+, and Cao variants have been compared (4, 6, 16, 17, 29, 34). A slight enhancement in the ability of the CAO variant, which is most similar to China 1, and the Med+ variant to induce NFκB signaling was mapped to the transmembrane domains. LMP1 also interacts with the E3 ubiquitin ligase component Homologue of Slimb (HOS), a member of the β-trcp/fbw1 subfamily of F box proteins, which regulates the ubiquitindependent destruction of IκBα and β-catenin (34, 47, 53, 60). Several studies have revealed that individuals are infected with multiple EBV variants and that the LMP1 variants differ in abundance between throat washings and peripheral blood and their detection and abundance varies over time (49-51). It is possible that these differences in abundance and detection reflect different biological properties or cellular tropism. Recently, computational analysis of the variants revealed key amino acid changes in potential Human Leukocyte Antigen (HLA)-restricted epitopes, suggesting a potential immune-modulated selection mechanism (11). Although all variants have been detected in various malignancies, the CAO/China 1 LMP1 variant 94

111 is significantly more prevalent in NPC tumors from the southern endemic region of China and is predicted to not be presented by individuals who are A2 or A24, the most common HLA types found in patients with NPC from this region (11). In this report, the biologic properties of the LMP1 variants were characterized through their ability to transform Rat-1 fibroblasts, affect epithelial cell motility, and induce homotypic adhesion of B lymphocytes. The LMP1 variants were also evaluated for their potential to activate the PI3K-Akt and NFκB signaling pathways as well as their ability to alter cell cycle markers that have been associated with G1/S phase progression. All the variants were capable of transforming Rat-1 fibroblasts as measured by blockage of contact-inhibited and anchorage-independent growth, and induced homotypic adhesion in BJAB cells. The PI3K-Akt signaling cascade was activated by all variants and this activation was necessary for LMP1-induced Rat-1 transformation. Changes in cellular markers that are frequently associated with cell cycle deregulation were also induced by all variants. Finally, the Alaskan, China 1, and Med+ variants had increased NFκB reporter activity compared to the other variants in conjunction with decreased binding to HOS. These similarities in biologic and molecular properties suggest that all of the variants have equal pathologic potential, in agreement with their detection in multiple types of cancer. MATERIALS AND METHODS Plasmids. LMP1 variants were subcloned into the myc-tagged expression vector M3-pcDNA3-Hygromycin (26) from pgem32. The Alaskan, China 1, and China 2 variants were PCR amplified with the 5 primer 95

112 (CGACGGATCCATATGGAACGCGACCT) and the 3 primer (ATCACGAGTCTAGAAATGTGGCTTTTCAGCCTAG) followed by restriction enzyme digestion and insertion into the BamHI and XbaI sites of M3-pcDNA3-Hyg. The B95.8, Med+, Med-, and NC variants were PCR amplified with the 5 primer (CGACGGATCCATATGGAACACGACCT) and the 3 primer (ATCACGAGTCTAGAAATGTGGCTTTTCAGCCTAG) followed by the abovedescribed cloning procedure. LMP1 variants were then subcloned into the pbabe-puromycin (pbabe) vector without the myc-tag but adding an HA tag. B95.8, Med+ and NC were PCR amplified with LMP1-HA5 and LMP1-3 (16). NCdel93C was isolated during the cloning of NC as a spontaneous mutation, glutamine to stop, resulting in the deletion of the last 93 amino acids of NC. Med- was PCR amplified with LMP1-HA5 and LMP1-SAL3 (ATCACGAGGTCGACAATGTGGCTTTTCAGCCTAGAC). China 1 and China 2 were PCR amplified with LMP1-C12AL5 (GCCGGATCCATGGCTTACCCATACGATGTTCCAGATTACGCTAGCTTGGGTG GTCATATGGAACGCGACCTTGAGAGG) and LMP1-3. Alaskan was PCR amplified with LMP1-C12AL5 and LMP1-SAL3. PCR amplification was followed by restriction enzyme digestion and insertion into the BamHI and EcoRI (B95.8, China 1, China 2, Med+, NC and NCdel93C) or BamHI and SalI (Alaska and Med-) sites of pbabe. The HA-tagged pcdna3-homologue of Slimb (HOS) plasmid was a gift of Serge Fuchs, University of Pennsylvania (53). Retrovirus production and transduction. Retrovirus production was carried out as described previously (14). Briefly, subconfluent 293T cells were triple transfected 96

113 using FuGENE 6 (Roche) according to manufacturer s directions with 5µg of pbabe or each of the pbabe-ha-tagged LMP1 variants, 5µg pvsvg, and 5µg pgag/pol. Following overnight incubation at 37 C media was replaced with fresh media, DMEM for BJAB and Rat-1, and Keratinocyte-SFM medium following a gentle wash with PBS for HFK, and cells were incubated at 33 C overnight. Cell supernatant containing the retrovirus was then cleared of cellular debris through centrifugation at 1000 g for 5 min. Rat-1 or HFK were then transduced with clarified supernatant with 4µg/ml polybrene overnight. BJAB cells were transduced through spinoculation of 3.0x10 5 cells with 1ml of retrovirus and 4µg/ml polybrene for 3 hours at 2000 g followed by removal of spent media and resuspension of pellet in RPMI. Cell culture and stable cell lines. Rat-1 fibroblasts (Rat-1) and human embryo kidney 293T (293T) cells were maintained in Dulbecco s modified Eagle s medium (DMEM, GIBCO) supplemented with heat-inactivated 10% fetal bovine serum (FBS, Sigma) and antibiotic/antimycotic (GIBCO). Rat-1 cells were prepared fresh for each experiment and were maintained for no more than four passages. Human foreskin keratinocyte (HFK) cells, immortalized with htert, were maintained in Keratinocyte- SFM (GIBCO) medium supplemented with 15ng bovine pituitary extract (BPE, GIBCO), 100ng epidermal growth factor (EGF, GIBCO) and antibiotic/antimycotic. BJAB cells were maintained in RPMI 1640 (GIBCO) medium supplemented with 10% FBS and antibiotic/antimycotic. Stable cell lines expressing pbabe or the variants in pbabe were established by transduction with recombinant retrovirus followed by selection with 5µg/ml puromycin (Sigma) for Rat-1 cells and 2.5 µg/ml puromycin for HFK and BJAB cells. 97

114 Homotypic adhesion assay. BJAB cells were transduced by spinoculation, placed under puromycin selection followed by separation though LSM Lymphocyte Separation Medium (ICN) gradient and amplification of live cells under puromycin selection. Equal cell numbers (~1.0x10 4 cells/ml) were plated in a 6 well plate and observed every 24 hours for clumping with phase contrast microscopy. Cell harvesting and western blotting. Cell lines were grown to confluency and harvested as described previously (14). Briefly, postharvesting, cells were washed with ice-cold phosphate buffered saline (PBS, GIBCO), centrifuged at 1000 g, lysed with RIPA buffer (20mM Tris-HCl ph 7.5, 150mM NaCl, 1mM EDTA, 1% NP40, 0.1% SDS, 0.1% deoxycholate, 0.5mM phenylmethylsulfonyl fluoride (PMSF), 1mM Na 3 VO 4, and protease and phosphatase inhibitors (SIGMA)). Lysates were clarified by centrifugation and protein concentration was determined using Bio-Rad DC protein assay system. Lysates were boiled in SDS sample buffer for 5 min. and µg of protein were separated by SDS-PAGE and transferred to an Optitran membrane (Schleicher and Schuell) for western blot analysis and efficient transfer was measured with Ponceau S staining (DiaSys Europe Ltd.). Primary antibodies used include HA-probe (Santa Cruz), c-myc tag (Santa Cruz), β-catenin (BD Biosciences), CS1-4 (Dako), LMP1 Rat monoclonal pool (Ascenion; CAO 7E10, CAO 8G3, LMP 1G6 and CAO 7G8), β-actin (Santa Cruz), total GSK3 (Upstate Biotechnology), p27/kip (Calbiochem), Id1 (Z8, Santa Cruz), phospho-rb (T373, Oncogene), Rb (BD Biosciences), p21/waf (Oncogene), CDK2 (BD Biosciences), phospho-cdk2 (T160), phospho-akt (Ser473), total Akt, phospho-gsk3β (Ser9), phospho-mtor (Ser2448), phospho-pten (Ser380), 98

115 phospho-mtor (Ser2448), total IκBα, total PTEN, E-cadherin (Cell Signaling). Densitometry analysis was done using Image J software. Focus formation and soft agars. Subconfluent Rat-1 cells were transduced with recombinant retrovirus in six-well plates overnight. Cells were then maintained by changing the media every other day for days. To assay focus formation in the presence of LY (LY, Calbiochem), stable cell lines were established as mentioned previously and seeded in 6-well plates. Upon reaching confluency, and every day thereafter for days, fresh media containing 25µM LY or vehicle control (DMSO, Sigma) used at 1:1000 was added to the cells. Cells were then stained with 1% crystal violet in 50% ethanol and imaged with a stereomicroscope. Soft agars were carried out as described previously (32, 48). Briefly, Bacto agar medium (5% Bacto agar into DMEM with 10% FBS and antibiotic/antimycotic to a 0.5% final concentration of Bacto agar) was poured into a twelve-well plate and allowed to solidify. A total of 1.0x10 4 cells/well were resuspended in Bacto agar medium, overlaid the initial layer of Bacto agar medium and allowed to solidify. Media was added on top of the solidified Bacto agar medium and changed every other day for days. Cells were imaged with a phase contrast microscope. Migration assay. Stable HFK cells were established as mentioned previously and seeded in six-well plates. Upon reaching confluency, cells were washed with PBS and the media was replaced with Keratinocyte-SFM media without EGF and BPE for hours. Cells were then scratched with a 200µl tip, the media was immediately changed followed by incubation at 37 C and imaged at 24 and 48 hours with phase contrast microscopy. Prior to imaging cell media was replaced to remove cell debris. 99

116 Immunofluorescent labeling. Rat-1 cells expressing pbabe and pbabe-hatagged LMP1 variants were maintained in a six well plate for days changing the media every other day. Cells were then washed once with PBS, fixed with methanol for 5 min at room temperature and washed 3 times with PBS. Cells were blocked for 20 min with PBS containing 20% normal goat serum (NGS, Jackson Laboratories), incubated with primary antibody in PBS-20% NGS for 1 h, washed three times with PBS, incubated with rhodamine-conjugated secondary (Jackson Laboratories) in PBS-20% NGS for 1h, and washed three times with PBS. Stained cells were observed with phase contrast and fluorescence microscopy. Co-immunoprecipitations and NFκB Reporter. HA-tagged HOS and myctagged LMP1 variants were immunoprecipitated using Pierce Mammalian ProFound HA and c-myc Tag Co-IP Kits as indicated by the manufacturer s directions. Briefly, 293T cells were transfected with HA-tagged HOS and either pcdna3 or the myc-tagged LMP1 variants. Cells were harvested 48 hours post transfection with RIPA buffer and protein concentration was determined as mentioned previously. IPs were carried out with 500µg of protein and 10µl of the provided myc- or HA-agarose slurry with overnight nutation at 4 C followed by the manufacturer s instructions. Co-IPs were then separated in an SDS-PAGE and western blots were carried out as previously mentioned. NFκB reporter assays were carried out by transfecting subconfluent 293T cells in a 12-well plate with Fugene 6 containing 0.2µg pcdna3 (vector control) or 0.2µg pcdna3-lmp1 variants, 0.2µg prl-sv40 (Promega), and 0.2µg pgl3-basic or 0.2µg pgl3-3nfκb (3κB), a gift from Albert Baldwin s lab (43). Cells were harvested

117 hours post transfection and luciferase activity was determined as mentioned previously (14). Statistical Analysis. P values were calculated using a Tukey-Krammer multiple comparison test using the triplicate relative luciferase values from the NFκB reporter. Statistical analysis was done using GraphPad Instat 3 software. RESULTS LMP1 variants transform Rat-1 fibroblasts. LMP1 is considered the EBV oncogene as it blocks contact-inhibited growth and induces anchorage independent growth in Rat-1 fibroblasts (14, 32, 58). To determine the ability of the LMP1 variants to block contact inhibited growth, Rat-1 fibroblasts were transduced with pbabe and pbabe- HA-tagged variants (Alaskan, B95.8, China 1, China 2, Med+, Med-, NC, and NCdel93C). 14 days post transduction cells were analyzed for focus formation and expression of the variants by phase contrast and immunofluorescent microscopy (Fig. 1). Whereas pbabe did not induce focus formation, all of the LMP1 variants induced foci. NCdel93C, which is deleted for CTAR2 but not CTAR1, also induced foci confirming the previous finding that CTAR1 but not CTAR2 is necessary for focus formation (32). Immunofluorescent microscopy using the LMP1-specific antibody CS1-4 revealed that expression of the variants was restricted to the foci indicating that all cells that expressed LMP1 formed foci. Immunofluorescent staining for the Alaskan variant is not included as the CS1-4 antibody does not recognize the Alaskan variant. There was some variability in the size and morphology of the foci induced by all the LMP1 variants but all the LMP1 variants formed large and small foci of similar morphology. Equivalent 101

118 amounts of DNA used to make retrovirus and serial dilutions of the retrovirus for each variant yielded similar numbers of foci (data not shown). This data suggest that all variants are equally efficient in focus formation. pbabe Med + B958 Med - China 1 NC China 2 NCdel93C Alaskan Figure 1. LMP1 variants block contact inhibited growth of Rat-1 cells. Rat-1 fibroblasts were transduced with pbabe and pbabe-lmp1 variants, maintained for days in full serum, fixed and stained with the anti-lmp1 antibody CS1-4, followed by imaging with phase contrast and immunofluorescent microscopy for focus formation. Alaskan immunofluorescent staining is not provided. To further determine the transforming ability of the LMP1 variants, Rat-1 cells stably expressing the LMP1 variants were assayed for anchorage-independent growth by growth in soft agar. Similarly to that observed with focus formation, all LMP1 variants were able to induce anchorage-independent growth (Fig. 2). Equivalent numbers of cells stably expressing the variants induced equal number of colonies of varying size and morphology indicating that all LMP1 variants are able to induce anchorage-independent 102

119 growth with equivalent efficiency. The size variation between colonies may be due to variable LMP1 expression within each colony. These data in conjunction with the ability of all the variants to block contact-inhibited growth suggest that the signature amino acid changes in the LMP1 variants do not impede or enhance their transforming potential. pbabe China 2 Alaskan Med + B95.8 Med - China 1 NC Figure 2. Anchorage-independent growth of Rat-1 fibroblasts is induced by LMP1 variants. Rat-1 cells stably expressing the LMP1 variants or vector control (pbabe) were resuspended in soft-agar and maintained for 21 days followed by imaging with phase contrast microscopy for anchorage-independent growth. LMP1 variants induce increased motility. It has been previously shown that expression of LMP1 in the nasopharyngeal carcinoma cell line NP69 that expresses SV40 T antigen or the MDCK canine cell line induces cellular motility (25, 29). In addition LMP1 induces actin stress-fiber and filopodia formation (44). To determine the ability of the LMP1 variants to induce motility in normal human epithelial cells, a wound heal scratch assay was performed using telomerase immortalized human keratinocytes. Monolayers of HFK cells stably expressing the LMP1 variants were serum starved, scratched and observed for their ability to migrate into the wound at 24 and 48 hours post scratch (Fig. 3). The scratch boundaries are delineated with white lines at the 48 hour 103

120 time-point. Although there were small differences in the rate of migration between the variants, all variants were able to migrate at a faster rate than the vector control cells (pbabe). The NCdel93C-expressing cells also induced migration into the wound, confirming the role of CTAR1 in LMP1-mediated cell motility. 24 HPS 48 HPS 24 HPS 48 HPS China 1 NCdel93C B95.8 Med - Alaskan Med + pbabe China 2 Figure 3. LMP1 variants increase motility of HFK cells. Monolayers of HFK cells stably expressing the LMP1 variants or vector control (pbabe) were scratched and assayed for increased motility 24 and 48 hours post scratch by phase contrast microscopy. White lines delineate approximate location of scratch boundary. LMP1 variants activate the PI3K-Akt signaling pathway. A recent study indicated that LMP1 transformation of Rat-1 fibroblasts is dependent on activation of the PI3K-Akt pathway (7, 32). To assess the ability of the LMP1 strains to activate Akt, phosphorylation of Akt as well as various targets of Akt was assessed in the stably LMP1 expressing Rat-1 cells analyzed in Figure 2 (Fig. 4A). Although the total levels of Akt were not changed, variable levels above vector control of activated Akt were detected with all the LMP1 variants (Fig. 4B). Increased phosphorylation of the Akt target GSK3β was also detected with all the LMP1 variants (Fig. 4A). Interestingly, 104

121 phosphorylation of another Akt target, mtor (mammalian Target of Rapamycin), was not affected. Total Akt and total GSK3 blots in conjunction with Ponceau S staining and an actin blot (not shown) confirmed equal loading on all lanes. These findings indicate that activation of Akt by LMP1 affects a subset of Akt-regulated pathways. A pbabe Alaskan B95.8 China 1 China 2 Med + Med - NC HA B CS α β p-akt (Ser473) Akt p-gsk3β (Ser9) GSK3 Percent Expression/Activation % LMP1 % pakt % pgsk3b % E-cadherin pbabe Alaskan B958 China 1 China 2 Med + Med - NC p-mtor (Ser2448) LMP1 Strain Variants Inactive p-pten (Ser380) PTEN E-cadherin Figure 4. Activation of the PI3K-Akt signaling pathway by LMP1 variants. (A) LMP1 variants and vector control (pbabe) expressed stably in Rat-1 cells were assayed for LMP1 expression with CS1-4 and HA antibodies (asterisks identify LMP1-specific bands), phosphorylated and total Akt and GSK3β, PTEN, mtor and total E-cadherin by western blot analysis. Equal protein loading was confirmed with Ponceau S staining and an actin western blot (not shown). (B) Quantitative analysis of LMP1 (white bars), phosphorylated Akt (checkered bars), phosphorylated GSK3β (striped bars), and E- Cadherin (black bars) protein levels. LMP1 levels were normalized to B95.8 whereas phospho-akt, phospho-gsk3β, and E-cadherin levels were normalized to pbabe. Expression of the LMP1 variants was assessed using a polyclonal antibody to HA and the CS1-4 monoclonal antibody pool (Fig. 4A). Detection by HA suggested similar levels of expression of Alaskan, B95.8, China 1 and Med+ and lower levels of China 2, Med -, and NC (marked by an asterisk in Fig. 4A). In contrast, detection by CS1-4 suggested that the B95.8, China 1, and China 2 were expressed at very high levels with low levels of Med- and NC and nearly undetectable Med+. Alaskan is not detected by 105

122 CS1-4. These differences clearly indicate differences for the affinity of CS1-4 antibody for the different LMP1 variants. Surprisingly, the HA epitope tag was apparently recognized with differing affinities for the tagged variants. CS1-4 also detects consistent cleavage products for each LMP1 variant that are not observed with HA. This suggests that there are differences in preferred proteolytic cleavage sites between the variants that eliminate the amino terminal end of LMP1 thus removing the HA tag. These differences in cleavage products may account for the differences in the detection of the LMP1 variants by the HA antibody. The clear differences in reactivity to the antibodies indicate that the expression levels of the LMP1 variants cannot be directly compared. However, densitometry of LMP1 expression levels as well as total levels of phospho-akt, phospho-gsk3β, and E- cadherin was performed (Fig. 4B). LMP1 expression was normalized to the B95.8 variant, using the HA western blot data, whereas the other markers were normalized to vector control (pbabe). Expression of the LMP1 variants as estimated by HA reactivity ranged from 19% for China 2 to 117% for Med+ compared to the B95.8 variant (white bars). Akt phosphorylation was increased from 127% to 223% of control (checkered bars). In Alaskan, B95.8, China 1, and Med+, which seem to be roughly equally expressed based on HA reactivity, normalization of the induction of Akt to LMP1 expression ranged from 1.4 to 1.9 fold. In cells expressing China 2, Med-, and NC, which seem to be poorly detected by the HA antibody, normalization to LMP1 suggested induction that ranged from 4.5 to 9.2 fold. Phosphorylation of GSK3β ranged from 257% to 453% of vector control and normalization to LMP1 indicated fold increases from 2.9 to 3.8 for variants detected similarly by anti-ha and from 4.5 to 9.2 for the 106

123 poorly detected variants. The disproportionately high ratios for the China 1, Med-, and NC variants also suggest that the expression levels of LMP1 are underestimated for these variants. It has been previously reported that LMP1 induces the methylation of the E- cadherin promoter resulting in the overall decrease of E-cadherin protein levels in LMP1- expressing NPC cell lines (56, 57). To determine the effects of the LMP1 variants on E- cadherin expression western blot analysis was performed with Rat-1 cells stably expressing the LMP1 variants (Fig. 4A). E-cadherin levels were decreased with all variants and detected at levels from 19% in the Med- variant to 46% in the B95.8 variant as compared to pbabe (black bars). Similarly to Akt and GSK3β, the overall reduction of E-cadherin levels did not correlate with the estimated expression levels of the LMP1 variants as determined by HA. The China 1 and China 2 variants, which are very differently detected by anti-ha, were expressed at similar levels as detected by CS1-4 and the stable cell lines expressing China 1 and China 2 had 40% and 44% of the E- cadherin expressed in the pbabe control. These data suggest that they have equivalent effects on E-cadherin. The PTEN phosphatase regulates PI3K-Akt signaling through its ability to regulate the phosphorylation status of phosphoinositides. Loss of function mutations of PTEN have been identified with several cancers, including endometrial carcinomas and lymphomas (31). To determine if the activation of PI3K by LMP1 is mediated by affecting PTEN expression or its activation status, western blot analysis for the phosphorylated, inactive form of PTEN as well as total levels of PTEN was performed (Fig. 4A). Expression of the LMP1 variants did not affect the levels of phosphorylated 107

124 PTEN with slight increases in total PTEN. These results suggest that PI3K-Akt activation by LMP1 is not mediated by PTEN inactivation or reduced PTEN protein levels. These findings indicate that all LMP1 variants can activate the PI3K-Akt signaling pathway as well as reduce E-cadherin protein levels. However, none of the variants alter the activation status of mtor or PTEN. DMSO LY DMSO LY pbabe China 2 Alaskan Med+ B95.8 Med- China 1 NC Figure 5. LY blocks LMP1-induced focus formation. Rat-1 cells stably expressing vector control (pbabe) or the LMP1 variants were seeded in 6-well plates and maintained for days in media with the PI3K-inhibor LY or vehicle control (DMSO), stained with crystal violet, and observed for focus formation with phase contrast microscopy. LY blocks focus formation by LMP1 variants. A previous study indicated that transformation of Rat-1 fibroblasts is dependent on PI3K-Akt activation (32). To determine if the requirement of the LMP1 variants to block contact inhibited growth is dependent on the PI3K-Akt signaling pathway, Rat-1 cells stably expressing 108

125 pbabe Alaskan B958 China 1 China 2 Med + Med - NC NCdel93C 237 LMP1 Strain Variant % LMP1 % p27 % Id1 the LMP1 variants were treated with vehicle control (DMSO) or the PI3K chemical inhibitor LY (LY) for days and were observed for focus formation (Fig. 5). As previously observed for the B95.8 strain of LMP1 (32), LY treatment abolished focus formation for all LMP1 variants indicating that activation of the PI3K-Akt pathway is required to suppress contact inhibition. LMP1 expression and inhibition of PI3K-Akt signaling, through analysis of phosphorylated Akt levels, was confirmed by western blot analysis (data not shown). A pbabe Alaskan B95.8 China 1 China 2 Med + Med - NC NCdel93C C pbabe Alaskan B95.8 China 1 China 2 Med + Med - NC * * * * * * * * HA p27 CS1-4 Id1 Actin p-rb (T373) B Rb p-cdk2 (T160) CDK2 Percent Protein Level p21 Actin Figure 6. LMP1 variants regulate cell cycle progression protein markers. (A) Rat-1 cells stably expressing pbabe or the LMP1 variants were assayed for LMP1 expression (asterisk delineates LMP1 variant), p27 and Id1 protein levels by western blot analysis. Equal loading was confirmed with an actin western blot. (B) Quantitative analysis of LMP1 (white bars), p27 (black bars), and Id1 (striped bars) protein levels. LMP1 expression was normalized to B95.8 whereas p27 and Id1 levels were normalized to pbabe. (C) HFK cells stably expressing pbabe or the LMP1 variants were assayed for LMP1 expression, phosphorylated and total levels of Rb and CDK2, and p21 /Waf1. Equal loading was confirmed with the actin blot. LMP1 variants regulate cell-cycle markers. The ability to induce cell-cycle progression is a key step in oncogenesis. Recent studies indicate that LMP1, through CTAR1, increases the levels of Id1 and Id3 as well as the pro-cellular growth markers 109

126 pprb and CDK2 while reducing levels of the cdki p27/ Kip1 (14, 27). To determine whether the LMP1 variants could equally affect these cellular markers involved in cell cycle progression, Rat-1 cells were assayed by western blot analysis. Confirming previous data with the B95.8 strain of LMP1, all variants induced higher levels of Id1 in Rat-1 cells compared to the pbabe control cells with reduced protein levels of the cdki p27/ Kip1 (Fig. 6A). Densitometry on LMP1 expression as well as protein levels of p27 and Id1 from Figure 6A was performed (Fig. 6B). The LMP1 bands for each variant that were used for densitometry analysis are delineated by an asterisk to their left. LMP1 expression as detected by anti-ha was normalized to the B95.8 variant whereas levels of p27 and Id1 were normalized to vector control (pbabe). Expression levels of the LMP1 variants ranged from 289% to 106% compared to the B95.8 variant (white bars). Protein levels of Id1 in cells expressing the LMP1 variants ranged from 143% to 250% compared to vector control (striped bars) whereas protein levels of p27 ranged from 24% to 59% compared to vector control (black bars). Expression levels of the LMP1 variants did not directly correlate with more Id1 levels or less p27 levels. These data suggest that LMP1 can only induce or repress Id1 and p27 to a certain level and that overexpression of LMP1 does not necessarily lead to an increase or decrease of these cellular markers. To determine the effects of LMP1 on cell cycle markers in normal epithelial cells, pprb and CDK2 phosphorylation as well as total Rb levels were assessed in HFK cells expressing the LMP1 variants. Similarly to Rat1 cells, higher levels of pprb and total Rb and phosphorylated CDK2 were detected (Fig. 6C). In contrast to the effects on p27, the cdki p21/ WAF1 levels were unchanged suggesting specific effects of LMP1 on p

127 However, all LMP1 variants induced phosphorylation of Rb and CDK2 as well as an induction in overall Rb protein levels. These data reveal that all LMP1 variants regulate a variety of cell cycle markers similarly to the well-characterized B95.8 LMP1 strain. LMP1 Variants induce homotypic adhesion of BJAB cells. It has been established that expression of LMP1 in BJAB cells results in increased homotypic adhesion possibly due to increased LFA-1 or ICAM-1 levels (16, 33, 59). BJAB stable cell lines expressing the LMP1 variants were established as mentioned previously and were observed for homotypic adhesion (Fig. 7A). Similarly to that previously observed with the B95.8 strain (59), all LMP1 variants induced homotypic adhesion. Although there was a small variation in the size and number of the cell clumps, overall there appeared to be no significant difference between the variants in their ability to induce homotypic adhesion. A pbabe China 2 B pbabe Alaskan B95.8 China 1 China 2 Med + Med - NC Alaskan Med+ CS1-4 B95.8 China 1 Med- NC p-akt Akt Actin Figure 7. Homotypic adhesion of BJAB cells is induced by LMP1 variants. (A) Equal number of BJAB cells stably expressing pbabe or the LMP1 variants were seeded and 111

128 observed for homotypic adhesion every 24 hours by phase contrast microscopy. Representative fields at 3 days post-seeding are shown. (B) LMP1 variants activate Akt in BJAB cells. BJAB cells stable expressing pbabe or the LMP1 variants were assayed for LMP1 expression and phosphorylated and total levels of Akt. Equal loading was confirmed with an Actin blot. LMP1 expression in the BJAB cells was confirmed by western blot analysis. All of the BJAB cell lines expressed detectable levels of LMP1 by CS1-4 (Fig. 7B), and the Alaskan strain by a pool of Rat monoclonal antibodies for LMP1 (data not shown). All of the LMP1-expressing BJAB cells had higher levels of phosphorylated Akt indicating that activation of Akt by LMP1 occurs in both epithelial and lymphoid cells. These data demonstrate that the LMP1 variants are capable of inducing phenotypic changes not only in epithelial cells, but also lymphocytes. A Destruction S350 S366 Box * B ATDDSGHESDSN HDSGHG..PTLLLGSSGSG-370 * * Alaskan China 1 China 2 Med+ Med- NC -ATDDSSHESDSN HDSGHG..PTLLLGTSGSG- -ATDDSSHESDSN del..g..ptlllgtsgsg- -ATDDSSHESDSN HDSGHG..PTLLLGTSGSG- -ATDDSGHESDSN del..g..ptlllgtsgsg- -ATDDSGHESDSN HDSGRG..PTLLLGTSGSG- -ATDDSSHESDSN HDSGNG..PTLLLGTSGSG- B pcdna3 Alaskan B95.8 China 1 China 2 Med + Med - NC HOS IP: HA (HOS) WB: myc (LMP1) myc (LMP1) HA (HOS) β-catenin Total Load IκBα Actin Figure 8. Differential binding of HOS by LMP1 variants. (A) Sequence alignment of the LMP1 variants from amino acids of LMP1-B95.8 showing residues important for HOS-LMP1 binding, including the Destruction Box, a serine residue at amino acid 350, and a serine residue at amino acid 366. The 10 amino acid deletion found in the China 1 and Med+ variants is represented by del. Asterisks indicate amino 112

129 acids important for HOS-LMP1 binding. B95.8 contains all residues required for HOS- LMP1 binding. (B) 293T cells co-transfected with pcdna3 (vector control), the LMP1 variants and HOS, or HOS alone were harvested 48 hours post transfection and analyzed for HOS-LMP1 binding through co-ip. HOS was immunoprecipitated with anti-haconjugated beads and western blot analysis for LMP1 was carried out with anti-c-myc. Western blot analysis of total protein (Total Load) confirmed expression of the LMP1 variants, HOS, IκBα, β-catenin, and actin to confirm equal loading. Abrogated HOS binding enhances LMP1 NFκB activity. The E3 ubiquitin ligase component HOS, a member of the β-trcp/fbw1 subfamily of F box proteins which targets β-catenin and IκBα, has been shown to bind to the B95.8 strain of LMP1 but not the CAO strain. This binding requires a destruction box motif close to CTAR1 and two serines at amino acids 350 and 366 (53). There are multiple changes in these required motifs in the LMP1 variants. The Alaskan, China 1, China 2, and NC variants of LMP1 have a G212S mutation in the destruction box, China 1 and Med+ have a 10 amino acid deletion that eliminates serine 350, and all the variants but B95.8 have a mutation that changes the serine at position 366 to threonine (Fig. 8A) (10). The ability of HOS to bind to the LMP1 variants was tested using transfection of 293T cells and coimmunoprecipitations (co-ip) of HA-tagged HOS and myc-tagged LMP1 (Fig. 8B). Immunoblotting with HA and myc revealed that HOS and the LMP1 variants were efficiently expressed. Immunoprecipitation with HA and blotting with myc indicated that the Alaskan, China 1, and Med+ variants of LMP1 bound HOS weakly compared to the B95.8, China 2, Med- and NC variants. The low binding ability of China 1 to HOS is similar to that observed previously for the CAO strain. The strong binding of Med-, which contains S350, compared to Med+ which is deleted for S350 indicates that this is an important element in binding HOS. The conservative change S366T in Alaskan, China 1, China 2, Med- and NC did not correlate with HOS binding as 113

130 Alaskan bound HOS very poorly in comparison to Med- and NC which bound strongly. These differences in binding suggest that multiple factors contribute to the HOS-LMP1 interaction. NFkB Reporter RelativeLuciferase Units pglbasic 3kB pcdna3 Alaskan B958 China 1 China 2 Med + Med - NC HOS LMP1 Strain Figure 9. All LMP1 variants activate NFκB. 293T cells were triple-transfected with pcdna3 (vector control) or the LMP1 variants, prl-sv40, and pgl3-basic (vector control) or pgl-3κb (NFκB reporter). 48 hours post transfection cells were harvested and relative luciferase activity was assessed by the firefly luciferase activity of the NFκB reporter relative to the control Renilla luciferase activity (prl-sv40). The Tukey- Krammer test was used to calculate p values. All LMP1 variants had a p value of less than compare to pcdna3. To determine the effects of this binding on HOS targets, the levels of β-catenin and IκBα were determined. The level of β-catenin were unchanged corroborating previous data that the LMP1-HOS interaction does not affect β-catenin levels (53). The total levels of IκBα did not fully correlate with the levels of HOS-LMP1 binding. China 1, which bound HOS very poorly had the least amount of IκBα, confirming an earlier report (53) and most LMP1 variants had lower IκBα levels than the vector control. Interestingly, the B95.8-LMP1 which bound HOS well had more IκBα than the other 114

131 variants including pcdna3 vector control. This is in contrast to the Med- and NC variants which also bound HOS very well but had lower levels of IκBα. IκBα levels can be affected by multiple factors in addition to HOS binding including transcriptional regulation by NFκB and the activity of the IKK kinases. Thus the absolute level of IκBα may not be reflective of its activity. To determine the ability of the LMP1 variants to induce NFκB activation, dual luciferase reporter assays were performed with the LMP1 variants in 293T cells (Fig. 9). Interestingly, activation of NFκB correlated with the ability of HOS to bind LMP1. The Alaskan, China 1, and Med+ variants which bound HOS poorly induced higher NFκB reporter activity than the B95.8, China 2, Med-, and NC variants which bound HOS well and induced nearly equivalent NFκB activity. The differences in reporter activity between all the LMP1 variants and pcdna3 had a p value of less than using the Tukey-Krammer Multiple Comparisons Test, thus indicating that they are statistically significant. Furthermore, the increased reporter activity observed between the Alaskan, China 1, and Med+ variants compared to the B95.8 variant also had a p value of less than Transfected HOS without LMP1 induced 2.4 fold more NFκB reporter activity suggesting that HOS can marginally induce NFκB reporter activity compared to LMP1. In addition, protein levels of the NFκB subunits p65/rela and p50 were higher in the nuclear fractions of the LMP1 variants compared to pcdna3 and correlated with the enhanced NFκB reporter activity (data not shown). These data indicate that all of the LMP1 variants can activate NFκB signaling but those variants that do not bind HOS have enhanced NFκB activation. 115

132 DISCUSSION The data presented in this study indicate that all LMP1 variants transform Rat-1 fibroblasts at an equal efficiency and activate the PI3K-Akt signaling pathway which is required for Rat-1 fibroblast transformation. These data demonstrate that the signature amino acid changes in the LMP1 variants do not hinder or enhance their transforming potential in vitro. The ability of all the LMP1 variants to activate the PI3K-Akt signaling was not unexpected as the ability for LMP1 to transform Rat-1 fibroblasts and activate PI3K-Akt signaling has been mapped to CTAR1 (7, 32), which is highly conserved amongst all the variants (10, 35). The activation of the PI3K-Akt signaling pathway in BJAB cells also reveals that activation of this pathway is not restricted to epithelial cells but also occurs in B-lymphocytes. Interestingly, activation of Akt had differential effects on known Akt targets as the phosphorylation and inactivation of GSK3β was significantly affected compared to the unchanged levels of phosphorylated mtor. The subcellular localization of activated Akt and/or availability of Akt targets likely contributes to these variable effects on regulation. The association of LMP1 with lipid rafts (19) may target activation of Akt by limiting LMP1 to specific regions in the cell. PTEN is a tumor suppressor gene with mutation frequencies in human cancer approached that of p53 (5). PTEN, a phosphatase, regulates PI3K signaling by reversing the PI3K-driven phosphorylation of phosphoinositides that are necessary for the downstream activation of Akt. The LMP1 variants, including the B95.8 strain, did not affect the phosphorylation levels of PTEN and LMP1-expressing cells had slightly increased levels of PTEN. These findings suggest that while LMP1 induces increased 116

133 PI3K-Akt signaling, it does not regulate this pathway through inhibiting the activity of PTEN. Cadherin molecules are a group of calcium-dependent transmembrane proteins that aid in cell-cell adhesion (18). LMP1 has been shown to downregulate E-cadherin levels in NPC cell lines through activation of DNA methyltransferases (56). Similarly to that observed with LMP1-B95.8, all LMP1 variants downregulated E-cadherin protein levels in Rat-1 cells. These findings are congruent with the increased motility observed with the LMP1 variants. The Wnt/β-catenin signaling pathway is regulated by GSK3β which can phosphorylate β-catenin and induces β-catenin ubiquitination and proteasome-mediated degradation (37). Inactivation of GSK3β through phosphorylation by Akt can lead to the accumulation of β-catenin in the cytoplasm followed by nuclear translocation where it interacts with TCF/LEF transcription factors to drive transcription of several genes (54). The EBV protein LMP2A also activates the PI3K-Akt pathway and induces GSK3β phosphorylation and β-catenin accumulation in the nucleus (38). The data in this study reveals that LMP1 expression activated Akt and induced phosphorylation of GSK3β but did not affect nuclear β-catenin protein levels (data not shown and (13)). This indicates that LMP1 does not affect β-catenin levels in epithelial cells in contrast to LMP2, which promotes β-catenin accumulation and nuclear translocation (38). The regulation of the cell cycle is an important step in oncogenesis and LMP1, through CTAR1, affects expression of several proteins that regulate G 1 /S progression, including Rb, CDK2, Id1 and Id3, and the cdki p27 Kip1 (14). All of the LMP1 variants had similar effects on the expression of these critical proteins, further suggesting that the 117

134 signature amino acid changes do not enhance or detract from the ability to deregulate the cell cycle. Interestingly, the regulation of the cdki proteins by LMP1 appears to be limited to p27 as p21 levels were not changed in HFK cells. Also, hyperphosphorylated and total protein levels of Rb were increased in LMP1-expressing HFK cells. Although hyperphosphorylated Rb can be targeted for proteasomal degradation (30), LMP1- expressing cells also had increased total levels of Rb. Higher total and hyperphosphorylated levels of Rb were also observed in BL41 cells expressing the B95.8 strain of LMP1 (1), suggesting that LMP1 may either block Rb degradation or induce increased Rb expression while also inducing its hyperphosphorylation. It has been documented that LMP1 activates the NFκB signaling pathway through both CTAR1 and CTAR2 (2, 8, 21, 34, 36, 55). It has also been demonstrated that the CAO strain, most similar to China 1, and Med+ activate NFκB signaling to a larger extent (4, 34). Subsequently, the increased NFκB activity observed with CAO was reported to be due to its lack of HOS binding, an E3 ubiquitin ligase component that regulates IκBα turnover (47, 53, 60). The data presented here confirms that link as increased NFκB reporter activity was observed with the Alaskan, China 1, and Med+ variants compared to B95.8 and the other variants that bound HOS. However, the proposed motifs required for HOS binding did not correctly predict HOS-LMP1 binding indicating that HOS-LMP1 binding is more complex than previously described. Furthermore, IκBα protein levels did not correlate with HOS-LMP1 binding, suggesting that IκBα turnover is regulated by other factors other than HOS. Enhanced NFκB signaling of the LMP1 strain Med+ was previously mapped to the transmembrane domains (34). Other data indicate the 1 st and 6 th transmembrane 118

135 domains of LMP1 are important for proper signaling. Six leucine repeats have been identified that may confer a specific structure when LMP1 self-assembles in the cellular membrane (23) and a FWLY motif in the 1 st transmembrane domain that possibly mediates interactions between LMP1 and other molecules in lipid rafts (61). The 1 st transmembrane domain of the Alaskan and China 2 variants contain two isoleucine mutations in the 6-leucine repeat although the isoleucine substitutions do not disrupt LMP1 signaling with the B95.8 strain (23). In addition, the FWLY motif is unchanged in all the variants. These data suggest that multiple properties of LMP1 contribute to activation of NFκB signaling including HOS binding and self-aggregation which may be affected by the leucine repeats and the FWLY motif. However, it should be noted that all LMP1 variants induce robust NFκB reporter activity. Activation of NFκB is required for continued growth of EBV transformed lymphocytes but is not required for rodent fibroblast transformation. This study reveals that all of the LMP1 variants activate both NFκB and PI-3K/Akt signaling and have equivalent effects on cell growth and transformation. It has previously been shown that the sequence changes that distinguish the LMP1 variants are preferentially located within known and predicted Class I HLA epitopes (11). The similar biologic and biochemical properties of the variants described in this study may suggest that these variants arose and are maintained through immune selection. ACKNOWLEDGEMENTS We would like to thank Dr. David Everly and Betsy Edwards for critical review of the manuscript, Michele Chang for aid in cloning the LMP1 variants into pcdna3, 119

136 Kathy Shair for help with western blots using the Rat monoclonal antibodies, Dr. Serge Fuchs for the HOS plasmids, Dr. Albert Baldwin and Derek Holmes for the NFκB reporter plasmid and Dr. Natalie J. Thornburg for the help with the statistical analysis. This work was supported by National Institutes of Health Grant CA and CA to NRT. 120

137 REFERENCES 1. Arvanitakis, L., N. Yaseen, and S. Sharma Latent membrane protein-1 induces cyclin D2 expression, prb hyperphosphorylation, and loss of TGF-beta 1- mediated growth inhibition in EBV-positive B cells. J Immunol 155: Atkinson, P. G., H. J. Coope, M. Rowe, and S. C. Ley Latent membrane protein 1 of Epstein-Barr virus stimulates processing of NF-kappa B2 p100 to p52. J Biol Chem 278: Babcock, G. J., L. L. Decker, M. Volk, and D. A. Thorley-Lawson EBV persistence in memory B cells in vivo. Immunity 9: Blake, S. M., A. G. Eliopoulos, C. W. Dawson, and L. S. Young The transmembrane domains of the EBV-encoded latent membrane protein 1 (LMP1) variant CAO regulate enhanced signalling activity. Virology 282: Cantley, L. C., and B. G. Neel New insights into tumor suppression: PTEN suppresses tumor formation by restraining the phosphoinositide 3- kinase/akt pathway. Proc Natl Acad Sci U S A 96: Cheung, S. T., S. F. Leung, K. W. Lo, K. W. Chiu, J. S. Tam, T. F. Fok, P. J. Johnson, J. C. Lee, and D. P. Huang Specific latent membrane protein 1 gene sequences in type 1 and type 2 Epstein-Barr virus from nasopharyngeal carcinoma in Hong Kong. Int J Cancer 76: Dawson, C. W., G. Tramountanis, A. G. Eliopoulos, and L. S. Young Epstein-Barr virus latent membrane protein 1 (LMP1) activates the phosphatidylinositol 3-kinase/Akt pathway to promote cell survival and induce actin filament remodeling. J Biol Chem 278: Devergne, O., E. D. Cahir McFarland, G. Mosialos, K. M. Izumi, C. F. Ware, and E. Kieff Role of the TRAF binding site and NF-kappaB activation in Epstein-Barr virus latent membrane protein 1-induced cell gene expression. J Virol 72: Devergne, O., E. Hatzivassiliou, K. M. Izumi, K. M. Kaye, M. F. Kleijnen, E. Kieff, and G. Mosialos Association of TRAF1, TRAF2, and TRAF3 with an Epstein-Barr virus LMP1 domain important for B-lymphocyte transformation: role in NF-kappaB activation. Mol Cell Biol 16:

138 10. Edwards, R. H., F. Seillier-Moiseiwitsch, and N. Raab-Traub Signature amino acid changes in latent membrane protein 1 distinguish Epstein-Barr virus strains. Virology 261: Edwards, R. H., D. Sitki-Green, D. T. Moore, and N. Raab-Traub Potential selection of LMP1 variants in nasopharyngeal carcinoma. J Virol 78: Eliopoulos, A. G., and L. S. Young Activation of the cjun N-terminal kinase (JNK) pathway by the Epstein-Barr virus-encoded latent membrane protein 1 (LMP1). Oncogene 16: Everly, D. N., Jr., S. Kusano, and N. Raab-Traub Accumulation of cytoplasmic beta-catenin and nuclear glycogen synthase kinase 3beta in Epstein- Barr virus-infected cells. J Virol 78: Everly, D. N., Jr., B. A. Mainou, and N. Raab-Traub Induction of Id1 and Id3 by Latent Membrane Protein 1 of Epstein-Barr Virus and Regulation of p27/kip and Cyclin-Dependent Kinase 2 in Rodent Fibroblast Transformation. J Virol 78: Fahraeus, R., H. L. Fu, I. Ernberg, J. Finke, M. Rowe, G. Klein, K. Falk, E. Nilsson, M. Yadav, P. Busson, T. Tursz, and B. Kallin Expression of Epstein-Barr virus-encoded proteins in nasopharyngeal carcinoma. Int J Cancer 42: Fielding, C. A., K. Sandvej, A. Mehl, P. Brennan, M. Jones, and M. Rowe Epstein-Barr virus LMP-1 natural sequence variants differ in their potential to activate cellular signaling pathways. J Virol 75: Fischer, N., B. Kopper, N. Graf, J. R. Schlehofer, F. A. Grasser, and N. Mueller-Lantzsch Functional analysis of different LMP1 proteins isolated from Epstein-Barr virus-positive carriers. Virus Res 60: Gumbiner, B. M Cell adhesion: the molecular basis of tissue architecture and morphogenesis. Cell 84: Higuchi, M., K. M. Izumi, and E. Kieff Epstein-Barr virus latentinfection membrane proteins are palmitoylated and raft-associated: protein 1 122

139 binds to the cytoskeleton through TNF receptor cytoplasmic factors. Proc Natl Acad Sci U S A 98: Izumi, K. M., and E. D. Kieff The Epstein-Barr virus oncogene product latent membrane protein 1 engages the tumor necrosis factor receptor-associated death domain protein to mediate B lymphocyte growth transformation and activate NF-kappaB. Proc Natl Acad Sci U S A 94: Kaye, K. M., O. Devergne, J. N. Harada, K. M. Izumi, R. Yalamanchili, E. Kieff, and G. Mosialos Tumor necrosis factor receptor associated factor 2 is a mediator of NF-kappa B activation by latent infection membrane protein 1, the Epstein-Barr virus transforming protein. Proc Natl Acad Sci U S A 93: Kaye, K. M., K. M. Izumi, and E. Kieff Epstein-Barr virus latent membrane protein 1 is essential for B-lymphocyte growth transformation. Proc Natl Acad Sci U S A 90: Kaykas, A., K. Worringer, and B. Sugden LMP-1's transmembrane domains encode multiple functions required for LMP-1's efficient signaling. J Virol 76: Kieff, E., and A. B. Rickinson Epstein-Barr Virus and Its Replication, p In B. N. Fields, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman, S. E. Straus, and D. M. Knipe (ed.), Field's Virology, Fourth ed, vol. 2. Lippincott Williams & Wilkins Publishers, Philadelphia, PA. 25. Kim, K. R., T. Yoshizaki, H. Miyamori, K. Hasegawa, T. Horikawa, M. Furukawa, S. Harada, M. Seiki, and H. Sato Transformation of Madin- Darby canine kidney (MDCK) epithelial cells by Epstein-Barr virus latent membrane protein 1 (LMP1) induces expression of Ets1 and invasive growth. Oncogene 19: Kusano, S., and N. Raab-Traub I-mfa domain proteins interact with Axin and affect its regulation of the Wnt and c-jun N-terminal kinase signaling pathways. Mol Cell Biol 22: Li, H. M., Z. H. Zhuang, Q. Wang, J. C. Pang, X. H. Wang, H. L. Wong, H. C. Feng, D. Y. Jin, M. T. Ling, Y. C. Wong, A. G. Eliopoulos, L. S. Young, D. P. Huang, and S. W. Tsao Epstein-Barr virus latent membrane protein 1 123

140 (LMP1) upregulates Id1 expression in nasopharyngeal epithelial cells. Oncogene 23: Li, S. N., Y. S. Chang, and S. T. Liu Effect of a 10-amino acid deletion on the oncogenic activity of latent membrane protein 1 of Epstein-Barr virus. Oncogene 12: Lo, A. K., D. P. Huang, K. W. Lo, Y. L. Chui, H. M. Li, J. C. Pang, and S. W. Tsao Phenotypic alterations induced by the Hong Kong-prevalent Epstein- Barr virus-encoded LMP1 variant (2117-LMP1) in nasopharyngeal epithelial cells. Int J Cancer 109: Lozano, G., and G. P. Zambetti Gankyrin: an intriguing name for a novel regulator of p53 and RB. Cancer Cell 8: Luo, J., B. D. Manning, and L. C. Cantley Targeting the PI3K-Akt pathway in human cancer: rationale and promise. Cancer Cell 4: Mainou, B. A., D. N. Everly, Jr., and N. Raab-Traub Epstein-Barr virus latent membrane protein 1 CTAR1 mediates rodent and human fibroblast transformation through activation of PI3K. Oncogene 24: Mehl, A. M., J. E. Floettmann, M. Jones, P. Brennan, and M. Rowe Characterization of intercellular adhesion molecule-1 regulation by Epstein-Barr virus-encoded latent membrane protein-1 identifies pathways that cooperate with nuclear factor kappa B to activate transcription. J Biol Chem 276: Miller, W. E., J. L. Cheshire, A. S. Baldwin, Jr., and N. Raab-Traub The NPC derived C15 LMP1 protein confers enhanced activation of NF-kappa B and induction of the EGFR in epithelial cells. Oncogene 16: Miller, W. E., R. H. Edwards, D. M. Walling, and N. Raab-Traub Sequence variation in the Epstein-Barr virus latent membrane protein 1. J Gen Virol 75 ( Pt 10): Miller, W. E., G. Mosialos, E. Kieff, and N. Raab-Traub Epstein-Barr virus LMP1 induction of the epidermal growth factor receptor is mediated through a TRAF signaling pathway distinct from NF-kappaB activation. J Virol 71:

141 37. Morin, P. J beta-catenin signaling and cancer. Bioessays 21: Morrison, J. A., A. J. Klingelhutz, and N. Raab-Traub Epstein-Barr virus latent membrane protein 2A activates beta-catenin signaling in epithelial cells. J Virol 77: Mosialos, G., M. Birkenbach, R. Yalamanchili, T. VanArsdale, C. Ware, and E. Kieff The Epstein-Barr virus transforming protein LMP1 engages signaling proteins for the tumor necrosis factor receptor family. Cell 80: Niederman, J. C., A. S. Evans, L. Subrahmanyan, and R. W. McCollum Prevalence, incidence and persistence of EB virus antibody in young adults. N Engl J Med 282: Ohtani, N., P. Brennan, S. Gaubatz, E. Sanij, P. Hertzog, E. Wolvetang, J. Ghysdael, M. Rowe, and E. Hara Epstein-Barr virus LMP1 blocks p16ink4a-rb pathway by promoting nuclear export of E2F4/5. J Cell Biol 162: Paine, E., R. I. Scheinman, A. S. Baldwin, Jr., and N. Raab-Traub Expression of LMP1 in epithelial cells leads to the activation of a select subset of NF-kappa B/Rel family proteins. J Virol 69: Poligone, B., and A. S. Baldwin Positive and negative regulation of NFkappaB by COX-2: roles of different prostaglandins. J Biol Chem 276: Puls, A., A. G. Eliopoulos, C. D. Nobes, T. Bridges, L. S. Young, and A. Hall Activation of the small GTPase Cdc42 by the inflammatory cytokines TNF(alpha) and IL-1, and by the Epstein-Barr virus transforming protein LMP1. J Cell Sci 112 ( Pt 17): Raab-Traub, N Epstein-Barr virus in the pathogenesis of NPC. Semin Cancer Biol 12: Roberts, M. L., and N. R. Cooper Activation of a ras-mapk-dependent pathway by Epstein-Barr virus latent membrane protein 1 is essential for cellular transformation. Virology 240:

142 47. Rodriguez, M. S., J. Wright, J. Thompson, D. Thomas, F. Baleux, J. L. Virelizier, R. T. Hay, and F. Arenzana-Seisdedos Identification of lysine residues required for signal-induced ubiquitination and degradation of I kappa B- alpha in vivo. Oncogene 12: Scholle, F., K. M. Bendt, and N. Raab-Traub Epstein-Barr virus LMP2A transforms epithelial cells, inhibits cell differentiation, and activates Akt. J Virol 74: Sitki-Green, D., M. Covington, and N. Raab-Traub Compartmentalization and transmission of multiple epstein-barr virus strains in asymptomatic carriers. J Virol 77: Sitki-Green, D., R. H. Edwards, J. Webster-Cyriaque, and N. Raab-Traub Identification of Epstein-Barr virus strain variants in hairy leukoplakia and peripheral blood by use of a heteroduplex tracking assay. J Virol 76: Sitki-Green, D. L., R. H. Edwards, M. M. Covington, and N. Raab-Traub Biology of Epstein-Barr virus during infectious mononucleosis. J Infect Dis 189: Sugden, B An intricate route to immortality. Cell 57: Tang, W., O. A. Pavlish, V. S. Spiegelman, A. A. Parkhitko, and S. Y. Fuchs Interaction of Epstein-Barr virus latent membrane protein 1 with SCFHOS/beta-TrCP E3 ubiquitin ligase regulates extent of NF-kappaB activation. J Biol Chem 278: Tetsu, O., and F. McCormick Beta-catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature 398: Thornburg, N. J., R. Pathmanathan, and N. Raab-Traub Activation of nuclear factor-kappab p50 homodimer/bcl-3 complexes in nasopharyngeal carcinoma. Cancer Res 63: Tsai, C. N., C. L. Tsai, K. P. Tse, H. Y. Chang, and Y. S. Chang The Epstein-Barr virus oncogene product, latent membrane protein 1, induces the downregulation of E-cadherin gene expression via activation of DNA methyltransferases. Proc Natl Acad Sci U S A 99:

143 57. Tsao, S. W., Y. Liu, X. Wang, P. W. Yuen, S. Y. Leung, S. T. Yuen, J. Pan, J. M. Nicholls, A. L. Cheung, and Y. C. Wong The association of E- cadherin expression and the methylation status of the E-cadherin gene in nasopharyngeal carcinoma cells. Eur J Cancer 39: Wang, D., D. Liebowitz, and E. Kieff An EBV membrane protein expressed in immortalized lymphocytes transforms established rodent cells. Cell 43: Wang, F., C. Gregory, C. Sample, M. Rowe, D. Liebowitz, R. Murray, A. Rickinson, and E. Kieff Epstein-Barr virus latent membrane protein (LMP1) and nuclear proteins 2 and 3C are effectors of phenotypic changes in B lymphocytes: EBNA-2 and LMP1 cooperatively induce CD23. J Virol 64: Yaron, A., A. Hatzubai, M. Davis, I. Lavon, S. Amit, A. M. Manning, J. S. Andersen, M. Mann, F. Mercurio, and Y. Ben-Neriah Identification of the receptor component of the IkappaBalpha-ubiquitin ligase. Nature 396: Yasui, T., M. Luftig, V. Soni, and E. Kieff Latent infection membrane protein transmembrane FWLY is critical for intermolecular interaction, raft localization, and signaling. Proc Natl Acad Sci U S A 101: Young, L., C. Alfieri, K. Hennessy, H. Evans, C. O'Hara, K. C. Anderson, J. Ritz, R. S. Shapiro, A. Rickinson, E. Kieff, and J. Cohen Expression of Epstein-Barr virus transformation-associated genes in tissues of patients with EBV lymphoproliferative disease. N Engl J Med 321:

144 CHAPTER FOUR UNIQUE SIGNALING PROPERTIES OF CTAR1 IN LMP1-MEDIATED TRANSFORMATION Bernardo A. Mainou and Nancy Raab-Traub

145 ABSTRACT The Epstein-Barr virus (EBV) latent membrane protein 1 (LMP1) is the EBV oncogene as it is necessary for EBV-mediated transformation of B-lymphocytes and itself transforms rodent fibroblasts. LMP1 activates the NFκB, PI3K-Akt, MAPK and JNK signaling pathways through its two signaling domains carboxyl-terminal activating regions 1 and 2 (CTAR1 and CTAR2). CTAR1 and CTAR2 induce signal transduction pathways through their direct, CTAR1, or indirect, CTAR2, recruitment of TNFR-associated factors (TRAFs). CTAR1 has been demonstrated to be necessary for LMP1-mediated transformation as well as activation of PI3K signaling and induction of cell cycle markers associated with G 1 /S transition. In this study, dominant negative forms of TRAF2 and TRAF3 inhibited, but did not fully block, LMP1-mediated transformation. Activation of PI3K-Akt signaling as well as the deregulation of cell-cycle markers was mapped to the TRAF-binding domain within CTAR1 and to the residues between CTAR1 and CTAR2. Activation of the MEK1/2-ERK1/2 signaling pathway through the TRAF-binding site was necessary for LMP1-induced transformation of Rat-1 fibroblasts. These findings identify a new signaling pathway that is uniquely activated by the TRAF-binding domain of LMP1. INTRODUCTION Epstein-Barr virus (EBV) is a ubiquitous herpesvirus that is associated with a variety of malignancies including nasopharyngeal-carcinoma (NPC), Hodgkin lymphoma, posttransplant lymphoma, and others (28, 41, 53, 54). The EBV-encoded latent membrane protein 1 (LMP1) is considered the EBV oncogene as it is essential for EBV-mediated B- lymphocyte and itself can transform rodent fibroblasts (2, 27, 49). LMP1 is frequently 129

146 expressed in EBV malignancies, such as the aforementioned NPC and Hodgkin lymphoma (18, 53). LMP1 consists of 386 amino acids that form a short 23 amino-terminal cytoplasmic end, six hydrophobic transmembrane domains, and a long carboxyl-terminal tail that contains the two main signaling domains, carboxyl-terminal activating regions 1 and 2 (CTAR1 and CTAR2). LMP1 self-associates in the plasma membrane. Not requiring a ligand, LMP1 acts as a constitutively active tumor necrosis factor receptor (TNFR) by mediating signaling through the recruitment of TNFR-associated factors (TRAFs) by CTAR1 or through recruitment of adapter molecules such as TNFR-associated death domain (TRADD) or the Receptor Interacting Protein 1 (RIP1) by CTAR2 (23, 25, 38). CTAR1 recruits TRAF1/2 or TRAF3/5 heterodimers through a consensus TRAF binding domain (PQQAT) whereas CTAR2 recruits TRAFs 2 and 6 through adapter molecules (28). LMP1 activates various signaling pathways including NFkB, mitogen-activated protein kinase (MAPK), c-jun N-terminal kinase, and phosphatidylinositol 3-kinase (PI3K)- Akt pathways (9, 16, 25, 33, 37, 40, 42, 47). LMP1 also induces the deregulation of various cellular markers associated with G1/S cell-cycle transition, including the upregulation of the inhibitor of differentiation (Id) 1 and 3, downregulation of cyclin-dependent kinase inhibitor (cdki) p27 Kip1 and p16 INK4a, upregulation of cyclin dependent kinase 2 (CDK2), and upregulation retinoblastoma (Rb) (17, 29, 39). Although both CTAR1 and CTAR2 recruit TRAFs, they yield different effects on the signal transduction pathways they activate. CTAR1, but not CTAR2, is necessary for rodent fibroblast transformation and EBV-mediated B-lymphocyte transformation (25, 33). Although CTAR2 induces the bulk of NFκB signaling, CTAR1 induces a more complex 130

147 signal, inducing both canonical and non-canonical forms of NFκB including p50/p50 and p50/p52 dimers (14, 26, 35, 48). While CTAR2 activates the JNK signaling cascade, CTAR1 activates PI3K-Akt signaling, including the Akt target glycogen synthase kinase β (GSK3β) and induces unique effects in cellular gene expression including the induction of epithelial growth factor receptor (EGFR), TRAF1, and Id1 and Id3 while repressing p27 (10, 11, 13, 17, 33, 36). The activation of PI3K-Akt, but not NFκB, is required for Rat-1 fibroblast transformation (33). The presence or absence of a specific TRAF can determine the outcome of the signal being transduced by LMP1. Although CTAR2, but not CTAR1, activates JNK signaling in epithelial cells, overexpression of TRAF1 allows CTAR1 to activate JNK signaling (15). In TRAF2 and TRAF5 knockout mouse embryo fibroblasts (MEF) LMP1 mediated NFκB activation is similar to wild-type MEFs and this activation is highly dependent on TRAF6 (32). In contrast, in mouse lymphoma cells, NFκB and IgM secretion are almost completely TRAF3 dependent (51, 52). In this study, the role of the TRAF-binding domain, TRAF2, and TRAF3 in rodent fibroblast transformation and signal transduction was evaluated. Blockade of TRAF2 or TRAF3 signaling with dominant negative TRAFs (dntraf) impaired, but did not block, LMP1-induced transformation of Rat-1 cells. LMP1 mutants in the carboxyl-terminal tail and the TRAF-binding domain indicate that CTAR1 mediates the majority of PI3K-Akt signaling, deregulation of cellular markers associated with G 1 /S transition and induces a decrease in the protein levels of the desmosome-associated protein plakoglobin. The activation of extracellular signal regulated kinase (ERK1/2) was uniquely activated by CTAR1 and this activation is necessary for LMP1-mediated transformation of rodent 131

148 fibroblasts. These data identify a signaling pathway that is uniquely activated by CTAR1 and is necessary for LMP1-mediated transformation. MATERIALS AND METHODS Plasmids. LMP1 and LMP1 mutants were cloned into the pbabe-puromycin (pbabe) vector with a hemagglutinin (HA) tag at the amino-terminus. LMP1-A5 ( AAAAA), LMP , LMP1-204/6AA, and LMP1-208A were subcloned from plasmids described in (35) into pbabe with the same primers used to clone full-length LMP1 in (17). Truncation mutants with unaltered CTAR1 utilized the full-length LMP1 construct and truncation mutants with a mutated CTAR1 (A5) utilized the LMP1-A5 construct. PCR amplification of the LMP1 mutants used the same 5 primer (LMP1-HA5 used to clone full-length LMP1) but different 3 primers primer 3TMSTOP (ATCACGAGGAATTCCTATTAATGGTAATACATCCAGATTAAAATCGCC) with the 3 primer 3TM195 (ATCACGAGGAATTCCTATTAGTGTTCATCACTGTGTCGTTGTC) with the 3 primer 3TM203 (ATCACGAGGAATTCCTATTAGTGCGGGAGGGAGTCATC) with the 3 primer TM-208 (ATCACGAGGAATTCCTATTAGGTAGCTTGTTGAGGGTGCG) A5 with the 3 primer TM-2085A (ATCACGAGGAATTCCTATTAGGCAGCTGCTGCAGCGTG) and A5 with the 3 primer 3TM220 (ATCACGAGGAATTCCTATTAGTTGGAGTTAGAGTCAGATTCATGG). LMP1-378Stop and A5-378Stop with the 3 primer 378STOP (ATCACGAGGAATTCCTATTAGCCGTGGGGGTCGTCATC). LMP1-Y384G and A5-132

149 Y384G with the 3 primer Y384G (ATCACGAGGAATTCCTATTATTAGTCATAGCCGCTTAGCTGAACTGG). PCR amplification was followed by restriction enzyme digestion and insertion into the BamHI and EcoRI sites of pbabe-m3 (with puromycin or hygromycin cassette). An expression cassette encoding three tandem myc-epitope tags was moved from M3-LMP1 (17) to pbabe-puro for retroviral expression of myc-tagged proteins. The myc-tag was amplified with M3EBH5 (CGCCGGATCCAGATCTAAGCTTGCCGCTCGAGCCACCATGGAACAAAAG) and M3Bam3 (CGTGTTCCATATGGATCCGAG), digested with Bgl II and BamH I, and cloned into the BamH I site of pbabepuro. Cloning in frame with the myc-tag results in triple-myc-tagged proteins. The dominant negative TRAF6 (dntraf6) construct was a gift from Ilona Jaspers (7). Dominant negative TRAF2 (dntraf2) and dominant negative TRAF3 (dntraf3) were subcloned in frame into pbabe-m3 (containing a triple myc tag) from plasmids described in (37). dntraf2 was PCR amplified with the 5 primer TRF2DN5 (CGACGGATCCATAGGGAGGTGGAGAGCCTGCCG) and the 3 primer TRF2DN3 (ATCACGAGGTCGACTTAGAGCCCTGTCAGGTCCACAATGG). dntraf3 was PCR amplified with the 5 primer TRF3DN5 (CGACGGATCCTAGAGGAAGCAGACAGCATGAAGAGCAG) and the 3 primer TRF3DN3 (ATCACGAGGTCGACTCAGGGATCGGGCAGATCCGAAG). PCR amplification was followed by restriction enzyme digestion and insertion into the BamHI and SalI sites of pbabe-m3 (puromycin and hygromycin) was described previously (17). 133

150 LMP1 was cloned into retroviral packaging vector phscg (kindly provided by Lishan Su, UNC-CH, (8)) co-expressing GFP under the control of the CMV promoter. HAtagged LMP1 was amplified using HA-EcoRI (GCCGAATTCATGGCTTACCCATACGATGTTCCAG) and LMP1 SalI (GCGGTCCAGAATGTGGCTTTTCAGCCTAGAC) primers, digested with EcoR I and Sal I, and ligated into the EcoR I and Xho I sites of phscg by compatible ends. Retrovirus production and transduction. Retrovirus production was prepared as described previously (17). Briefly, subconfluent HEK-293T (293T) cells were triple transfected with 5µg of pbabe or phscg or each of the pbabe-ha-tagged LMP1 constructs or phscg-lmp1, 5µg of pvsvg, and 5µg of pgag/pol using Fugene 6 (Roche) transfection reagent according to the manufacturers directions. Following overnight incubation at 37ºC the media were replaced with fresh media (DMEM (GIBCO) with 10% fetal bovine serum (FBS; Sigma) and antibiotic/antimycotic (GIBCO)) and cells were incubated at 33ºC overnight. Cell supernatant containing the retrovirus was clarified by centrifugation at 1,000 x g for 5 min. Rat-1 cells were then transduced with the clarified supernatant and 4 µg/ml polybrene overnight. Cell culture and stable cell lines. Rat-1 fibroblasts and 293T cells were maintained in DMEM supplemented with 10% FBS (Sigma) and antibiotic/antimycotic (GIBCO). Rat-1 cells were prepared fresh and maintained for no more than 5 passages for each experiment. Stable cell lines with pbabe, the LMP1 constructs, or the dntrafs were established by transduction with recombinant retrovirus followed by selection with 5µg/ml of puromycin (Sigma). Alternatively dntraf stable cells were kept under hygromycin (Cellgro) at a concentration of 200µg/ml. 134

151 Focus formation and soft agars. Subconfluent Rat-1 cells were transduced with recombinant retrovirus in six-well plates overnight. Cells were then maintained by changing the media every other day for days. To assay for focus formation in the presence of U0126 (Calbiochem), stable cell lines were established as described previously and seeded in duplicate six well plates. Upon reaching confluence and every other day thereafter for 7-10 days, fresh media containing 10µM U0126 or vehicle control (dimethyl sulfoxide; DMSO from Sigma) was added to the cells. Cells were then stained with 1% crystal violet in 50% ethanol and imaged with a stereo microscope. Soft agar assays were performed as described previously (33, 45). Briefly, Bacto agar medium (5% Bacto agar in DMEM with 10% FBS and antibiotic/antimycotic to a 0.5% final concentration) was poured into a 12-well plate and allowed to solidify. 1.0 x 10 5 to 2.0 x 10 5 cells/well were resuspended in Bacto agar medium, over-laid on the initial layer of solidified Bacto agar medium and allowed to solidify. Medium was added on top of the solidified Bacto agar medium and changed every 2-3 days for days. For the dntraf soft agars, medium was supplemented with 5µg/ml of puromycin to maintain stable expression of the dntrafs. Cells were imaged with phase-contrast microscopy and fluorescence microscopy to verify GFP expression. Cell harvesting and western blotting. Cell lines were grown to confluence and harvested as described previously (17). Briefly, after being harvested, cells were washed with ice-cold PBS (GIBCO), centrifuged at 1,000 x g, and lysed with radioimmunoprecipitation assay buffer (RIPA; 20mM Tris-HCl ph 7.5, 150mM NaCl, 1mM EDTA, 1% NP40, 0.1% sodium dodecyl sulfate (SDS), 0.1% deoxycholate, 0.5mM phenylmethylsulfonyl fluoride (PMSF), 1mM Na 3 VO 4, and protease and phosphatase 135

152 inhibitor cocktails from Sigma). Lysates were incubated on ice for 10 minutes, clarified by centrifugation, and protein concentration was determined using the Bio-Rad DC protein assay system. Lysates were boiled in SDS-sample buffer for 5 minutes, 12.5 or 25.0 µg of protein was separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to an Optitran membrane (Whatman) for western blot analysis, and efficient transfer was confirmed with Ponceau S staining (Fluka). Primary antibodies used included HA probe (Covance), c-myc tag, β-actin, TRAF6, phospho-erk1/2 (Y473), total ERK1/2, PARP (Santa Cruz), plakoglobin (Abcam), CDK2, Rb (BD Biosciences), total GSK3 (Upstate Biotechnology), phospho-rb (Oncogene, p27/kip (Calbiochem and Cell Signaling), phospho-gsk3β (S9), phospho-cdk2 (T160), phospho-akt (S473), total Akt (Cell Signaling). Densitometry analysis was done with Image J software. RESULTS CTAR1 is necessary for rodent fibroblast transformation. LMP1 is considered the EBV oncogene for its ability to block contact-inhibited growth and induce anchorageindependent growth in Rat-1 fibroblasts (17, 33, 49). CTAR1, but not CTAR2, is required for rodent fibroblast transformation (33). To assess the role of the TRAF-binding domain in rodent fibroblast transformation two TRAF-binding domain mutants were developed. LMP1-A5 has the TRAF-binding domain mutated from PQQAT to AAAAA and LMP has a deletion of the TRAF-binding domain encompassing amino acids To determine whether these constructs were able to block contact-inhibited growth Rat- 1 fibroblasts were transduced with pbabe (vector), LMP1, (LMP1 deleted for amino acids ), LMP1-A5, and LMP Ten days post transduction cells were 136

153 analyzed for block of contact-inhibited growth as presented by focus formation (Fig. 1). Whereas LMP1 and 1-231, both of which contain CTAR1, induced focus formation, pbabe and the two TRAF-binding domain mutants, LMP1-A5 and LMP did not. Western blot analysis on parallel transduced cells confirmed expression of all four constructs indicating that the failure to block contact-inhibited growth was not due to failed transduction or expression (data not shown). These data reveal that the TRAF-binding domain, amino acids , is necessary for rodent fibroblast transformation. pbabe LMP LMP1-A5 LMP FIG 1. TRAF-binding domain is necessary for LMP1-mediated block of contact-inhibited growth. Rat-1 fibroblasts were transduced with pbabe, LMP1, 1-231, LMP1-A5 or LMP , maintained for 10 days, stained with crystal violet and observed for focus formation. LMP1-mediated transformation is impaired by dntraf2 and dntraf3. The interaction of CTAR1 with several TRAFs, including TRAFs 1, 2, 3, and 5, mediate the activation of signal transduction pathways such as NFκB and induction of key pro-growth cellular molecules like the EGFR (4, 11, 12, 35, 37, 51). To determine if TRAF2 and/or 137

154 TRAF3 mediate the ability of LMP1 to block contact-inhibited growth stable Rat-1 cell lines expressing pbabe-m3, dominant negative TRAF2 (dntraf2) or dominant negative TRAF3 (dntraf3) were established followed by transduction with three serial dilutions of either pbabe or LMP1. Duplicate plates were harvested and expression of the dntrafs and LMP1 was confirmed by western blot analysis (data not shown). DnTRAFs contain the TRAFbinding domain but have been deleted of their RING and zinc-finger domains thus allowing interaction with their target molecule while impairing their ability to induce signaling upon their recruitment. Fourteen days post-transduction cells were observed for focus formation (Fig. 2). Transduction of the pbabe-m3 (vector) stables with pbabe (pbabe-m3-pbabepuro), or the stable cells expressing only dntraf2 or dntraf3 did not show signs of focus formation. In contrast, transduction of the pbabe-m3, dntraf2, or dntraf3 stable cells with LMP1 induced focus formation. Furthermore, Rat-1 cells stably expressing dntraf6 transduced with LMP1 formed foci to similar levels than the vector control cells, indicating that TRAF6 is not involved in mediating LMP1 signals involved in transformation (data not shown). Although dntraf2 or dntraf3 did not completely ablate focus formation they markedly reduced the number of foci. Quantitative analysis of the foci showed that dntraf2 and dntraf3 repress focus formation by around 2.5 fold (data not shown). Furthermore, anchorage-independent growth was also impaired, but not fully blocked, by either dntraf2 or dntraf3 (data not shown). These data suggest that TRAF2 and TRAF3, but not TRAF6, contribute in LMP1-mediated transformation but are not fully required for the transformation process. The inability for dntraf2 and dntraf3 to fully block LMP1-mediated transformation suggests that some redundancy is associated with 138

155 LMP1-TRAF signaling. Indeed, in TRAF2 and TRAF5 knockout MEFs, LMP1 can still mediate nuclear translocation of the NFκB subunit p65 (31). pbabem3-pbabepuro dntraf2 dntraf3 pbabem3-lmp pbabem3-lmp pbabem3-lmp dntraf2-lmp dntraf2-lmp dntraf3-lmp dntraf3-lmp FIG. 2. LMP1-mediated transformation of Rat-1 fibroblasts is inhibited by dntraf2 and dntraf3. Rat-1 fibroblasts stably expressing pbabe-m3, dntraf2, or dntraf3 were transduced with pbabe or LMP1 with three serial dilutions, maintained for 14 days, stained with crystal violet and observed for focus formation. Role of CTAR1 in LMP1 signal transduction. To further evaluate the role of CTAR1 in the induction of several signal transduction pathways additional LMP1 mutants were constructed (Fig. 3). The serial truncation LMP1 mutants encompass from the start of the carboxyl-terminal tail at amino acid 188 to amino acid 231. Two more full-length LMP1 mutants of CTAR1, LMP1-204/6AA (two alanine substitutions at amino acids 204 and 206) and LMP1-208A (alanine substitution at amino acid 208), were subcloned to evaluate the role of CTAR1. Finally, a CTAR2 deletion mutant (LMP1-378Stop) and a point mutant that has been described to abrogate most CTAR2 activity (LMP1-Y384G) were constructed with 139

156 a functional CTAR1 and a mutant CTAR1 (A5-378Stop and A5-Y384G) (3, 19). All LMP1 constructs were hemagglutinin (HA)-tagged on the amino-terminus. 1 PxQxT 1x AAAAA 1 AxAxT 1 PxQxA 2 YYD 2 YYD 2 YYD 2 YYD LMP1 LMP1-A5 LMP1-204/6AA LMP1-208A 1 PxQxT x1 AAAAA 1 PxQxT x1 AAAxA 2x GYD x2 GYD 2 2 LMP1-Y384G A5-Y384G LMP1-378STOP A5-378STOP x PxQxT 1 AAAxA 1 PxQxT 1x AAAxA 1 PxQxT A A FIG. 3. Graphical representation of LMP1 mutants. All constructs are amino-terminal HA tagged. CTAR1 and CTAR2 are represented by a circle with number 1 or 2 respectively. Substitutions to CTAR1 or CTAR2 are underlined. Bottom row delineates truncation mutants. Rat-1 fibroblasts stably expressing pbabe, LMP1, LMP , 1-187, 1-195, 1-203, 1-220, and were assayed for their ability to modulate three aspects of transformation that have been linked to LMP1; PI3K-Akt signaling, cell-cycle deregulation, and cellular adhesion (Fig. 4A). Expression of LMP1 was confirmed using antibodies against the amino-terminal HA-tag. The variation in the levels of LMP1 expression are due to ubiquitination and proteasomal degradation being mediated by CTAR1-TRAF binding (43). As reported previously, full-length LMP1 induced activation of the PI3K-Akt signaling pathway as represented by phosphorylation and inactivation of the Akt-target GSK3β. Furthermore, the LMP1 mutants and 1-231, which are deleted for CTAR2, also 140

157 induced increased levels of phosphorylated GSK3β although had the strongest induction. Interestingly, deletion of the TRAF-binding domain in full-length LMP1 (LMP ) resulted in a 2 fold reduction of phosphorylated GSK3β compared to fulllength LMP1 (Fig. 4B). A pbabe LMP1 LMP B HA p-gsk3β α GSK3 β Plakoglobin Fold Induction pgsk3b Plakoglobin Rb CDK2 Rb 0.0 pbabe LMP1 D LMP1 Construct Actin FIG. 4. CTAR1 induces activation of PI3K-Akt signaling and deregulates markers associated with cell-cycle progression. (A) Rat-1 stable cells expressing pbabe, LMP1, or LMP1 mutants were assayed for expression with HA antibodies, phosphorylated-gsk3β (S9), total GSK3 (α and β forms), plakoglobin, CDK2 (hyperphosphorylated CDK2 is marked by the arrowhead), total Rb, and actin as a loading control by western blot analysis. (B) Quantitative analysis of protein levels of pgsk3b (white bars), plakoglobin (black bars), and Rb (striped bars). Values are in fold induction compared to pbabe. Increased levels of hyperphosphorylated CDK2 (top band; arrowhead) and increased levels of total Rb, cellular markers involved in G 1 /S cell-cycle progression, were observed in LMP1, LMP , 1-220, and Plakoglobin, a cellular protein associated with cell-cell adhesion, was also downregulated by LMP1, LMP , 1-220, and

158 The ability of the non-transforming LMP to modulate GSK3β, plakoglobin, CDK2 and Rb to similar levels as the transforming is surprising. Comparison of the truncation mutants, 1-187, 1-195, 1-203, 1-220, and 1-231, suggest that the TRAF-binding domain is required to modulate these cellular changes. However, comparison of LMP1 and LMP indicates that the TRAF-binding domain is only partially responsible for these cellular effects. These data indicate that although CTAR1, or TRAF-binding domain, is the main effector in modulating these cellular pathways, there is another site within fulllength LMP1 that augments the ability of the TRAF-binding domain to affect these cellular changes. Mutations in CTAR1 ameliorate LMP1 transforming potential. Two residues within the TRAF-binding domain, the proline at amino acid 204 and the glutamine at position 206, that constitute CTAR1 have been found to play an important role in TRAF binding (35). To further evaluate the role of the residues within CTAR1 in rodent fibroblast transformation, Rat-1 cells were transduced with pbabe, LMP1, LMP1-A5, 1-195, 1-203, 1-208, A5, 1-220, A5, 1-231, LMP1-204/6AA, and LMP1-208A and assayed for the ability to block contact-inhibited growth (Fig. 5). LMP1, 1-220, 1-231, LMP1-208A, and LMP1-204/6AA formed foci. Although LMP1-204/6AA was not fully inhibited for focusformation, it was highly impaired in the ability to block-contact inhibited growth as represented by smaller foci. LMP1-208A formed foci to similar levels than LMP1 indicating that the threonine residue at position 208 in the TRAF-binding site is not necessary for transformation. Although did not form foci even though the TRAF-binding site is intact, previous studies demonstrated that the aspartic acid residue at position 210 is necessary for proper TRAF3 binding, suggesting that could be non-transforming due 142

159 to a TRAF-binding defect (50). Furthermore, substitution of CTAR1 to all alanine residues (LMP1-A5 or A5) or deletion of CTAR1 (1-195 or 1-203) inhibited transformation. These data indicate that the TRAF-binding site is required for transformation and that the residues between amino acids 208 and 220 are required for transformation. pbabe LMP1 LMP1-A A A LMP1-204/6AA LMP1-208A FIG. 5. Mutation of proline and glutamine residues in CTAR1 impair LMP1-induced transformation. Rat-1 cells were transduced with pbabe, LMP1, or LMP1 mutants, maintained for 14 days, stained with crystal violet and observed for focus formation. Effects of mutation of TRAF-binding domain in LMP1 signaling. To evaluate the role of CTAR1 and the amino acids surrounding CTAR1 in LMP1-mediated signal transduction, Rat-1 stable cells expressing LMP1 and several LMP1-mutants were established and their ability to induce various signal transduction pathways was assessed through western blot analysis (Fig. 6). LMP1, 1-208, 1-220, 1-231, and LMP1-208A had a moderate increase of phospho-gsk3β (Fig. 6A). Mutation (LMP1-A5) or deletion 143