Virus neutralization reveals antigenic variation among feline immunodeficiency virus isolates

Transcription

1 Journal of General Virology (1994), 75, Printed in Great Britain 3641 Virus neutralization reveals antigenic variation among feline immunodeficiency virus isolates Robert Osborne, l* Mark Rigby, 1 Kees Siebelink, ~ James C. Neil I and Oswald Jarrett 1. 1 MRC Retrovirus Research Laboratory, Department of Veterinary Pathology, University of Glasgow, Bearsden, Glasgow G61 1QH, U.K. and 2Department of Immunology, RIVM, Bilthoven, The Netherlands By using a focus reduction assay in CrFK feline fibroblast cells, virus neutralizing antibodies (VNA) to feline immunodeficiency virus (FIV) were demonstrated in cats that had been naturally or experimentally infected with FIV. The antigenic relatedness of four strains of FIV, divergent in nucleotide sequence within the env gene, was investigated by neutralization following adaptation of each virus for growth in CrFK cells. Two of the viruses were from The Netherlands (FIV/AM-4 and AM-6), one was from the U.K. (FIV/GL-8) and one was from the U.S.A. (FIV/PET). Reaction of the viruses in the neutralization assay with cat antibodies to homologous or heterologous strains indicated that while there was a degree of cross-reactivity between all four, there were consistent differences suggesting the existence of FIV neutralization subtypes. In particular, FIV/PET and FIV/AM-6 were closely related but FIV/PET and FIV/GL-8 were clearly distinct. VNA from naturally infected cats in the field showed a pattern of reactivity against FIV/PET and FIV/GL-8 that confirmed the antigenic diversity of FIV. Virus neutralizing antibodies (VNA) are found in man and domestic animals infected with lentiviruses and may be important factors in suppressing viral growth during the asymptomatic state that characterizes much of the course of these infections. Consequently, it is generally considered that immunogens capable of inducing VNA should be included in vaccines to prevent or alleviate lentiviral infections. Certainly, high titres of VNA develop in cats immunized with a vaccine that protects against infection with feline immunodeficiency virus (FIV) (Yamamoto et al., 1991). Since we are interested in possible antigenic variation among FIV isolates that might influence the content of future vaccines, we investigated whether there was antigenic diversity in virus neutralization between FIV isolates. The presence of VNA to the Petaluma strain of FIV (FIV/PET) has been reported in cats naturally or experimentally infected with FIV (Fevereiro et al., 1991 ; Yamamoto et al., 1991 ; Tozzini et al., 1992). Since all of the sera tested neutralized the single virus isolate used in these studies (FIV/PET), it was suggested that there may be little antigenic difference between FIV strains. We have now studied four isolates of FIV from geographically distant areas. All belong to the subgroup A defined by Sodora et al. (1994) and were shown to have distinct env nucleotide sequences, from which they were estimated to be phylogenetically equally divergent (Rigby et al., 1993). We consistently found antigenic differences between them. FIV strains are conventionally isolated in primary cultures of feline peripheral blood T cells (Pedersen et al., 1987). A small proportion of isolates also replicates in the CrFK fibroblast line (Pedersen et al., 1987), This system has proved useful in studies of FIV neutralization because of its great sensitivity (Fevereiro et al., 1991; Tozzini et al., 1992). In the present study four strains of FIV, adapted for growth in CrFK cells, were used. FIV/Glasgow-8 (FIV/GL-8) was isolated in Glasgow from the plasma of a cat from Hayling Island, England (Hosie & Jarrett, 1990). FIV/PET, isolated from a cat in California (Pedersen et al., 1987), was kindly supplied by Dr N. C. Pedersen, University of California, Davis, U.S.A. FIV/Amsterdam strains 4 and 6 (FIV/AM-4 and FIV/AM-6) were isolated from the blood mononuclear cells of two naturally infected cats at Bilthoven, The Netherlands (Siebelink et al., 1994). Each virus was isolated and grown on IL-2-dependent feline T cell cultures in its laboratory of origin and was subsequently adapted for growth in CrFK cells (FIV/GL-8 and PET in Glasgow and FIV/AM-4 and AM-6 in Bilthoven). Virus stocks were made from the clarified culture fluids of infected CrFK cells and were stored at -80 C. It was important to exclude strain contamination in the viral stocks used for the neutralization assays by confirming that the virus growing in each CrFK culture represented the original isolate. This was possible for three of the isolates, FIV/PET, FIV/GL-8 and FIV/ AM-6. Re-analysis of env gene sequences provided an SGM

2 3642 Short communication unequivocal method of confirming strain identity since the three isolates display extensive env sequence variation with the greatest divergence being in the segment encoding the V5 domain of the SU protein (Rigby et al., 1993). One million CrFK cells infected with each virus were lysed by boiling for 5 min in buffer (10mM- Tris-HC1, 1 mm-edta, ph 8), and the clarified supernatant was used directly in a polymerase chain reaction (PCR) using primers from the 5' and 3' ends of the SU coding region. Uninfected cultures were used as negative controls. The sequence at V5 was obtained directly from 1 lag of product purified from the gel using internal primers and standard methodology (Sequenase; United States Biochemicals) and was found to be identical to that previously reported [FIV/PET (Sodora et al., 1994), GenBank accession number M25381; FIV/GL-8 and /AM-6 (Rigby et al., 1993), GenBank accession numbers X69496 and X69499]. For FIV/GL-8 this result demonstrated the invariance of this region of env during adaptation to, and several years subsequent culture in, CrFK cells following original isolation in T cells. While it is possible that sequence changes outside this region arise during adaptation for growth in CrFK cells or after extended passage in vitro, this issue was not addressed here. Strain integrity was also confirmed using isolatespecific PCR to detect any contaminating strains in the viral stocks used in the neutralization assays. Separate 3' primers corresponding to the V5 region of FIV/PET (3' ATATCACCATGATTTTACCGTACAG 5'), FIV/ AM-6 (3' GTCATCGGGACTGTTTTACTTTACA 5') or FIV/GL-8 (3' CATCATGTTTATCACAATTTTA- CCG 5') (Rigby et al., 1993) were used in PCR and failed to show any contamination. Cell mixing experiments indicated a sensitivity of 1 : 1000 for this assay (results not shown). For the cross-neutralization assays, samples of serum or plasma were obtained from cats experimentally inoculated with FIV/GL-8 or FIV/PET approximately 6 months previously, or in the case of FIV/AM-4 and FIV/AM-6, from the pet cat from which each virus was originally isolated. Plasma was also obtained from cats in our specific pathogen free colony and from pet cats presented to veterinarians in general practice. The neutralization assay was similar to that described previously (Fevereiro et al., 1991). CrFK/ID10/R cells were usefll throughout. These cells were derived from the CrFK ID10 clone (the generous gift of Dr P. Anderson, IDEXX Corporation, Portland, Maine, U.S.A.) following transfection with a ras gene by Dr D. Spandidos (NatiOnal Hellenic Research Foundation, Athens, Greece). The cells were plated in 48-well cluster plates at a concentration of 5 x 104 in 1 ml of medium and were incubated overnight at 37 C. The cells were about 85 % confluent when used. Serum or plasma samples were incubated at 56 C for 30 min before use. Equal volumes of serum dilutions and virus, containing 30 to 60 focus forming units (f.f.u.)/well, were incubated for 1 h at 37 C. The culture fluids were then replaced with 320 gl of each virus-serum mixture. Each test was performed in duplicate. After incubation for 75 min at 37 C, the inoculum was replaced with 1 ml of medium and the cells were incubated for a further 4 days at 37 C. Residual infectious virus was quantified by counting loci of F1V antigen-containing cells. The cells were fixed with 1% acetic acid in ethanol for 20 min, washed and incubated for 60 min at 37 C with 5 % normal goat serum as a blocking reagent. After washing, infected cells were detected by incubation with a 1:4500 dilution of anti- FIV p24 monoclonal antibody (1E2) generously supplied by Dr N. C. Pedersen. The cell sheet was washed and incubated with biotinylated horse anti-mouse IgG (Sigma) and streptavidin peroxidase (Vector), each for 15 min at 37 C. Following further washings, a 0.04% solution of aminoethylcarbazole in 0"05 M-acetate buffer ph 4.9 and 0.08 % 30 volume hydrogen peroxide was added for 20 to 30 min at room temperature. Reddishbrown plaques appeared within 5 to 10 min and when the background began to show colouration (usually after a further 10 to 20min) the reaction was stopped by immersing the plate in water. Cells were counterstained using Meyer's haemotoxylin for 10 min and were blued overnight in water. After drying the plates, foci were counted microscopically. The end-point of neutralizing activity was computed by regression analysis as the serum dilution that reduced the number of foci by 75 % relative to virus controls incubated without antibody. The presence of VNA in cats naturally or experimentally infected with FIV was confirmed. Plasma samples from eight naturally infected pet cats which were seropositive in ELISA for antibodies to recombinant FIV proteins CA and M (Reid et al., 1991) were found to have VNA titres to FIV/PET in the range 3200 to (mean ). None of the plasma samples from ten pet cats, seronegative for antibodies to CA or M, had VNA at a dilution of 1:10. As expected, plasma from five specific pathogen free cats had no detectable neutralizing activity. We were able to follow the development of VNA during the course of a natural infection. Callanan et al. (1991) described the infection of a kitten by its mother during the neonatal period. The mother had been inoculated with FIV/GL-8 six weeks before kittening. Plasma samples were obtained from her five kittens at intervals from 3 days to 29 weeks of age. All of the kittens received maternal antibody, measured in an ELISA for anti-ca antibody, which waned with time. However, from 9 weeks onwards the antibody titre of one kitten rose indicating the development of an active

3 Short communication 3643 Table 1. Development of VNA during natural FIV infection Age of VNA titre kitten (weeks) 1 2 Kitten no "3 4680* ND < 32 < 32 < ND ND ND ND ND ND ND ND ND ND ND ND * Sacrificed at 3 days of age. ND, Not done. infection. FIV was isolated subsequently from this kitten when 17 weeks old. In the present study these plasma samples were also examined for VNA to FIV/GL-8. As shown in Table 1, the same overall pattern of antibody development was observed as in the previous study. An exceptionally high VNA titre of was recorded at week 19. Since VNA do not appear before 5 to 6 weeks after experimental infection by inoculation (Fevereiro et al., 1991; Hosie & Jarrett, 1990), infection of kitten 5 could have occurred as early as the first or second week of life and in the presence of the high levels of colostral antibody, supporting the suggestion that VNA do not eliminate virus from infected cats (Fevereiro et al., 1991). With the availability of four isolates of FIV which had been adapted to grow in CrFK cells, and serum or plasma samples from cats infected with these isolates, it was possible to begin to investigate the extent of antigenic cross-reactivity between FIV strains. The results of crossneutralizing assays between these isolates are shown in Table 2. Each test was carried out between two and four times and the average standard error was 15"8 % (range 5 to 31%). All plasma samples had high VNA titres against their homologous viruses. Overall there was some degree of cross-neutralization between strains, with titres of heterologous antibodies sometimes exceeding those of homologous antibodies. The most closely related viruses were FIV/PET and FIV/AM-6. However, it was clear that there were antigenic differences between isolates. Thus, in cross-neutralization tests between the two isolates, antibodies to FIV/GL-8 or FIV/AM-6 neutralized the heterologous virus with a titre of only 11 to 15 % of that to the homologous virus. There was also consistent non-reciprocal cross-neutralization between FIV/GL-8 and FIV/PET: while plasma containing antibodies to FIV/GL-8 neutralized FIV/PET to a level of the same order as the homologous virus, the titre of antibodies to FIV/GL-8 in the plasma of cats infected with FIV/PET was only approximately 7% of that against the homologous strain. In addition, we have repeatedly obtained similar results with sera taken at intervals over a period of 3 years from several cats infected with either of these two viruses. The trivial explanation for the non-reciprocal neutralization between FIV/PET and FIV/GL-8, that FIV/GL-8 is a mixture of viruses, capable of eliciting anti-fiv/pet antibodies in cats by virtue of a minority of FIV/PET, was excluded by testing the strain integrity of each virus as described above. The pattern of reactivity of neutralizing antibodies to FIV/PET and FIV/GL-8 in the plasma of seropositive pet cats from the field was also determined. Plasma samples from nine cats chosen at random were tested twice in the neutralization assay and the ratio of the titre to FIV/PET:titre to FIV/GL-8 was determined for each. Table 3 shows that this ratio varied between cats. Table 2. Cross-neutralization between FIV isolates VNA titre ( x 10 3) anti-fiv/gl-8 anti-fiv/am-4 anti-fiv/am-6 anti-fiv/pet Challenge Titre* Titre Titre Titre virus (S.E.) % (S.E.) % (S.E.) % (S.E) % FIV/GL (2.16) (1.35) (1.24) (0.64) FIV/AM '17 56 (5-51) (1"35) (3"03) (3-32) FIV/AM (0"39) (0"90) (3"31) (1"26) FIV/PET 23"75 (426) (2"00) '25 (9"78) "50 (186) 100 * Mean (standard error). ~ Percentage of titre as a proportion of the t~tre against homologous virus.

4 3644 Short communication Table 3. VNA to FIV isolates in naturally infected cats Assay 1 Assay 2 VNA titre ( 10-3) VNA titre (x 10-3) Plasma to FIV/: to FIV/: Mean no. PET GL-8 Ratio* PET GL-8 Ratio* ratio anti-pet? anti-gl8$ * Ratio of VNA titre to FIV/PET:VNA titre to FIV/GL-8. t Plasma from FIV/PET-infected cat. Plasma from FIV/GL-8-infected cat. While all the seropositive cats had antibodies which neutralized FIV/PET, many neutralized FIV/GL-8 to a greater degree, also suggesting that there is antigenic diversity between FIV strains in the field. From Table 3 it can also be seen that the titrations were highly reproducible (standard error of duplicate determinations was 11% with a range of 2 to 31%). It has been reported that all sera tested from naturally and experimentally infected cats in the U.S.A. and Europe neutralized FIV/PET in a CrFK-based assay (Fevereiro et al., 1991; Tozzini et al., 1992). From subsequent studies in which sera were reacted with FIV/PET and a second isolate, FIV/AM-6, it was concluded that there was little antigenic difference between FIV strains (Tozzini et al., 1993). Our results confirm these observations in part since FIV/PET was neutralized by all the plasma samples tested in the present study. However, the neutralization reactions in these previous reports were performed in only one direction using either FIV/PET or FIV/AM-6, which we now know to be antigenically very closely related. Hence these earlier assays would not have revealed antigenic diversity unless some of the sera tested were completely non-reactive. By contrast, we found that in reciprocal reactions heterologous viruses, such as FIV/GL-8, may not be neutralized completely by antibodies to FIV/PET. Even in the limited survey of plasma samples from naturally infected cats reported here, it was clear that viruses with the reactivity of FIV/GL-8 are common, at least in the U.K. The extent of antigenic variation among a much larger number of FIV isolates will only be possible to determine in assays employing peripheral blood mononuclear cells or primary cultures of T cells in which all FIV isolates grow. Also, the interaction of virus and cells in these systems rather than in CrFK cells may possibly reflect more accurately the neutralization process in vivo. Antigenic variation has already been demonstrated in a T cell system in the characterization of a mutant which had escaped from neutralization following incubation of cells infected with a molecularly cloned FIV in homologous cat antibody (Siebelink et al., 1993). Our results are analogous to those obtained with human immunodeficiency virus type 1 (HIV-1) isolates. While there is cross-reactivity between many isolates of HIV-1 in virus neutralization, especially among those from similar geographical areas, there is also antigenic diversity between strains (Weiss et al., 1986; Cheng- Mayer et al., 1988). Epitopes responsible for antigenic variation have been recorded in the V1, V2 or V3 regions of SU (McKeating et al., 1993). However, the relative importance of each site and the contribution of linear or conformational epitopes to the overall virus neutralization process remains to be defined. The availability of many viral isolates and the capacity to raise antibodies in the target species means that many of these questions may be resolved in the FIV system. It is already clear that linear determinants in the V3 region of FIV SU are immunodominant and are recognized by the great majority of naturally infected cats (Pancino et al., 1993); also, peptides and recombinant proteins representing this region induce VNA antibodies in cats (de Ronde et al., 1994). The functional relevance of antigenic variety among virus isolates may also be resolved for FIV. For example, there is evidence that the antigenic diversity observed in the present study may be important in vaccine design. Thus, cats immunized with a vaccine containing FIV/PET were protected against challenge by the homologous virus (Yamamoto et al., 1991), but not against the antigenically distinct FIV/GL-8 (M. J. Hosie and others, unpublished). It will be important in future to define the extent of antigenic variation among larger numbers of FIV isolates as an aid to the design of vaccines for general use in the field. This research was supported by grants from the AIDS Directed Programme of the Medical Research Council and the European Commission Concerted Action on FIV Vaccination. References CALLANAN, J., HOSIE, M. J. & JARRETT, O. (1991). Transmission of FIV from mother to kitten. Veterinary Record 128, 33~333. CHENG-MAYER, C., HOMSY, J., EVANS, L. A, & LEVY, J. A, (1988). Identification of human immunodeficiency virus subtypes with distinct patterns of sensitivity to serum neutralization. Proceedings' of the National Academy of Sciences, U.S.A. 85, DE RONDE, A., STAM, J. G., BOERS, P., LANGEDtlK, H., MELOEN, R., HESSELINK, W., KELDERMANS, L. C., VAN VLIET, A., VERSCHOOR, E. J. & HORZINEK, M.C. (1994). Antibody response in cats to the

5 Short communication 3645 envelope proteins of feline immunodeficiency virus : identification of an immunodominant neutralization domain. Virology 198, FEVEREIRO, M., RONEKER, C., LAUFS, A., TAVARES, L. & DE NORONHA, F. (1991). Characterization of two monoclonal antibodies against feline immunodeficiency virus gag gene products and their application in an assay to evaluate neutralizing antibody activity. Journal of General Virology 72, HOSIE, M. J. & JAgRETT, O. (1990). Serological responses of cats to feline immunodeficiency virus. AIDS 4, MCKEAT1NG, J. A., SHOTTON, C., CORDELL, J., GRAHAM, S., BALFE, P., SULLIVAN, N., CHARLES~ M.~ PAGE, M., BOLMSTEDT, A., OLOFSSON, S., KAYMAN, C., Wu, Z., PINTER, A., DEAN, C., SODROSKI, J. & WEISS, R. A. (l 993). Characterization of neutralizing monoclonal antibodies to linear and conformation-dependent epitopes within the first and second variable domains of human immunodeficiency virus type 1 gpl20. Journal of Virology 67, PANCINO, G., CHAPPEY, C., SAURIN, W. & SONIGO, P. (1993). B epitopes and selection pressures in feline immunodeficiency virus envelope glycoproteins. Journal of Virology 67, PEDERSEN, N. C., HO, E. W., BROV ~, M. L. & YAMAMOTO, J. K. (1987). Isolation of a T-lymphotropic virus from domestic cats with an immunodeficiency-like syndrome. Science 235, REID, G., RIGBY, M., MCDONALD, M., HOS~E, M., NEIL, J.C. & JARRETT, O. (1991). Immunodiagnosis of feline immunodeficiency virus infection using recombinant viral p17 and p24. AIDS 5, RIGBY, M.A., HOLMES, E.C., PISTELLO, M., MACKAY, A., LEIGH BROWN, A. J. & NEIL, J. C. (1993). Evolution of structural proteins of feline immunodeficiency virus: molecular epidemiology and evidence of selection for change. Journal of Virology 74, 425~,36. SIEBELINK, K. H. J., RIMMELZWAAN, G.F., BOSCH, M.L., MELOEN, R.H. & OSTERHAUS, A. D. M. E. (1993). A single amino acid substitution in hypervariable region 5 of the envelope protein of feline immunodeficiency virus allows escape from virus neutralization. Journal of Virology 67, SIEBELINK, K. H. J., KARLAS, J. A., RIMMELZWAAN, G. F., OSTERHAUS, A. D. M. E. & BOSCH, M.L. (1994). A determinant of feline immunodeficiency virus involved in CrFK cell tropism. Veterinary Immunology and Immunopathology (in press). SODORA, D. L., SHPAER, E. G., KITCHELL, B. E., Dow, S. W., HOOVER, E.A. & MULLINS, J.I. (1994). Identification of three feline immunodeficiency virus (FIV) env gene subtypes and comparison of the FIV and human immunodeficiency virus type 1 evolutionary patterns. Journal of Virology 68, TOZZINI, F., MATTEUCCI, D., BANDECCH1, P., BALDINOTTI, F., POLI, A., PISTELLO, M., SIEBELINK, K. H. J., CECCHERINI-NELLI, L. & BENDIN- ELLI, M. (1992). Simple in vitro methods for titrating feline immunodeficiency virus (FIV) and FIV neutralizing antibodies. Journal of Virological Methods 37, TOZZINI, F., MATTEUCCI, D., BANDECCHI, P., BALDINOTTI, F., SIEBE- LINK, K., OSTERHAUS, A. 8z BENDINELLI, M. (1993). Neutralizing antibodies in cats infected with feline immunodeficiency virus. Journal of Clinieal Microbiology 31, 162(~ WEISS, R. A., CLAPHAM, P. R., WEBER, J. N., DALGLEISH, A. G., LASKY, L. A. 81. BERMAN, P. W. (1986). Variable and conserved neutralization antigens of human immunodeficiency virus. Nature, London 324, YAMAMOTO, J. K., OKUDA, T., ACKLEY, C. D., LOUIE, H., PEMBROKE, E., ZOCHLINSKI, H., MUNN, R.J. & GARDNER, M.B. (1991). Experimental vaccine protection against feline immunodeficiency virus. AIDS Research and Human Retroviruses 7, (Received 29 April 1994; Accepted 9 August 1994)