West Nile Virus Overview: Biology, Phylogenetics, & Canadian Epidemiology Considerations for Tissue Donors Workshop - July 9, 2010

Transcription

1 West Nile Virus Overview: Biology, Phylogenetics, & Canadian Epidemiology Considerations for Tissue Donors Workshop - July 9, 2010 Michael Drebot, PhD Viral Zoonoses & Science Technologies, NML Public Health Agency of Canada, Winnipeg

2 Flaviviruses About 70 members, half of which are associated with human disease Enveloped, spherical virion, nm ssrna genome, positive polarity, ~ 11kb Antigenic complexes: --- Tick-borne encephalitis (tick vector) --- Dengue (mosquito vector) --- Japanese encephalitis (mosquito vector) RNA E M 5' C prm E NS1 NS2A NS2B NS3 NS4A NS4B NS5 3' Structural Non-Structural

3 Flavivirus Genus Phylogenetics (NS5) ~ 70 ss (+)sense RNA viruses TBEV POW CxFV QBV NAKV DENV Cell Fusion Agent Virus (CFAV) Group Calbertado WNV APOIV AEFV RBV KRV 2003 Crabtree et al. CFAV 1975 Stollar & Thomas

4 Flavivirus Phylogeny Japanese Encephalitis Murray Valley Encephalitis West Nile Virus St. Louis Encephalitis Dengue 1 Dengue 2 Dengue 3 Uganda S Yellow Fever Kyasnur Forest Western Tick-borne E Powassan Jutiapa?

5 Phylogenetic Relationships among West Nile Viruses Lineage 1: India, Australia, Europe Russia, Middle East, North Africa, Africa (Senegal, C. African Republic Ivory Coast) Lineage 2: Africa (Central and Southern including Madagascar) Lanciotti et al Virology 298, Egypt 1951 France 1965 South Africa Israel 1952 Romania 1996 Kenya 1998 Senegal 1993 Morocco 1996 Italy 1998 Volgograd 1999 New York 1999 Israel 1998-A NY NY NY 1999 equine NY 1999 hum Conn 1999 MD 2000 NJ 2000 Israel 1999 H C.Afr.Rep 1989 Senegal 1979 Algeria 1968 C.Afr.Rep 1967 Iv.Coast 1981 Kunjin 1960 Kunjin 1973 Kunjin 1984b Kunjin 1991 Kunjin 1984a Kunjin 1966 Kunjin 1994 India 1955a India 1980 India 1958 India 1955b Kenya Uganda Senegal 1990 Uganda 1937 C.Afr.Rep 1972a C.Afr.Rep 1983 Uganda 1959 C.Afr.Rep 1972b Madagascar 1988 Madagascar 1986 Madagascar 1978 JE SA 14 LIN-1 LIN-2

6 North American WNV Phylogeny: Slow Evolution Average Nucleotide Divergence: 0.24%, AA 0.1 % (NIH,CBS) MX 04 AZ, TX 04 NY 03 MB, CO 02 ON 02 North American MD 00 Eastern NY 99 U.S. Evolution and Adaptation of WNV in North America FL01 (Brault, Kramer ) : --- NY99 strain more temp resistant then other WNV strains (Kenya) SE Coastal Texas NS3 genes confers virulence in American GAL02 Crows, E -rodents WNV strain displacement, WN02 vs NY99 (Val159 OR02 Ala in E protein) WN02 more infectious in mosq, infection of tissues more efficient --- C. t and C.p, WN02 transmits earlier, Israel 98 lower temp then NY99, and replicates to higher concentration in mosquitoes

7 Identifying Genetic Variants of West Nile Virus nucleotides C prm E NS1 2A 2B NS3 4A 4B NS5 5 3 vrna Val159 - Ala WNV NY 1999 BSL (14 nt deln, SD) TTTAGTGGTGTTAGTGTAAATAGTTAAGAA AATTTTGAGG TTTAGTGGTGTTAGTGTAA TTTGAGG (Grinev, Rios et al, 2008) Kimberly Holloway, VZ, NML

8 WNV 3 NTR Deletion Mutants Identified Among Canadian Mosquitoes, Birds and Human Blood Donors & Cases (Up to %!) MB Donor (13) MB Mosquitos (13) AB Mos 2006 (13) AB Mos 2007 (13) AB Mos 2007b (12) TTTAGTGGTGTTAGTGT AATTTGAGGG TTTAGTGGTGTTAGTGT AATTTGAGGG TTTAGTGGTGTTAGTGT AATTTGAGGG TTTAGTGGTGTTAGTGT AATTTGAGGG TTTAGTGGTGTTAGTGTAAATAGTT AGGG AB 3 Cases 07 (13) TTTAGTGGTGTTAGTGT AATTTGAGGG AB 1 Case (9) T TTAGTGTAAATAGTTAATAAAATTTGAGGG Alberta Sask. Manitoba Quebec Ontario

9 WNV Inactivation Thermostability of WNV 10 6 PFU (PBS) inactivated by 56 C for 30 minutes (Fang et al., 2009) Gamma Irradiation 3 Mega rad dose (serum) Other possible procedures for blood: Methylene Blue light treated, Psoralen light, Riboflavin light, Detergents (Solheim, 2008)

10 FLAVIVIRUS LIFE CYCLE B-Integrin DC-SIGN - + +

11 Stages of West Nile Virus Infection Host Entry By Mosquito Innoc First round of replication in the skin: Langerhans dentritic cells (LDC) LDC migrate to draining lymph nodes Secondary round of replication occurs Viceral Organs (Liver, kidney, spleen) Viremia CNS Infected leukocytes? Passive transport across vessels? Access through olfactory bulb? Destruction of neurons

12 WNV Viremia and Antibody Response Time of Sample Collection and Type: Diagnostic Approach (Case Investigation, Surveillance) Exposure Date of Onset IgM IgG Incubation Period ( days) Days

13 Immunity to WNV Innate - early line of defence against microbes production of inflamatory cytokines (Eg. IFNs), complement activation, attraction of macrophage, etc Innate signaling pathways involve Toll-like receptors, RIG-like proteins,etc Adaptive Immune Response Humoral Response Antibody response (B cell deficient mice, CNS burden, Diamond 2003) Cellular Immune Response T lymphocyte response Receptor T cell (CD8 cells clear infection, Diamond 2004) - Macrophages, Dendritic cells MHC (HLA) Peptide APC (Dendritic)

14 Pre - Infection of cells with NY-WNV inhibits IFN antiviral response NY-WNV NS2A + other NS?

15 Neuroinvasiveness: Toll-like Receptor 3 mediates WNV entry into the brain? Dai et al 2008-ICAM, Wang et al 2008-Drak-2, (Nature Medicine :1294) Daffis et al. TLR 3??

16 West Nile Virus Overview: Continued Considerations for Tissue Donors J. Erin Staples, MD, PhD Arboviral Diseases Branch Division of Vector-Borne Diseases Centers for Disease Control and Prevention Fort Collins, CO

17 WNV Clinical Syndromes Asymptomatic or subclinical infections (80%) WNV non-neuroinvasive disease = WNF (20%) Acute systemic febrile illness Headache, myalgia, arthralgia, rash, and gastrointestinal symptoms WNV neuroinvasive disease = WNND (<1%) Encephalitis, meningitis, or acute flaccid paralysis

18 Blood Donor WNV Symptoms Analyzed blood donors who had confirmed WNV infection (n=576) vs false-positive PVDs (n=615) 1 42% WNV infected blood donors with symptoms Symptoms reported in 15% of more WNV infected donors Symptom Adjusted % (95%CI) Symptom Adjusted % (95% CI) New rash 26 (22-30) Muscle pain 15 (12-18) Weakness 24 (20-28) Joint pain 15 (11-18) Headache 24 (19-28) Fever 15 (12-19) PPV of any symptom in week before donation for reactive donors was 43% and NPV for no symptoms was 66% 2 1 Zou S, et al. In press.; 2 Custer B, et al. Transfusion. 2009; 49:

19 West Nile Virus Surveillance

20 National Arboviral Surveillance System Electronic surveillance system developed by CDC in response to WNV introduction Unique system collecting both human and non-human data Non-human data collection variable by location Dynamic system which can be adapted

21 Percent U.S. Counties Reporting Non-Human WNV Surveillance Data to ArboNET by Type and Year

22 Counties reporting WNV activity in humans and non-human species, U.S.,

23 Human Epidemiology United States

24 Reported WNV Human Disease Cases U.S., * 28,961 cases from 1,869 counties in 47 states and DC WNND 11,822 (41%) WNF 17,139 (59%) 1,134 (4%) fatal cases * CDC. Surveillance for Human West Nile Virus Disease United States, MMWR Surv Summ. 2010; 59(SS-2).

25 Estimated Number of WNV Infections and Fever Cases, U.S., Diagnoses and reporting of WNF varies by year and location WNND most reliable indicator of WNV disease activity in humans Based on serosurveys 140 WNV infections per 1 WNND case 140 x 11,822 WNND = ~1.66 million infections 19% of infection result in WNF 19% x 1,655,080 = ~314,000 WNF

26 Incidence of WNND by Year, U.S., Incidence per 100,000 Year

27 Incidence of WNND by Year, U.S., Incidence per 100,000 Year

28 Average Annual Incidence of WNND, by State, U.S.,

29 Average annual incidence* of WNND by county United States, * per 100,000 population

30 Percent of WNND Cases by Week of Onset, U.S., % 12% 90% of cases occur between July and September Proportion of cases 10% 8% 6% 4% 2% 0% Jan 5 Jan 26 Human disease cases reported between January 2 nd and December 31st Feb 16 Mar 9 Mar 30 Apr 20 May 11 Jun 1 Jun 22 Jul 13 Aug 3 Aug 24 Sep 14 Oct 5 Oct 26 Nov 16 Dec 7 Dec 28

31 Demographic and Clinical Information WNV Human Disease Cases United States

32 Average Annual Incidence of WNND Cases by Sex and Race, U.S., Sex Incidence per 100,000 Male 0.48 Female 0.33

33 Average Annual Incidence of WNND by Age Group, U.S., Incidence per 100,000 population to 9 10 to to to to to to Age group (years)

34 WNND Clinical Syndrome by Age Cohort, U.S., Children <18 yrs (N=443) Adults yrs (N=3,634) Adults 50 yrs (N=7,002) Meningitis 47% 51% 23% Encephalitis 37% 34% 59% AFP* 1% 1% 1% Unspecified 15% 15% 17% *Data from ; includes cases reported as AFP only.

35 WNND Severity and Outcome by Age Cohort, U.S., Children <18 yrs (N=443) Adults yrs (N=3,634) Adults 50 yrs (N=7,002) Hospitalized* 81% 79% 88% Fatal 1% 1% 14% *Data from

36 Expansion of West Nile Virus Throughout the Western Hemisphere ( ) 30, 000 cases of illness, Febrile and Neurological

37 Climatic, Environmental Factors Key For WNV Human Cases But WNV will continue to be a problem in Canada Yearly number of WNV cases in Canada WNV cases in Canada in >

38 2003 Activity in 7 provinces 1481 cases (most in west) 2002 Activity in 5 provinces > 400 human cases (Ont, QC) Culex tarsalis

39 Number of human cases of West Nile Virus by classification and symptom onset date in Canada 2003 (n=1427, excludes 30 cases missing onset dates, 13 cases unclassified) West Nile Fever (n=1213, 27 missing onset) West Nile Neurological Syndrome (n=214, 3 missing onset) No. cases Jun 20 Jun 27 Jul 04 Jul 11 Jul 18 Jul 25 Aug 01 Aug 08 Aug 15 Aug 22 Aug 29 Sep 05 Sep 12 Sep 19 Sep 26 Oct 03 Oct 10 Oct 17

40 Transmission of WNV Without Mosquitoes

41 Alternative Modes of Transmission Blood Transfusion PRBC, platelets, FFP Organ Transplantation Kidney, Liver, Heart, Lung In utero (during pregnancy) Breastfeeding

42 Background CBS West Nile Blood Donor Testing Initiated July 2003, Roche TaqMan WNV Assay Real-time quantitative RT PCR Minipools of 6 Reactive with all flaviviruses in Japanese encephalitis group Testing done in Calgary (includes West of Manitoba) and Toronto (includes Atlantic)

43 Background CBS West Nile Donor Testing All donations tested by mini-pool Except during WNV season when single unit testing initiated for 7 days in a health region when one WNV positive donor is identified. or The number of new confirmed community cases reported in a health region reaches the level of 1/1,000 (rural areas) or 1/2,500 (urban) for the past 2 consecutive weeks.

44 2007 AABB WNV Biovigilence Map Includes ARC, ABC, CBS and HQ Canadian Blood Testing Results probable transfusion transmitted Update 07/11/ positive donors Usually significant 2004 delay 0 positive donors in updates positive donors CBS provides data only if Presumptive Positive 8 positive donors positive donors positive donors positive donors

45 2008 AABB WNV Biovigilence Map Includes ARC, ABC, CBS and HQ Updated 08/12/31

46 WNV Transfusion-associated Disease 23 transfusion-associated WNV infections identified in Beginning 2003, all blood donations screened using NAT on either pooled or individual samples 32 transfusion-associated WNV infections reported; last documented cases in 2006 (2008) CDC investigates multiple cases of possible WNV transfusion-associated disease annually Predominantly immunocompromised Unable to substantiate due to lack of retention samples from the original blood unit 1 Pealer et al N Engl J Med. 349:1236

47 WNV Transmission by Solid Organ Transplantation 13 confirmed or probable cases of SOTtransmitted WNV infection from 5 donors One additional suspect cluster (1 donor, 4 recipients) CDC investigates multiple cases of possible WNV transplant-associated disease annually Two clusters investigated in 2009 No current guidelines for routine screening of organ donors

48 WNV infected Donors (n=5) Median age = 44 years (range 18-53) Male = 4 (80%) Origin of infection WNV-infected blood product pre-harvest (2) Mosquito bite (2) Unknown (1) None were screened for WNV prior to transplant

49 Retrospective WNV Testing of Organ Donors Donor NAT RT-PCR IgM IgG A ND + - ND B ND C - ND - - D + ND - - E Equivocal NAT = Nucleic acid amplification testing; ND = Not done Nucleic acids detected in three of five cases One NAT positive case was from testing performed after transplant at a tissue bank WNV-specific antibodies detection variable

50 WNV-infected Recipients (n=13) Median age = 55 years (range 31-71) Male = 9 (69%) Ten (77%) infected with WNV WNND = 8; WNF = 1; Asymptomatic = 1 Died = 3 Received a variety of organs Kidney = 4; Liver = 3; Heart = 2; Lung = 1 Three not infected (one pre-immune) Two kidney and one liver recipient

51 Other Modes of Transmission Documented in utero transmission of WNV One cases with definitive evidence and three with supportive evidence Breast-feeding associated WNV case

52 Issues for Further Consideration

53 Evidence of WNV Persistence in Infected Animals 1. Russian study in the 80 s documented viral isolation from infected monkey organs several months after inoculation (Pogodina et al. 1983) 2. RT- PCR positives from spleen and kidney of sparrows 65 days post infection (Nemeth et al, 2009). Pigeons 100 days (Russian study, Semenov et. 1973) 3. Murray et al year shedding of virus RNA in urine by RT-PCR detection 4. General arbovirus persistence observations (Kuno 2001).

54 Persistence of IgM Antibody in Arboviruses WNV persistent IgM, Roehrig et al, 2003 Murray et al Shedding of virus in urine for 6 years! Chronic Kidney Disease (5 patients) Persistence of IgM in certain patients was unexpected The immunological basis of this phenomenon remains to be determined. Possible mechanisms could include reinfection, reactivation of latent infection, chronic antigen production, etc.

55 Significant Number of JC-LAC High IgM Titres Among Probable Cases, Evidence of Persistence IgM P/N Range of 2009 IgM P/N Values Positive and equivocols (P/N = 3), PRNT Confirmed JC SSH IgM positives (14 patients) from QC and NB exhibit persistent JC IgM from 1-5 years SSH P/N=3 Cutoff Days post onset

56 Conclusions CDC with unique surveillance system for WNV WNV disease incidence and occurrence varies annually Non-human activity helps define location WNND affects all age groups Cause more deaths and encephalitis in individuals >50 years Human-to-human transmission occurs, often resulting in worse outcome Blood, organs, in utero, breastfeeding

57 Areas for Further Investigation Assess differences in WNV transmission between high and low risk areas Explore ability of PVDs to predict human WNND Describe screening of organ donors for WNV Evaluate the development and use of WNV vaccine for humans Assess possible persistence of WNV in humans prospectively

58 Acknowledgments Viral Zoonoses Section ZDSP, NML, Winnipeg CBS, Dr. Margaret Fearon, Toronto Centre for Food-borne, Environmental, Zoonotic Infectious Diseases, PHAC, Ottawa Provincial Laboratories, Canada Surveillance and Epidemiology Activity, Arboviral Diseases Branch, CDC Robert Lanciotti, CDC Roger Nasci, CDC Lyle Petersen, CDC Peggy Collins and the ArboNET technical staff State/local health dept ArboNET surveillance coordinators