Research Update: Avian Disease & Oncology Lab (ADOL) and SEPRL Endemic Poultry Virus Diseases (EPVD)

Size: px

Start display at page:

Download "Research Update: Avian Disease & Oncology Lab (ADOL) and SEPRL Endemic Poultry Virus Diseases (EPVD)"

Pamela Andrews
5 years ago
Views:

1 Research Update: Avian Disease & Oncology Lab (ADOL) and SEPRL Endemic Poultry Virus Diseases (EPVD) John Dunn, Hans Cheng, Mohammad Heidari, Huanmin Zhang, Taejoong Kim, Stephen Spatz, Qingzhong Yu USDA-ARS-USPNRC

2 Congressionally-funded projects Genomics Herpesvirus (MDV, ILT) Enteric viruses New IBD project Hans Cheng Mohammad Heidari Huanmin Zhang John Dunn Taejoong Kim Stephen Spatz Vacant Qingzhong Yu New Hire East Lansing, MI Athens, GA

3 Genomics Enteric viruses Herpesvirus Vaccine synergism Vaccine interference Vaccine development Research Highlights

4 Genomics Enteric viruses Herpesvirus Vaccine synergism Vaccine interference Vaccine development Research Highlights

Ikaros The First Marek s Disease Driver Gene Graphical representation of Ikaros protein showing somatic mutations in key Zn-finger DNAbinding domains Every Marek s disease virus (MDV)-infected bird

5 Ikaros The First Marek s Disease Driver Gene Graphical representation of Ikaros protein showing somatic mutations in key Zn-finger DNAbinding domains Every Marek s disease virus (MDV)-infected bird does not develop tumors, thus, we hypothesized that additional somatic mutations in the chicken genome were required. Using DNA and RNA sequencing of Marek s disease (MD) tumors, we find that Ikaros is frequently mutated in key locations (see figure) or shows low gene expression. Ikaros is a Zn-finger transcription factor and the master regulator of lymphocyte development. It is a known tumor suppressor gene for human cancers, e.g., Acute Lymphoblastic Leukemia (ALL). This knowledge will enhance the ability to select for genetic resistance to MD.

T Cell Receptor (TCR) Expression and Response is Associated with Marek s Disease Resistance CD8+ TCR Vbeta-1 cells respond to MDV infection in resistant birds but not in susceptible ones.

6 T Cell Receptor (TCR) Expression and Response is Associated with Marek s Disease Resistance CD8+ TCR Vbeta-1 cells respond to MDV infection in resistant birds but not in susceptible ones. Examining the role of TCR in genetically Marek s disease resistance vs. susceptible birds, we find: MD resistant birds show constitutively higher levels of TCR Vbeta-1+ T cells MD resistant birds show a TCR Vbeta-1+ response to MDV infection in CD8+, but not CD4+, T cells MHC haplotype has a mild effect on TCR usage in CD8+ (class I-restricted) T cells but not CD4+ (class II-restricted) T cells MD resistant birds have a reduced TCR repertoire Similar bioassays could be used to select birds for superior resistance to MD

7 MDV-Induced Differential Expression of Genes at 5 DPI in MD Resistant & Susceptible Chickens by RNA-Seq A. C. E. F. B. D.

8 MDV-Induced Differential Expression of Genes at 10 & 21 DPI in MD Resistant & Susceptible Chickens (Cont.) G

9 Virus transmission project Infected donor Uninfected recipient Infected recipient Transfer of donors to naïve recipients Time

10 Selection of birds based on virus transmission % Marek's disease 100 % MD of recipients at 8 weeks (Rep 1) Donor transfer age Line 6 Line 7 Viral load in feathers of donors at each transfer (Rep 2) Copies of MDV gb/gapdh Donor age (days) Line 6 Line 7

11 Genomics Enteric viruses Herpesvirus Vaccine synergism Vaccine interference Vaccine development Research Highlights

12 Development of Newcastle disease virus (NDV) vector vaccine NDV vaccines, such as LaSota, B1, VG/GA, PHY LMV42 strains, are commonly used to control Newcastle disease (ND). Developed NDV vaccines as tissue-tropic live vaccine vectors to express an antigen from other avian pathogens as dual vaccine candidates. Respiratory tissue-tropic LaSota vaccine vector for expressing: Infectious laryngotracheitis virus (ILTV): gb, or gd protein Infectious bronchitis virus (IBV): S2, S1, or recombinant S protein Enteric tissue-tropic NDV vaccine vector for expressing: Turkey enteric corona virus (TCoV): S1 or S2 protein Chicken parvovirus (ChPV): NP protein Evaluated the protective efficacy in natural hosts, chicken or turkeys against challenge with virulent NDV and the targeted avian pathogen.

13 1. Construction of NDV cdna clones containing a foreign gene (FG) T 7 L e N P GFP M F HN L T r HDVR z T7 ɸ Pathogen genome pls-gfp vector FG T 7 L e In-fusion PCR cloning N P M F HN L T FG r PCR/RT- PCR HDVRz T7ɸ pls/fg TCAAGTTAGAAAAAATACGGGTAGAA GCCACC ATGCA TGA Gene end Gene start Kozak FG ORF 2. Rescue of NDV recombinant viruses containing a foreign gene (FG) 1 L P M 2 N HEp-2 cells T 7 T 7 T 7 N u c l e u s T 7 NDVcDNA ribozyme terminators T7 LcDNA T 7 NcDNA T 7 PcDNA T 7 MVA/T7 At 72 hours post transfection 2 Amplify rescued virus in embryonated eggs

14 Biological characterization of rndv vaccine candidates Viruses MDT a ICPI b HA c EID 50 d TCID 50 e rlasota 110hs rls/iltv-gb 120hs rls/iltv-gd 112hs rls/ibv-s2 122hs LMV 113hs x x10 5 rlmv/tcov-s1 >150hs x10 9 ND rlmv/tcov-s >150hs x10 9 ND a MDT: Mean death time in embryonated eggs. b ICPI: Intracerebral pathogenicity index in day-old chickens. c HA: Hemagglutination titer. d EID 50 : The 50% egg infectious dose in embryonated eggs. e TCID 50 : The 50% tissue infectious dose on DF-1 cells.

15 Results and summary NDV vaccine-based recombinant viruses were slightly attenuated with a lower ICPI and longer MDT when compared with parental NDVs rndv vaccine candidates were safe in one-day-old SPF chickens without showing any vaccine side-effects All rndv vaccine candidates conferred complete protection against virulent NDV challenge rls/iltv-gb, -gd, and rls/ibv-s2 vaccine candidates conferred significant clinical protection against correspondent virulent virus (ILTV or IBV) challenge rlmv/tcov-s and -S1 vaccine candidates are being evaluated in turkeys for protection against TCoV challenge

16 Genomics Enteric viruses Herpesvirus Vaccine synergism Vaccine interference Vaccine development Research Highlights

Serotype 2 and 3 MD Vaccines Differ in When and Where They Replicate Investigating the mechanism of vaccinal synergy between serotype 2 (SB-1) and 3 (HVT) MD vaccines, we find: SB-1 replicates

17 Serotype 2 and 3 MD Vaccines Differ in When and Where They Replicate Investigating the mechanism of vaccinal synergy between serotype 2 (SB-1) and 3 (HVT) MD vaccines, we find: SB-1 replicates similar to virulent MDV, i.e., in all lymphoid organs and increasing over time especially in the spleen. HVT replicates only at very early time points and only in the bursa. The bursa is required for HVT protection, which implies that either B cells or the organ is necessary. These results and others should help to rationallydesign the next generation of MD vaccines.

18 HVT interference project ILT clinical scores ILT Day3 ILT Day4 Clinical Sign Score a b b b b Clinical Sign Score a c b b b 0 None alone + rhvt/ibd + rhvt/nd (1) + rhvt/nd (2) 0 None alone + rhvt/ibd + rhvt/nd (1) + rhvt/nd (2) rhvt/ilt rhvt/ilt

19 HVT interference project ILT tracheal swabs Genome copies of ILTV challenge virus ILTV qpcr Day3 **** **** ** ** rhvt/ilt Genome copies of ILTV challenge virus 8000 None alone rhvt/ibd rhvt/nd (1) + rhvt/nd (2) ILTV qpcr Day5 *** *** ** * rhvt/ilt None alone + rhvt/ibd + rhvt/nd (1) + rhvt/nd (2) Vaccine(s) administered Vaccine(s) administered

20 GaHV-3 (MDV Serotype 2) genome determination Determined the entire genomic sequence of Gallid herpesvirus 3 (GaHV-3) strain 301B/1 using next-generation sequencing Illumina s MiSeq technology with DNA isolated from virus capsids Comparatively analyzed the 301B/1 genomic sequences with GaHV-3 strains, SB-1 and HPRS24 as well as other avian herpesviruses (GaHV-2, and GaHV-1) Identified total 126 open reading frames in the genome of 301B/1. Overall the 301B/1 genome is very similar to that of GaHV-3 SB-1 strain (99.1% identity) than that of HPRS24 strain (97.7% identity) Long terminal repeat (LTR) sequences of avian retrovirus, found in the unique short region of SB-1 genome was not found in the 301B/1 virus genome 20

21 GaHV-3 (MDV Serotype 2) vaccine platform The 301B/1 strain has been demonstrated to work synergistically with the widely-used HVT vaccine against Marek s disease. The entire genome of GaHV-3 strain 301B/1 was molecularly cloned into a Bacterial Artificial Chromosome (BAC) plasmid. The in vitro characteristics of reconstituted 301B/1 virus, derived from BAC clones, indicated that they grew to similar titers as wildtype virus. Two reconstituted 301B/1 viruses from BAC clones were further examined in vaccine efficacy studies against pathogenic Marek s disease virus challenge. Two BAC-derived 301B/1 viruses had comparable protection efficacies against very virulent Marek s disease virus with protective indices of approximately 80%. The resulting BAC clones are valuable tools that allow rapid and precise site-directed modifications of viral genomes in order to develop efficacious vector vaccines not only against Marek s disease but against other important poultry diseases. 21

Reconstitution of the Infectious Laryngotracheitis Virus using Bacterial and Yeast Genomic Assembly Recombinant ILTV clones (~ 45 Kb) spanned the complete ILTV genome.

22 Reconstitution of the Infectious Laryngotracheitis Virus using Bacterial and Yeast Genomic Assembly Recombinant ILTV clones (~ 45 Kb) spanned the complete ILTV genome. ILTV could be reconstituted when linearized clones were transfected into LMH cells. Mod KLO pciz34 pciz52 pci28 pcib27 Linearize with Restriction Enzymes pul48 picp4 Mirus TransIT Transfection 5-6 days

23 Virulence of three rescued recombinants were tested in vivo and compared to the USDA parental strains Total clinical scores Tracheal virus load (3, 5 & 7 days)

24 Conclusions Infectious ILTV can be reconstituted from five cloned ILTV fragments. Reconstituted wild type (BC) and packaging mutants (KLO and Mod KLO) grew to similar titers in chicken kidney cells. All reconstituted recombinants were pathogenic in birds. This indicated that no attenuating mutation were introduced during constitution of the clone and reconstitution of the virus.

25 Thank you for your attention

Avian Disease & Oncology Lab (ADOL) Research Update. John Dunn, Hans Cheng, Mohammad Heidari, Huanmin Zhang USDA-ARS-USPNRC

Avian Disease & Oncology Lab (ADOL) Research Update John Dunn, Hans Cheng, Mohammad Heidari, Huanmin Zhang USDA-ARS-USPNRC Research Programs at ADOL 1) Genomics (Cheng, Zhang, Vacant SY) Title: Employing