Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding
|
|
|
- Bethany Cameron
- 5 years ago
- Views:
Transcription
1 Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding Aleksei Krasnov, Nofima FHFs fiskehelsesamling september 2015
2 Smoltifiction and breeding suppress immunity in Atlantic salmon There is space for improvement
3 Projects & methods Multifactorial disease Smolt brain Fit Smolt Collaboration with VI & NVH Transcriptomics multiple gene expression profiling: - Oligonucleotide microarray - RNA-seq
4 Disease occurrence increases after SWT Sea water transfer IPN, PD, ISA, HSMI, CMS Stress? Pathogen pressure? Management? Immunity?
5 Smoltification Endocrine (pituitary, thyroxine, cortisol) Metabolism, esp. osmoregulation Morphology Behavior
6 Smoltifiction and breeding suppress immunity in Atlantic salmon Endocrine changes, osmoregulation & immunity need much resources Breeding allocates resources to growth Competition is not in favour of defence Immune suppression remained unknown
7 Study 1 Smoltification / SWT FHF Multifactorial disease
8 FHF Multifactorial disease. Spring 2013 Constant light Week 3 Presmolt Week 6 Smolt Week 7 Seawater transfer Week 10 Seawater adaptation Sampling & analyses: gills, head kidney & intestine. Week 3 (presmolt) - reference
9
10 Cell signaling Cytokines & receptors Chemokines and receptors Eicosanoid metabolism & signaling Organ Gene Smolt SWT1 SWT2 Gill interleukin 17 isoform D Gill interleukin-1 receptor antagonist Gill interleukin Gill Small inducible cytokine A Head kidney C-C motif chemokine 19 precursor Head kidney C-C motif chemokine 20 precursor Head kidney C-C motif chemokine 21 precursor Head kidney C-X-C motif chemokine 10 precursor Head kidney Interleukin-12 subunit beta precursor intestine C-C motif chemokine 20 precursor intestine interleukin-1 receptor antagonist intestine interleukin-1 receptor type II intestine Interleukin-17 receptor A precursor intestine Small inducible cytokine A intestine Cytochrome P450 4F intestine Cytochrome P450 2K Head kidney Microsomal prostaglandin E synthase Gill Cytochrome P450 4F Head kidney Arachidonate 5-lipoxygenase Gill 33 Head kidney 19 Intestine - 30
11 Organ Gene Smolt SWT1 SWT2 Head kidney Barrier-to-autointegration factor Head kidney Gig Head kidney Gig Head kidney Radical S-adenosyl methionine domain Head kidney VHSV-inducible protein Intestine Barrier-to-autointegration factor Intestine interferon-inducible protein Gig2-like Intestine VHSV-induced protein Intestine Tyrosine-protein kinase Jak Intestine Myxovirus resistance Gill Gig Gill Barrier-to-autointegration factor Gill STAT Gill Barrier-to-autointegration factor Gill Fish virus induced TRIM Innate antiviral responses VRG Receptors, sensors Transducers Effectors Genes with unknown roles Gill 27 Head kidney 44 Intestine - 27
12 Organ Gene Smolt SWT1 SWT2 Intestine TNF receptor member 11B Intestine TNF alpha-induced protein 8-like Intestine Mitogen-activated protein kinase Intestine SAPS domain family member Intestine Sequestosome Intestine TNFAIP3-interacting protein Intestine CD265 Tumor necrosis factor receptor super Intestine TNF superfamily member 13b Head kidney SAPS domain family member Head kidney CD Head kidney TNFR superfamily member Gill Sequestosome Gill TNF superfamily member 13b Gill TNF receptor member 11B Gill TNFR associated factor Gill CD40 ligand Gill TNF decoy receptor TNFa-pathway Acute inflammation TNF receptors Signal transduction Gill 10 Head kidney 8 Intestine - 14
13 Organ Gene Smolt SWT1 SWT2 Gill Amyloid protein beta A Gill Complement component C Gill Pentraxin Gill Rhamnose-binding lectin WCL1 [Salvelinus l Gill Complement C1q C Head kidney Antimicrobial peptide 2 (LEAP2) Head kidney Complement C Head kidney P-selectin Head kidney Complement C Head kidney Complement component C Head kidney Mannose-binding protein C Intestine Serum amyloid P component Intestine Complement C1qC Intestine C1q-like adipose specific protein Intestine Rhamnose-binding lectin Intestine Complement component C8 beta Humoral & cellular effectors Acute phase proteins Antibacterial proteins Lectins Complement Oxidative burst Organ Gene Smolt SWT1 SWT2 Gill Myeloperoxidase Gill Natterin-like protein Gill Inducible nitric oxide synthase Gill Neutrophil cytosolic factor Gill Perforin Head kidney Inducible nitric oxide synthase Gill Head kidney Defensin beta 3 Head kidney Head kidney Myeloperoxidase Head kidney Lysozyme g Intestine Head kidney Neutrophil cytosolic factor Intestine Myeloperoxidase Intestine Inducible nitric oxide synthase Intestine Cytochrome b-245, beta polypeptide Intestine Perforin Intestine Neutrophil cytosolic factor
14 Organ Gene Smolt SWT1 SWT2 Gill MHC class I antigen Gill MHC class II antigen Gill Tapasin Gill TAP2b Gill MHC class I antigen Head kidney MHC class I antigen Head kidney MHC class I heavy chain Head kidney Hmha1 protein Head kidney H-2 class II histocompatibility antigen gamma Head kidney CD86 molecule Intestine MHC class I antigen Intestine MHC class I MHC class I Intestine MHC class I antigen Intestine CD Intestine H-2 class II histocompatibility antigen gamma Antigen presentation MHCI MHCII CD40, CD86 Gill 11 Head kidney 11 Intestine - 19
15 Organ Gene Smolt SWT1 SWT2 Gill CD8 beta Gill CD3epsilon Gill CD8 alpha Gill CD4-like protein Gill T cell receptor alpha Head kidney Transcription factor SOX Head kidney CD8 alpha Head kidney T-cell activation Rho GTPase Head kidney Drebrin-like protein Head kidney CD3epsilon Intestine T-cell activation Rho GTPase Intestine L-plastin Intestine Modified T cell receptor alpha Intestine CD28 T-cell-specific surface glycoprotein Intestine T-cell surface antigen CD T cells, lymphocytes CD4, CD8 Receptor CDR3 Transducers Transcription factors Effectors Gill 29 Head kidney 26 Intestine - 26
16 Organ Gene Smolt SWT1 SWT2 Gill Ig kappa chain Gill AF297518_1 immunoglobulin light chain Gill Ig kappa chain V region K Gill Ig kappa chain V-III region CLL Gill Ig kappa chain V-III region MOPC Head kidney Ig kappa chain V-IV region Len Head kidney Ig kappa chain V-III region MOPC Head kidney Ig kappa chain V-III region CLL Head kidney Transcription factor PU Head kidney Immunoglobulin heavy chain AF141606_ Intestine Ig heavy chain membrane bound Intestine Ig kappa chain V-III region CLL Intestine Ig mu chain C region Intestine Immunoglobulin lambda-like polypeptide Intestine Zinc finger_ AN1-type domain IgM HK: increase in smolt and shortly after SWT Gill transient increase shortly after SWT Intestine stable decrease Smoltification and SWT stimulate proliferation and redistribution of B cells
17 - Smoltification suppressed major immune pathways and functional groups of immune system - Exclusion: B cells & Ig - No recovery was observed at 3 weeks after SWT, further unkown - Changes were similar by character and magnitude in gill, head kidney and intestine, but different genes were affected - Results are relevant for commercial aquaculture
18 Happens always, commonly or in rare cases? Consequences for disease resistance?
19 Study 2 HSMI in parr & smolt NVI / NVH (Espen Rimstad, Maria Dahle)
20 Challenge by co-habitance Parr, FW No heart pathology, Effective clearance of PRV Smolt, SW Heart pathology HSMI Persistent infection with PRV Differences in immunity? Before and / or after infection?
21 Innate antiviral responses, antigen presentation (97 genes) Head kidney week 0 week 4 week 6 week 8 IFN-induced Stat Stat IFN-induced Stat IFN-induced VLIG Cholesterol 25-hydroxylase Ubiquitin-like protein VLIG week 0 week 4 week 6 week 8 Receptor transporting protein VLIG VLIG Fish virus induced TRIM Viperin IFIT Viperin Viperin Ubiquitin-like protein kda Ro protein Thymidylate kinase
22 T cells (72 genes) Head kidney week 0 week 4 week 6 week 8 TCR-gamma constant region TCR-gamma constant region TCR-gamma constant region TCR-gamma constant region TCR-gamma constant region TCR-gamma constant region TCR-gamma constant region TCR-gamma constant region T-cell receptor V-alpha TCR-gamma constant region T-cell receptor alpha chain VR Spleen week 0 week 4 week 6 week 8 TCR-gamma constant region TCR-gamma constant region TCR-gamma constant region TCR-gamma constant region TCR-gamma constant region TCR-gamma constant region TCR-gamma constant region TCR-gamma constant region TCR-gamma constant region TCR-gamma constant region
23 B cells (72 genes) Head kidney week 0 week 4 week 6 week 8 Ig kappa chain V-IV Ig tau heavy chain Ig kappa chain V-IV Ig heavy chain Ig kappa-b4 chain C region Ig kappa chain V-IV Ig kappa chain V Ig heavy chain Ig tau-2 heavy chain C-region IG heavy HC V-region Ig lambda-like Spleen week 0 week 4 week 6 week 8 Ig kappa chain V-IV Ig tau-2 heavy chain C-region Ig kappa chain V-IV Ig tau heavy chain Ig kappa chain V Ig heavy chain Ig heavy chain Ig heavy chain V-I Ig heavy chain Ig heavy chain IG heavy HC V-region
24 HSMI in parr and smolts Smoltification slightly suppressed immunity in head kidney and spleen under basal conditions Immune responses to HSMI were earlier in parr - Innate antiviral immunity: both tissues at 4 & 6 wpi - B cells: head kidney (strong) and spleen (weak) at 8 wpi Smoltification might reduce immune protection against HSMI
25 Study 3 Parr & smolt, wild salmon FreeBio Smolt Brain (Lars Ebbesson, Simon MacKenzie)
26
27 Name Gill Blood RBC Inducible nitric oxide synthase Myeloperoxidase precursor Complement C Lectin precursor Complement C1q Serine protease 1-like Allograft inflammatory factor Toxin Complement C1q-like protein Collagenase 3 precursor Differentially regulated trout protein Apolipoprotein O precursor Serum amyloid A-5 protein Matrix metalloproteinase Serum amyloid A Kidney injury molecule Gene Gill Blood RBC Cholesterol 25-hydroxylase-like pro Gelsolin precursor Hect domain and RLD Barrier-to-autointegration factor VHSV-inducible protein IFN-induced protein VHSV-induced protein Gig VHSV-induced protein RING finger protein Fish virus induced TRIM protein Vacuolar protein protein Fish virus induced TRIM VHSV-induced protein Hect domain and RLD Zinc finger_ C3HC Gill Blood RBC MHC class I MHC class I MHC class I antigen MHC class I antigen MHC class II antigen HLA class II DP alpha MHC class II alpha MHC class II alpha MHC class II alpha H-2 class I L-D alpha H-2 class II Gamma CD MHC class I antigen MHC class I antigen MHC class I alpha
28 Gill Blood RBC CD CD4-like protein CD CD81 antigen CD Cytotoxic and regulatory T cell protein Hmha1 protein interleukin SH3 and SAM domains T cell receptor alpha chain T-cell-originated protein kinase TCR-gamma constant region TCR-gamma constant region TCR-gamma constant region Wiskott-Aldrich protein homolog Gene Gill Blood RBC C-X-C motif chemokine C-C motif chemokine C-C motif chemokine C-C motif chemokine C-C motif chemokine C-C motif chemokine C-C motif chemokine C-X-C motif chemokine IFN-gamma receptor alpha IL-12 subunit beta IL IL-17 receptor A IL IL-20 receptor alpha TNF receptor 11B
29 Study 4 Lærdal & Bolaks salmon FitSmolt (Harald Takle, Sven Martin Jørgensen)
30 Heart RNA-seq: farmed vs wild Breeding for rapid growth suppressed immunity
31 Heart RNAseq: smolt vs parr Bolaks Moderate immune suppression Stimulation of Ig
32 Trend to immune suppression was seen in different - experiments & projects - fish & facilities - transcriptomic methods Advantage: confidence Drawback: - Large part of results obtained as a side product - Many questions without answer - Lack of system & stringent design
33 Questions: - Immune suppression is different by magnitude why? - Difference between strains & families? - Farming conditions & practice? - How long after SWT? - Impact on disease resistance? - Need to take measures and how?
CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems
CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems Vasco Mota*, Tom Nilsen, Elizabeth Ytteborg, Grete Baeverfjord, Aleksei Krasnov, Jelena Kolarevic, Lars Ebbesson, Steven
HOST RESPONSE AGAINST SALMON LOUSE what have we learned so far?
Norwegian University of Life Sciences () Department of Basic Sciences & Aquatic Medicine HOST RESPONSE AGAINST SALMON LOUSE what have we learned so far? Stanko Skugor 1, Helle Holm 1, Anne Kari Osmo 2,
Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University
Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve
A. Incorrect! It s not correct. Synergism of cytokines refers to two or more cytokines acting together.
Immunology - Problem Drill 11: Cytokine and Cytokine Receptors Question No. 1 of 10 1. A single cytokine can act on several different cell types, which is known as. Question #1 (A) Synergism (B) Pleiotropism
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
NTD Vaccine Design Toolkit and Training Workshop Providence, RI January 05, 2011 Cytokines Leslie P. Cousens, PhD EpiVax, Inc.
NTD Vaccine Design Toolkit and Training Workshop Providence, RI January 05, 2011 Cytokines Leslie P. Cousens, PhD EpiVax, Inc. Cytokines Properties of Cytokines Cytokines are proteins with specific roles
Chapter 11 CYTOKINES
Chapter 11 CYTOKINES group of low molecular weight regulatory proteins secreted by leukocytes as well as a variety of other cells in the body (8~30kD) regulate the intensity and duration of the immune
MCB 4211 Basic Immunology 2nd Exam; 10/26/17 Peoplesoft #:
For this first section, circle the letter that precedes the best answer for each of the following multiple-choice questions. LOOK AT ALL ALTERNATIVES BEFORE CHOOSING YOUR ANSWER. 1. The TcR (T cell receptor)
Chapter 13: Cytokines
Chapter 13: Cytokines Definition: secreted, low-molecular-weight proteins that regulate the nature, intensity and duration of the immune response by exerting a variety of effects on lymphocytes and/or
ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT
ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes
Chapter 21: Innate and Adaptive Body Defenses
Chapter 21: Innate and Adaptive Body Defenses I. 2 main types of body defenses A. Innate (nonspecific) defense: not to a specific microorganism or substance B. Adaptive (specific) defense: immunity to
Lecture 4. T lymphocytes
Lecture 4 T lymphocytes Objectives Mention the types of T cells List the Types of T helper cell (CD4+) Discuss the Activation of T cells Define Interleukins Distinguish the Super Ag from ordinary Ag Show
The T cell receptor for MHC-associated peptide antigens
1 The T cell receptor for MHC-associated peptide antigens T lymphocytes have a dual specificity: they recognize polymporphic residues of self MHC molecules, and they also recognize residues of peptide
Structure and Function of Antigen Recognition Molecules
MICR2209 Structure and Function of Antigen Recognition Molecules Dr Allison Imrie allison.imrie@uwa.edu.au 1 Synopsis: In this lecture we will examine the major receptors used by cells of the innate and
Immune System AP SBI4UP
Immune System AP SBI4UP TYPES OF IMMUNITY INNATE IMMUNITY ACQUIRED IMMUNITY EXTERNAL DEFENCES INTERNAL DEFENCES HUMORAL RESPONSE Skin Phagocytic Cells CELL- MEDIATED RESPONSE Mucus layer Antimicrobial
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
Innate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin
Chapter Know Differences and Provide Examples Innate Immunity kin and Epithelial Barriers Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive Immunity
Defense mechanism against pathogens
Defense mechanism against pathogens Immune System What is immune system? Cells and organs within an animal s body that contribute to immune defenses against pathogens ( ) Bacteria -Major entry points ;open
T cell-mediated immunity
T cell-mediated immunity Overview For microbes within phagosomes in phagocytes.cd4+ T lymphocytes (TH1) Activate phagocyte by cytokines studies on Listeria monocytogenes For microbes infecting and replicating
Innate Immunity. Hathairat Thananchai, DPhil Department of Microbiology Faculty of Medicine Chiang Mai University 2 August 2016
Innate Immunity Hathairat Thananchai, DPhil Department of Microbiology Faculty of Medicine Chiang Mai University 2 August 2016 Objectives: Explain how innate immune system recognizes foreign substances
Development of B and T lymphocytes
Development of B and T lymphocytes What will we discuss today? B-cell development T-cell development B- cell development overview Stem cell In periphery Pro-B cell Pre-B cell Immature B cell Mature B cell
all of the above the ability to impart long term memory adaptive immunity all of the above bone marrow none of the above
1. (3 points) Immediately after a pathogen enters the body, it faces the cells and soluble proteins of the innate immune system. Which of the following are characteristics of innate immunity? a. inflammation
11/25/2017. THE IMMUNE SYSTEM Chapter 43 IMMUNITY INNATE IMMUNITY EXAMPLE IN INSECTS BARRIER DEFENSES INNATE IMMUNITY OF VERTEBRATES
THE IMMUNE SYSTEM Chapter 43 IMMUNITY INNATE IMMUNITY EXAMPLE IN INSECTS Exoskeleton made of chitin forms the first barrier to pathogens Digestive system is protected by a chitin-based barrier and lysozyme,
* Kyoto Encyclopedia of Genes and Genomes.
Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited
Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26
Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory
Table S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.
Table S1 Differentially expressed genes showing > 2 fold changes and p
The Major Histocompatibility Complex (MHC)
The Major Histocompatibility Complex (MHC) An introduction to adaptive immune system before we discuss MHC B cells The main cells of adaptive immune system are: -B cells -T cells B cells: Recognize antigens
TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57
Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive
T cell Receptor. Chapter 9. Comparison of TCR αβ T cells
Chapter 9 The αβ TCR is similar in size and structure to an antibody Fab fragment T cell Receptor Kuby Figure 9-3 The αβ T cell receptor - Two chains - α and β - Two domains per chain - constant (C) domain
TCR, MHC and coreceptors
Cooperation In Immune Responses Antigen processing how peptides get into MHC Antigen processing involves the intracellular proteolytic generation of MHC binding proteins Protein antigens may be processed
Innate Immunity. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples Chapter 3. Antimicrobial peptide psoriasin
Know Differences and Provide Examples Chapter * Innate Immunity * kin and Epithelial Barriers * Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive
CELL BIOLOGY - CLUTCH CH THE IMMUNE SYSTEM.
!! www.clutchprep.com CONCEPT: OVERVIEW OF HOST DEFENSES The human body contains three lines of against infectious agents (pathogens) 1. Mechanical and chemical boundaries (part of the innate immune system)
LYMPHOCYTES & IMMUNOGLOBULINS. Dr Mere Kende, Lecturer SMHS
LYMPHOCYTES & IMMUNOGLOBULINS Dr Mere Kende, Lecturer SMHS Immunity Immune- protection against dangers of non-self/invader eg organism 3 components of immune system 1 st line: skin/mucosa/cilia/hair/saliva/fatty
The Immune System: Innate and Adaptive Body Defenses Outline PART 1: INNATE DEFENSES 21.1 Surface barriers act as the first line of defense to keep
The Immune System: Innate and Adaptive Body Defenses Outline PART 1: INNATE DEFENSES 21.1 Surface barriers act as the first line of defense to keep invaders out of the body (pp. 772 773; Fig. 21.1; Table
SINGLE CHOICE. 5. The gamma invariant chain binds to this molecule during its intracytoplasmic transport. A TCR B BCR C MHC II D MHC I E FcγR
A Name: Group: SINGLE CHOICE 1. Which is the most important ligand of TLR5? A endospore B flagellin C polysaccharide capsule D DNA E pilus 2. The antibody-binding site is formed primarily by... A the constant
Time course of immune response
Time course of immune response Route of entry Route of entry (cont.) Steps in infection Barriers to infection Mf receptors Facilitate engulfment Glucan, mannose Scavenger CD11b/CD18 Allows immediate response
I. Lines of Defense Pathogen: Table 1: Types of Immune Mechanisms. Table 2: Innate Immunity: First Lines of Defense
I. Lines of Defense Pathogen: Table 1: Types of Immune Mechanisms Table 2: Innate Immunity: First Lines of Defense Innate Immunity involves nonspecific physical & chemical barriers that are adapted for
Innate Immunity. Jan 8 th Prof. dr. sc. Ivana Novak Nakir 1
Innate Immunity Jan 8 th 2018. Prof. dr. sc. Ivana Novak Nakir 1 Adaptive Innate 2 Immune system overview 1 st line of defense skin (2m 2 ) and mucosal membranes (~400m 2 ): physical barrier, lymphoid
Supporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma
Supporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma Jiejun Gao 1, Lu Lin 2, Alexander Wei 2,*, and Maria S. Sepúlveda 1,* 1 Department of Forestry and Natural
Cutaneous Immunology: Innate Immune Responses. Skin Biology Lecture Series
Cutaneous Immunology: Innate Immune Responses Skin Biology Lecture Series The Immune Response: Innate and Adaptive Components Source: Wolff, Goldsmith, Katz, Gilchrest, Paller, Leffell. Fitzpatrick s Dermatology
Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells
Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells Andrew H. Lichtman, M.D. Ph.D. Department of Pathology Brigham and Women s Hospital and Harvard
IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS
LECTURE: 07 Title: IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS LEARNING OBJECTIVES: The student should be able to: The chemical nature of the cellular surface receptors. Define the location of the
An#body structure & func#on
An#body structure & func#on Objec&ves You should be able to: ü Define an&body ü Describe an&body structure ü Compare between different types or classes of an&body and their func&on An#bodies = Immunoglobulin
Overview of the immune system
Overview of the immune system Immune system Innate (nonspecific) 1 st line of defense Adaptive (specific) 2 nd line of defense Cellular components Humoral components Cellular components Humoral components
Immunology - Lecture 2 Adaptive Immune System 1
Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers
The Immune System. These are classified as the Innate and Adaptive Immune Responses. Innate Immunity
The Immune System Biological mechanisms that defend an organism must be 1. triggered by a stimulus upon injury or pathogen attack 2. able to counteract the injury or invasion 3. able to recognise foreign
Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection.
Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Genes found to be significantly upregulated (FDR2) in Y strain
Chapter 23 Immunity Exam Study Questions
Chapter 23 Immunity Exam Study Questions 1. Define 1) Immunity 2) Neutrophils 3) Macrophage 4) Epitopes 5) Interferon 6) Complement system 7) Histamine 8) Mast cells 9) Antigen 10) Antigens receptors 11)
ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY
ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY The recognition of specific antigen by naïve T cell induces its own activation and effector phases. T helper cells recognize peptide antigens through
immunity produced by an encounter with an antigen; provides immunologic memory. active immunity clumping of (foreign) cells; induced by crosslinking
active immunity agglutination allografts immunity produced by an encounter with an antigen; provides immunologic memory. clumping of (foreign) cells; induced by crosslinking of antigenantibody complexes.
Principles of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
Innate immunity. Abul K. Abbas University of California San Francisco. FOCiS
1 Innate immunity Abul K. Abbas University of California San Francisco FOCiS 2 Lecture outline Components of innate immunity Recognition of microbes and dead cells Toll Like Receptors NOD Like Receptors/Inflammasome
Prof. Ibtesam Kamel Afifi Professor of Medical Microbiology & Immunology
By Prof. Ibtesam Kamel Afifi Professor of Medical Microbiology & Immunology Lecture objectives: At the end of the lecture you should be able to: Enumerate features that characterize acquired immune response
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding
Immunology Part II. Innate Immunity. 18. April 2018, Ruhr-Universität Bochum Marcus Peters,
Immunology Part II Innate Immunity 18. April 2018, Ruhr-Universität Bochum Marcus Peters, marcus.peters@rub.de Conserved structures of pathogens PAMPs are detected by Pattern Recognition Receptors PRRs
Examples of questions for Cellular Immunology/Cellular Biology and Immunology
Examples of questions for Cellular Immunology/Cellular Biology and Immunology Each student gets a set of 6 questions, so that each set contains different types of questions and that the set of questions
T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
T Cell Activation, Costimulation and Regulation
1 T Cell Activation, Costimulation and Regulation Abul K. Abbas, MD University of California San Francisco 2 Lecture outline T cell antigen recognition and activation Costimulation, the B7:CD28 family
Clinical Basis of the Immune Response and the Complement Cascade
Clinical Basis of the Immune Response and the Complement Cascade Bryan L. Martin, DO, MMAS, FACAAI, FAAAAI, FACOI, FACP Emeritus Professor of Medicine and Pediatrics President, American College of Allergy,
Innate Immunity II. Integration. Lindsay Nicholson Advanced Immunology L2
Innate Immunity II Integration Lindsay Nicholson Advanced Immunology L2 l.nicholson@bristol.ac.uk Lecture 1 Defining Innate Immunity Recognition and effector mechanisms (I) Lecture 2 Recognition and effector
Adaptive Immunity to Bacteria. T cell subsets
Adaptive Immunity to Bacteria Role of T cells in anti-bacterial host responses. Dr. C. Piccirillo Department of Microbiology & Immunology McGill University T cell subsets MHC I and II -restricted cells
Principles of Adaptive Immunity
Principles of Adaptive Immunity Chapter 3 Parham Hans de Haard 17 th of May 2010 Agenda Recognition molecules of adaptive immune system Features adaptive immune system Immunoglobulins and T-cell receptors
Immunology. T-Lymphocytes. 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters,
Immunology T-Lymphocytes 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters, karin.peters@rub.de The role of T-effector cells in the immune response against microbes cellular immunity humoral immunity
Basic Immunology. Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction
Basic Immunology Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction Molecular structure of MHC, subclasses, genetics, functions. Antigen presentation and MHC restriction.
Antigen Presentation and T Lymphocyte Activation. Abul K. Abbas UCSF. FOCiS
1 Antigen Presentation and T Lymphocyte Activation Abul K. Abbas UCSF FOCiS 2 Lecture outline Dendritic cells and antigen presentation The role of the MHC T cell activation Costimulation, the B7:CD28 family
Lymphatic System. Where s your immunity idol?
Lymphatic System Where s your immunity idol? Functions of the Lymphatic System Fluid Balance Drains excess fluid from tissues Lymph contains solutes from plasma Fat Absorption Lymphatic system absorbs
Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD.
Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Chapter 13: Mechanisms of Immunity to Viral Disease Prepared by
Advances in Cancer Immunotherapy
Advances in Cancer Immunotherapy Immunology 101 for the Non-Immunologist Arnold H. Zea, PhD azea@lsuhsc.edu Disclosures No relevant financial relationships to disclose This presentation does not contain
Test Bank for Basic Immunology Functions and Disorders of the Immune System 4th Edition by Abbas
Test Bank for Basic Immunology Functions and Disorders of the Immune System 4th Edition by Abbas Chapter 04: Antigen Recognition in the Adaptive Immune System Test Bank MULTIPLE CHOICE 1. Most T lymphocytes
INFLAMMATION & REPAIR
INFLAMMATION & REPAIR Lecture 7 Chemical Mediators of Inflammation Winter 2013 Chelsea Martin Special thanks to Drs. Hanna and Forzan Course Outline i. Inflammation: Introduction and generalities (lecture
chapter 17: specific/adaptable defenses of the host: the immune response
chapter 17: specific/adaptable defenses of the host: the immune response defense against infection & illness body defenses innate/ non-specific adaptable/ specific epithelium, fever, inflammation, complement,
Immune system. Aims. Immune system. Lymphatic organs. Inflammation. Natural immune system. Adaptive immune system
Aims Immune system Lymphatic organs Inflammation Natural immune system Adaptive immune system Major histocompatibility complex (MHC) Disorders of the immune system 1 2 Immune system Lymphoid organs Immune
Innate Immunity. Hathairat Thananchai, DPhil Department of Microbiology Faculty of Medicine Chiang Mai University 25 July 2017
Innate Immunity Hathairat Thananchai, DPhil Department of Microbiology Faculty of Medicine Chiang Mai University 25 July 2017 Objectives: Explain how innate immune system recognizes foreign substances
CYTOKINES. Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010.
CYTOKINES Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010. 1 What are cytokines? Glycoproteins (15 25 kda): Interleukins
Basis and Clinical Applications of Interferon
Interferon Therapy Basis and Clinical Applications of Interferon JMAJ 47(1): 7 12, 2004 Jiro IMANISHI Professor, Kyoto Prefectural University of Medicine Abstract: Interferon (IFN) is an antiviral substance
Development Team. Head, Department of Zoology, University of Delhi. Department of Zoology, University of Delhi
Paper No.: 10: Module : 03: cells, BCR, TCR, Co-receptors, properties of antigen recognized by Development Team Principal Investigator: Co-Principal Investigator: Paper Coordinator: Content Writer: Content
T Cell Activation. Patricia Fitzgerald-Bocarsly March 18, 2009
T Cell Activation Patricia Fitzgerald-Bocarsly March 18, 2009 Phases of Adaptive Immune Responses Phases of T cell responses IL-2 acts as an autocrine growth factor Fig. 11-11 Clonal Expansion of T cells
Macrophage Activation & Cytokine Release. Dendritic Cells & Antigen Presentation. Neutrophils & Innate Defense
Macrophage Activation & Cytokine Release Dendritic Cells & Antigen Presentation Neutrophils & Innate Defense Neutrophils Polymorphonuclear cells (PMNs) are recruited to the site of infection where they
I. Defense Mechanisms Chapter 15
10/24/11 I. Defense Mechanisms Chapter 15 Immune System Lecture PowerPoint Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Defense Mechanisms Protect against
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving
April 01, Immune system.notebook
I. First Line of Defense: Skin and Mucus Membranes Non Specific A. Skin Surface 1. dry, dead, thick, secretions 2. sweat and sebaceous glands: antibiotics, lactic acid, RNase B. Mucus (moist and sometimes
Antibody-Cytokine- Autoimmune
Antibody-Cytokine- Autoimmune Surasak Wongratanacheewin, Ph.D Dean, Graduate School, KKU Microbiology, Faculty of Medicine, KKU sura_wng@kku.ac.th การอบรมหล กส ตรประกาศน ยบ ตรการข นทะเบ ยนช วว ตถ ว นท
I. Critical Vocabulary
I. Critical Vocabulary A. Immune System: a set of glands, tissues, cells, and dissolved proteins that combine to defend against non-self entities B. Antigen: any non-self chemical that triggers an immune
remember that T-cell signal determine what antibody to be produce class switching somatical hypermutation all takes place after interaction with
بسم هللا الرحمن الرحيم The last lecture we discussed the antigen processing and presentation and antigen recognition then the activation by T lymphocyte and today we will continue with B cell recognition
T cell maturation. T-cell Maturation. What allows T cell maturation?
T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry
Adaptive Immunity. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 16 Adaptive Immunity The Body s Third Line of Defense Adaptive Immunity Adaptive immunity
Immunology Lesson plan for international medical students
Immunology Lesson plan for international medical students Kermanshah University of medical sciences (KUMS) international affairs School of medicine Department of Immunology Lecturers: Dr. Ali Gorgin Karaji
Adaptive Immunity: Specific Defenses of the Host
17 Adaptive Immunity: Specific Defenses of the Host SLOs Differentiate between innate and adaptive immunity, and humoral and cellular immunity. Define antigen, epitope, and hapten. Explain the function
Anti-infectious Immunity
Anti-infectious Immunity innate immunity barrier structures Secretory molecules Phagocytes NK cells Anatomical barriers 1. Skin and mucosa barrier 2.hemo-Spinal Fluid barrier 3. placental barrier Phagocytic
Adaptive Immunity. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R
CSLO7. Describe functions of host defenses and the immune system in combating infectious diseases and explain how immunizations protect against specific diseases. PowerPoint Lecture Presentations prepared
Immunology lecture: 14. Cytokines: Main source: Fibroblast, but actually it can be produced by other types of cells
Immunology lecture: 14 Cytokines: 1)Interferons"IFN" : 2 types Type 1 : IFN-Alpha : Main source: Macrophages IFN-Beta: Main source: Fibroblast, but actually it can be produced by other types of cells **There
Cytokines modulate the functional activities of individual cells and tissues both under normal and pathologic conditions Interleukins,
Cytokines http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter22/animation the_immune_response.html Cytokines modulate the functional activities of individual cells and tissues both under
White Blood Cells (WBCs)
YOUR ACTIVE IMMUNE DEFENSES 1 ADAPTIVE IMMUNE RESPONSE 2! Innate Immunity - invariant (generalized) - early, limited specificity - the first line of defense 1. Barriers - skin, tears 2. Phagocytes - neutrophils,
Tumor Immunology. Wirsma Arif Harahap Surgical Oncology Consultant
Tumor Immunology Wirsma Arif Harahap Surgical Oncology Consultant 1) Immune responses that develop to cancer cells 2) Escape of cancer cells 3) Therapies: clinical and experimental Cancer cells can be
2. Innate immunity 2013
1 Innate Immune Responses 3 Innate immunity Abul K. Abbas University of California San Francisco The initial responses to: 1. Microbes: essential early mechanisms to prevent, control, or eliminate infection;
Unit 5 The Human Immune Response to Infection
Unit 5 The Human Immune Response to Infection Unit 5-page 1 FOM Chapter 21 Resistance and the Immune System: Innate Immunity Preview: In Chapter 21, we will learn about the branch of the immune system
Chapter 19: IgE-Dependent Immune Responses and Allergic Disease
Allergy and Immunology Review Corner: Chapter 19 of Cellular and Molecular Immunology (Seventh Edition), by Abul K. Abbas, Andrew H. Lichtman and Shiv Pillai. Chapter 19: IgE-Dependent Immune Responses
Intrinsic cellular defenses against virus infection
Intrinsic cellular defenses against virus infection Detection of virus infection Host cell response to virus infection Interferons: structure and synthesis Induction of antiviral activity Viral defenses
General Overview of Immunology. Kimberly S. Schluns, Ph.D. Associate Professor Department of Immunology UT MD Anderson Cancer Center
General Overview of Immunology Kimberly S. Schluns, Ph.D. Associate Professor Department of Immunology UT MD Anderson Cancer Center Objectives Describe differences between innate and adaptive immune responses