SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS
|
|
- Nancy Elliott
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi annexin A2 gi Phosphatidylethanolamine-binding protein 1(PEBP-1) gi glutathione S-transferase P gi Malate dehydrogenase gi serotransferrin precursor gi annexin I gi 74 8 fatty acid-binding protein, epidermal gi regucalcin gi glutathione S-transferase Mu 1 gi cathepsin D gi beta-2-glycoprotein I gi 6 13 superoxide dismutase [Cu-Zn] gi glutathione S-transferase mu 3 gi ectonucleotide pyrophosphatase/phosphodiesterase 5 gi (putative function) 16 Sperm adhesion molecule 1 (PH-20 hyaluronidase, zona gi pellucida binding) 17 acylphosphatase-1 gi acyl-coa-binding protein gi protein DJ-1 gi sialate O-acetylesterase gi Transaldolase gi leucine-rich alpha-2-glycoprotein gi alpha 3 type VI collagen, partial gi coactosin-like protein gi inter-alpha (globulin) inhibitor H4 (plasma Kallikreinsensitive gi glycoprotein) 26 glucosamine 6-phosphate N-acetyltransferase gi transgelin gi haptoglobin precursor gi plasma glutamate carboxypeptidase precursor gi epididymal secretory protein E1 precursor gi lumican precursor gi lysosomal Pro-X carboxypeptidase precursor gi annexin A5 gi rho GDP-dissociation inhibitor 1 gi acrosin gi cathepsin C gi rho GDP-dissociation inhibitor 2 gi glutathione S-transferase mu 1 gi N-acetylglucosamine-6-sulfatase precursor gi Huang et al., SUPPLEMENTAL TABLE I Page 1 of 2
2 No. Protein 40 alpha-1b-glycoprotein precursor gi SH3 domain-binding glutamic acid-rich-like protein gi annexin A3 gi alpha-1-acid glycoprotein precursor gi thioredoxin gi tubulin polymerization-promoting protein family gi member 2 46 Ig heavy chain precursor (B/MT.4A.17.H5.A5) - bovine gi immunoglobulin lambda light chain constant region 2 gi allotypic variant IGLC2a 48 cathepsin B precursor gi fatty acid-binding protein, adipocyte gi plastin-3 gi hemoglobin subunit beta gi phospholipase D3 gi UV excision repair protein RAD23 homolog B gi IGL@ gi putative phospholipase B-like 2 precursor gi kininogen I precursor gi microtubule-associated protein RP/EB family member 1 gi CD5 gi eppin gi PDZ and LIM domain protein 3 gi complement factor B precursor gi Y-box-binding protein 2 gi D-dopachrome decarboxylase gi eukaryotic translation initiation factor 3 subunit J gi macrophage migration inhibitory factor gi NAGA protein gi gamma-glutamylcyclotransferase gi Huang et al., SUPPLEMENTAL TABLE I Page 2 of 2
3 SUPPLEMENTAL TABLE II. Identified Proteins in Bovine Testicular Hyaluronidase Type IV-S via LC-MS/MS No. Protein 1 serum albumin precursor gi annexin A2 gi annexin I gi 74 4 Phosphatidylethanolamine-binding protein 1(PEBP-1) gi glutathione S-transferase P gi ectonucleotide pyrophosphatase/phosphodiesterase 5 gi (putative function) 7 cathepsin D gi beta-2-glycoprotein I gi 6 9 sialate O-acetylesterase gi fatty acid-binding protein, epidermal gi annexin A5 gi ANXA5 protein gi regucalcin gi acyl-coa-binding protein gi Sperm adhesion molecule 1 (PH-20 hyaluronidase, zona gi pellucida binding) 16 superoxide dismutase [Cu-Zn] gi N-acetylglucosamine-6-sulfatase precursor gi alpha 3 type VI collagen, partial gi cathepsin C gi putative phospholipase B-like 2 precursor gi glutathione S-transferase Mu 1 gi haptoglobin precursor gi leucine-rich alpha-2-glycoprotein gi lysosomal Pro-X carboxypeptidase precursor gi acylphosphatase-1 gi annexin A3 gi inter-alpha (globulin) inhibitor H4 (plasma Kallikreinsensitive gi glycoprotein) 28 transaldolase gi acrosin gi SH3 domain-binding glutamic acid-rich-like protein gi Malate dehydrogenase gi cathepsin B precursor gi glucosamine 6-phosphate N-acetyltransferase gi fatty acid-binding protein, heart gi kda glucose-regulated protein precursor gi phospholipase D3 gi plasma glutamate carboxypeptidase precursor gi tubulin polymerization-promoting protein family gi member 2 Huang et al., SUPPLEMENTAL TABLE II Page 1 of 3
4 No. Protein 39 coactosin-like protein gi Rsb-66 protein gi serotransferrin precursor gi epididymal secretory protein E1 precursor gi lumican precursor gi gamma-glutamylcyclotransferase gi gamma-glutamyl hydrolase precursor gi fatty acid-binding protein, adipocyte gi myosin light chain kinase, smooth muscle gi cysteine-rich secretory protein 2 gi IgG2a heavy chain constant region gi glutathione S-transferase mu 1 gi immunoglobulin lambda-like polypeptide 1-like gi alpha-1-acid glycoprotein precursor gi aminoacyl trna synthase complex-interacting gi multifunctional protein 1 54 talin 1 gi microtubule-associated protein RP/EB family member 1 gi protein NipSnap homolog 3A gi activated RNA polymerase II transcriptional coactivator gi p15 58 UV excision repair protein RAD23 homolog B gi anti-testosterone antibody gi glutathione S-transferase mu 3 gi peroxiredoxin-4 gi lymphocyte cytosolic protein 1 (L-plastin) gi phosphatidylethanolamine-binding protein 4 gi cathepsin L2 precursor gi alpha-1b-glycoprotein precursor gi cathepsin F gi heat shock-related 70 kda protein 2 gi pro-cathepsin H precursor gi plastin-3 gi heat shock cognate 71 kda protein gi complement factor B precursor gi thioredoxin gi spectrin beta chain, brain 1 gi rho GDP-dissociation inhibitor 1 gi mesencephalic astrocyte-derived neurotrophic factor gi precursor 76 palmitoyl-protein thioesterase 1 precursor gi cathepsin S gi protein DJ-1 gi LIM protein gi glucosylceramidase precursor gi Huang et al., SUPPLEMENTAL TABLE II Page 2 of 3
5 No. Protein 81 DNAJA4 protein gi interleukin enhancer binding factor 3, 90kDa gi ADP-ribosyltransferase 3 gi filamin A, alpha gi D-tyrosyl-tRNA(Tyr) deacylase 1 gi PDIA6 protein gi ganglioside GM2 activator gi Chain I, Trypsin gi immunoglobulin light chain variable region gi myristoyl CoA:protein N-myristoyltransferase gi gamma-inducible protein 30 gi lysozyme-like protein 1 precursor gi AMBP protein gi immunoglobulin lambda light chain constant region 3 gi allotypic variant IGLC3c 95 rho GDP-dissociation inhibitor 2 gi eppin gi serine carboxypeptidase vitellogenic-like gi CD5 gi tubulin polymerization-promoting protein family gi member vesicle-associated membrane protein-associated protein gi A 101 acid sphingomyelinase-like phosphodiesterase 3a gi precursor Huang et al., SUPPLEMENTAL TABLE II Page 3 of 3
6 SUPPLEMENTAL TABLE III. Identified Proteins in rhuph20 via LC-MS/MS No. Protein 1 hyaluronidase PH-20 isoform 2 [Homo sapiens] gi Huang et al., SUPPLEMENTAL TABLE I Page 1 of 1
Biological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase
Full name Glyceraldehyde3 phosphate dehydrogenase Succinatesemialdehyde Glutamate dehydrogenase 1, Alcohol dehydrogenase [NADP+] 2',3'cyclicnucleotide 3' phosphodiesterase Dihydropyrimidinaserelated 2
More informationSupporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma
Supporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma Jiejun Gao 1, Lu Lin 2, Alexander Wei 2,*, and Maria S. Sepúlveda 1,* 1 Department of Forestry and Natural
More informationSupplemental Information. Host-Microbiota Interactions in the Pathogenesis. of Antibiotic-Associated Diseases
Cell Reports, Volume Supplemental Information Host-Microbiota Interactions in the Pathogenesis of -Associated Diseases Joshua S. Lichtman, Jessica A. Ferreyra, Katharine M. Ng, Samuel A. Smits, Justin
More informationTable S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.
Table S1 Differentially expressed genes showing > 2 fold changes and p
More informationFig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A).
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease
More informationSwissProt/ TrEmbl Acc. No. 1 Description. Found in Other Studies 5. MW (kda) 2 pi 3 Function 4
P02774 Vitamin D-binding protein precursor 52.95 5.4 Cell communication c, a,b S,C P08833 Insulin-like growth factor binding protein 1 precursor 27.88 5.1 Cell communication c, a P02760 AMBP protein precursor
More informationTECHNICAL NOTE. Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive
TECHNICAL NOTE Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive In this technical note you will learn about: Step-by-step set-up of parallel reaction monitoring (PRM)
More informationACCESSORY PUBLICATION. Supplementary Table 1. Genes up regulated in the skin of both HR and LR animals. after tick larval challenge e
ACCESSORY PUBLICATION Supplementary Table 1. Genes up regulated in the skin of both HR and LR animals after tick larval challenge e GenBank Accession a No. of elemen ts b t=0 Signal intensity c t=0 Description
More informationnumber Done by Corrected by Doctor F. Al-Khateeb
number 23 Done by A. Rawajbeh Corrected by Doctor F. Al-Khateeb Ketone bodies Ketone bodies are used by the peripheral tissues like the skeletal and cardiac muscles, where they are the preferred source
More informationValidated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name
5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)
More informationGMI STUDY. COMPARATIVE PROTEOMIC STUDY BETWEEN GMI and STRAUMANN DENTAL IMPLANTS
GMI STUDY. COMPARATIVE PROTEOMIC STUDY BETWEEN GMI and STRAUMANN DENTAL IMPLANTS 2 Hypothesis. Proteomic study of first protein layer Post-implantation, the biomaterial becomes in contact with the blood,
More informationBiosynthesis of Fatty Acids
Biosynthesis of Fatty Acids Fatty acid biosynthesis takes place in the cytosol rather than the mitochondria and requires a different activation mechanism and different enzymes and coenzymes than fatty
More informationSupporting Information
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2018 Supporting Information Covalent functionalization of graphene oxide with
More informationSupporting Information. Synthesis of Zwitterionic Polymer Particles via Combined Distillation
Supporting Information Synthesis of Zwitterionic Polymer Particles via Combined Distillation Precipitation Polymerization and Click Chemistry for Highly Efficient Enrichment of Glycopeptide Jianxi Liu,
More informationImmune suppression in Atlantic salmon: smoltification, sea water transfer and breeding
Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding Aleksei Krasnov, Nofima FHFs fiskehelsesamling 1.-2. september 2015 Smoltifiction and breeding suppress immunity in
More informationReceptor mediated Signal Transduction
Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third
More informationAn#body structure & func#on
An#body structure & func#on Objec&ves You should be able to: ü Define an&body ü Describe an&body structure ü Compare between different types or classes of an&body and their func&on An#bodies = Immunoglobulin
More informationCell-Derived Inflammatory Mediators
Cell-Derived Inflammatory Mediators Introduction about chemical mediators in inflammation Mediators may be Cellular mediators cell-produced or cell-secreted derived from circulating inactive precursors,
More informationSupplementary Data A
Supplementary Data A Proteomic data and MS/MS fragmentation spectra from 2-DE and GeLC-MS/MS analysis of the bovine teat canal lining and the outer teat skin epithelium Table A1: 2-DE proteins spots identified
More informationGlycolysis - Plasmodium
Apicomplexan Biochemistry Basics Toxoplasma Good cell biology model Genome sequencing not completed Virtual pathways Cryptosporidium The strange one Genome sequence completed Virtual pathways Plasmodium
More informationCellular functions of protein degradation
Protein Degradation Cellular functions of protein degradation 1. Elimination of misfolded and damaged proteins: Environmental toxins, translation errors and genetic mutations can damage proteins. Misfolded
More informationCO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems
CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems Vasco Mota*, Tom Nilsen, Elizabeth Ytteborg, Grete Baeverfjord, Aleksei Krasnov, Jelena Kolarevic, Lars Ebbesson, Steven
More informationTable S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function
Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function 1 BPSL0024 26223 26621 + LrgA family BPSL0025 26690 27412 + hypothetical
More informationMultiple High-Abundant Protein Removal for Proteomics. Dr. Cory Szafranski, Product Manager
Multiple High-Abundant Protein Removal for Proteomics Dr. Cory Szafranski, Product Manager Agilent Multiple Affinity Removal System - What is it? H L High-Abundant Proteins (Albumin, IgG, IgA, Transferrin,
More informationREGULATION OF ENZYME ACTIVITY. Medical Biochemistry, Lecture 25
REGULATION OF ENZYME ACTIVITY Medical Biochemistry, Lecture 25 Lecture 25, Outline General properties of enzyme regulation Regulation of enzyme concentrations Allosteric enzymes and feedback inhibition
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationAhmad Ulnar. Faisal Nimri ... Dr.Faisal
24 Ahmad Ulnar Faisal Nimri... Dr.Faisal Fatty Acid Synthesis - Occurs mainly in the Liver (to store excess carbohydrates as triacylglycerols(fat)) and in lactating mammary glands (for the production of
More informationTable S1. CRC case Pool Control Pool Name UniProt No. FC b VIP value d Spectral Counts Spectral Counts
Table S1. page 1/4 Phase 1 Exploratory Study, List of proteins identified by LC-ESI-MS/MS after 1DE separation and their relative quantitation by spectral count UniProt Entry SwissProt- CRC case Pool Control
More informationModel Answer. M.Sc. Zoology (First Semester) Examination Paper LZT 103 (Endocrinology)
Model Answer M.Sc. Zoology (First Semester) Examination-2013 Paper LZT 103 (Endocrinology) Section A 1. (i) d (ii) b (iii) b (iv) c (v) c (vi) a (vii) c (viii) a (ix) d (x) b Section B Q.2 Answer Hormonal
More informationLecture 13 (10/13/17)
Lecture 13 (10/13/17) Reading: Ch6; 187-189, 204-205 Problems: Ch4 (text); 2, 3 NXT (after xam 2) Reading: Ch6; 190-191, 194-195, 197-198 Problems: Ch6 (text); 5, 6, 7, 24 OUTLIN NZYMS: Binding & Catalysis
More informationSphingosine-1-phosphate signaling and cardiac fibrosis. Department of Physiology, Kanazawa University School of Medicine, Kanazawa, Japan
96 Special Issue: Cellular and Molecular Bases for Fibrotic Diseases Review Article Sphingosine-1-phosphate signaling and cardiac fibrosis Noriko Takuwa 1, 2, ), Yasuo Okamoto 1), Kazuaki Yoshioka 1) and
More informationLECTURE: 21. Title IMMUNOGLOBULINS FUNCTIONS & THEIR RECEPTORS LEARNING OBJECTIVES:
LECTURE: 21 Title IMMUNOGLOBULINS FUNCTIONS & THEIR RECEPTORS LEARNING OBJECTIVES: The student should be able to: Determine predominant immunoglobulin isotypes in serum. Determine the predominant immunoglobulin
More informationEnergy storage in cells
Energy storage in cells Josef Fontana EC - 58 Overview of the lecture Introduction to the storage substances of human body Overview of storage compounds in the body Glycogen metabolism Structure of glycogen
More informationCELLS. Cells. Basic unit of life (except virus)
Basic unit of life (except virus) CELLS Prokaryotic, w/o nucleus, bacteria Eukaryotic, w/ nucleus Various cell types specialized for particular function. Differentiation. Over 200 human cell types 56%
More informationLIPID METABOLISM
LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-
More informationBIOLOGY 103 Spring 2001 MIDTERM LAB SECTION
BIOLOGY 103 Spring 2001 MIDTERM NAME KEY LAB SECTION ID# (last four digits of SS#) STUDENT PLEASE READ. Do not put yourself at a disadvantage by revealing the content of this exam to your classmates. Your
More informationESTUDIO GMI. ESTUDIO PROTEÓMICO-COMPARACIÓN IMPLANTES DENTALES
ESTUDIO GMI. ESTUDIO PROTEÓMICO-COMPARACIÓN IMPLANTES DENTALES 2 Hypothesis. Proteomic study of first protein layer Post-implantation, the biomaterial becomes in contact with the blood, resulting in protein
More informationAmino acids. Side chain. -Carbon atom. Carboxyl group. Amino group
PROTEINS Amino acids Side chain -Carbon atom Amino group Carboxyl group Amino acids Primary structure Amino acid monomers Peptide bond Peptide bond Amino group Carboxyl group Peptide bond N-terminal (
More informationPhospholipids Metabolism
Chapter VI: Phospholipids Metabolism Dr. Sameh Sarray Hlaoui Phospholipids Features: Amphipatic: - Hydrophobic head: fatty acids - Hydropholic head: P group+ alcohol Composed of alcohol attached by a phosphodiester
More informationLevels of organization
The Cell 1.The cell the basic structural and functional unit of living organisms 2.Prokaryotic and Eukaryotic Cells 3.Cellular organization: external morphology cell size, shape and color internal structure
More informationMBBS First Professional (Part-I Examination) BIOCHEMISTRY Model Paper
MBBS FIRST PROFESSIONAL (PART I) Biochemistry (MCQs) Maximum Marks: 35 Time Allowed: 45 minutes Q 1. What is not correct about cell membrane? A. Contains two layers of phospholipids B. May contain receptor
More informationChapter 19: IgE-Dependent Immune Responses and Allergic Disease
Allergy and Immunology Review Corner: Chapter 19 of Cellular and Molecular Immunology (Seventh Edition), by Abul K. Abbas, Andrew H. Lichtman and Shiv Pillai. Chapter 19: IgE-Dependent Immune Responses
More informationSeparation of Main Proteins in Plasma and Serum
BCH 471 Experiment (2) Separation of Main Proteins in Plasma and Serum PLASMA PROTEINS Mw The main plasma proteins are: þ Albumin (36-50 g/l), Mw 66.241kDa. þ Globulins (18-32 g/l), Mw of globulins Cover
More informationSupplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
More informationFIRST BIOCHEMISTRY EXAM Tuesday 25/10/ MCQs. Location : 102, 105, 106, 301, 302
FIRST BIOCHEMISTRY EXAM Tuesday 25/10/2016 10-11 40 MCQs. Location : 102, 105, 106, 301, 302 The Behavior of Proteins: Enzymes, Mechanisms, and Control General theory of enzyme action, by Leonor Michaelis
More informationMetabolism of acylglycerols and sphingolipids. Martina Srbová
Metabolism of acylglycerols and sphingolipids Martina Srbová Types of glycerolipids and sphingolipids 1. Triacylglycerols function as energy reserves adipose tissue (storage of triacylglycerol), lipoproteins
More informationIII. Metabolism The Citric Acid Cycle
Department of Chemistry and Biochemistry University of Lethbridge III. Metabolism The Citric Acid Cycle Slide 1 The Eight Steps of the Citric Acid Cycle Enzymes: 4 dehydrogenases (2 decarboxylation) 3
More informationMOLECULAR WEIGHT OF DIFFERENT PROTEINS PRESENT IN ZEBRAFISH EMBRYO DURING GASTRULATION PERIOD
MOLECULAR WEIGHT OF DIFFERENT PROTEINS PRESENT IN ZEBRAFISH EMBRYO DURING GASTRULATION PERIOD 1) 37% molecular weight of about 97KDa 2) 14.6% molecular weight of about 45 KDa 3+4) 27.4% molecular weight
More informationLevels of organization
The Cell 1.The cell the basic structural and functional unit of living organisms 2.Prokaryotic and Eukaryotic Cells 3.Cellular organization: external morphology cell size, shape and color internal structure
More informationSignal Transduction Cascades
Signal Transduction Cascades Contents of this page: Kinases & phosphatases Protein Kinase A (camp-dependent protein kinase) G-protein signal cascade Structure of G-proteins Small GTP-binding proteins,
More informationMedical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University
Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve
More informationBiochemistry 423 Final Examination NAME:
Biochemistry 423 Final Examination NAME: 1 Circle the single BEST answer (3 points each) 1. At equilibrium the free energy of a reaction G A. depends only on the temperature B. is positive C. is 0 D. is
More informationAmino Acids and Proteins (2) Professor Dr. Raid M. H. Al-Salih
Amino Acids and Proteins (2) Professor Dr. Raid M. H. Al-Salih 1 Some important biologically active peptides 2 Proteins The word protein is derived from Greek word, proteios which means primary. As the
More informationINTERACTION DRUG BODY
INTERACTION DRUG BODY What the drug does to the body What the body does to the drug Receptors - intracellular receptors - membrane receptors - Channel receptors - G protein-coupled receptors - Tyrosine-kinase
More informationProtein Trafficking in the Secretory and Endocytic Pathways
Protein Trafficking in the Secretory and Endocytic Pathways The compartmentalization of eukaryotic cells has considerable functional advantages for the cell, but requires elaborate mechanisms to ensure
More informationCell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
More informationSupporting Information
Comparative Proteomic Study of Fatty Acid-treated Myoblasts Reveals Role of Cox-2 in Palmitate-induced Insulin Resistance Supporting Information Xiulan Chen 1#, Shimeng Xu 2,3#, Shasha Wei 1,3, Yaqin Deng
More informationAntibody-Cytokine- Autoimmune
Antibody-Cytokine- Autoimmune Surasak Wongratanacheewin, Ph.D Dean, Graduate School, KKU Microbiology, Faculty of Medicine, KKU sura_wng@kku.ac.th การอบรมหล กส ตรประกาศน ยบ ตรการข นทะเบ ยนช วว ตถ ว นท
More informationProteomic Analysis of Glomeruli in Diabetes 1
Proteomic Analysis of Glomeruli in Diabetes 1 Table 1: Identified Proteins from Mouse Glomerular Proteome Map spot# ; Regulation Functional swiss prot mass with group Protein entry (kda) pi Diabetes* Cytoskeletal
More informationQuiz #1. BIO200 January 11, point each
Quiz #1 January 11, 2013 1. The primary amine group of an amino acid has a pka of 10 and the carboxylic acid group of an amino acid has a pka of 2. The side chain of the amino acid alanine is a methyl
More informationSarah Jaar Marah Al-Darawsheh
22 Sarah Jaar Marah Al-Darawsheh Faisal Mohammad Receptors can be membrane proteins (for water-soluble hormones/ligands) or intracellular (found in the cytosol or nucleus and bind to DNA, for lipid-soluble
More informationGENERAL CHARACTERISTICS OF THE ENDOCRINE SYSTEM FIGURE 17.1
GENERAL CHARACTERISTICS OF THE ENDOCRINE SYSTEM FIGURE 17.1 1. The endocrine system consists of glands that secrete chemical signals, called hormones, into the blood. In addition, other organs and cells
More informationBio Metabolism. Metabolism Life is a bag of biochemistry. Chloroplasts and mitochondria. What is food?
Metabolism Life is a bag of biochemistry 1 Chloroplasts and mitochondria Heat Carbohydrate O 2 CO 2 + H 2 O Heat Chloroplast Mitochondria 2 What is food? Proteins - polymers of amino acids Carbohydrates
More informationSupplementary Data. References
Supplementary Data Materials and Methods Sample collection from acute kidney injury patients Urine samples were obtained from patients who had cardiac surgery at one academic medical center and two local
More informationSUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body
More informationActivation of the endocannabinoid system by organophosphorus nerve agents
1 Supplementary Information Activation of the endocannabinoid system by organophosphorus nerve agents Daniel K. Nomura, 1 Jacqueline L. Blankman, 2 Gabriel M. Simon, 2 Kazutoshi Fujioka, 1 Roger S. Issa,
More informationMultiplex Protein Quantitation using itraq Reagents in a Gel-Based Workflow
Multiplex Protein Quantitation using itraq Reagents in a Gel-Based Workflow Purpose Described herein is a workflow that combines the isobaric tagging reagents, itraq Reagents, with the separation power
More informationProteins are sometimes only produced in one cell type or cell compartment (brain has 15,000 expressed proteins, gut has 2,000).
Lecture 2: Principles of Protein Structure: Amino Acids Why study proteins? Proteins underpin every aspect of biological activity and therefore are targets for drug design and medicinal therapy, and in
More informationPosttranslational Modification of Proteins
Posttranslational Modification of Proteins Expanding Natures Inventory Christopher T. Walsh Harvard Medical School RoBERTS AND CoMPANY PuBLISHERS Englewood, Col ~1 ado,. Brief Contents Preface xv Reviewers
More informationBCM 221 LECTURES OJEMEKELE O.
BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX
More informationCYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
More informationBIOL 158: BIOLOGICAL CHEMISTRY II
BIOL 158: BIOLOGICAL CHEMISTRY II Lecture 5: Vitamins and Coenzymes Lecturer: Christopher Larbie, PhD Introduction Cofactors bind to the active site and assist in the reaction mechanism Apoenzyme is an
More informationSynthesis and elongation of fatty acids
Synthesis and elongation of fatty acids A molecular caliper mechanism for determining very long-chain fatty acid length Vladimir Denic and Jonathan S. Weissman (2007) Cell 130, 663-677 February 28, 2008
More informationSupplementary Tables 1
Supplementary Tables 1 Supplementary Table 1: The 11 genes in the geneset for Case Study 1 At1g62570 At1g09350 At1g60470 At2g47180 At4g17090 At5g20830 At2g16890 At3g51240 At3g55120 At4g27560 At5g08640
More informationPHM142 Lecture 4: Platelets + Endothelial Cells
PHM142 Lecture 4: Platelets + Endothelial Cells 1 Hematopoiesis 2 Platelets Critical in clotting - activated by subendothelial matrix proteins (e.g. collagen, fibronectin, von Willebrand factor) and thrombin
More informationLehninger 5 th ed. Chapter 17
Lehninger 5 th ed. Chapter 17 December 26, 2010 Prof. Shimon Schuldiner Email: Shimon.Schuldiner@huji.ac.il Phone: 6585992 CHAPTER 17 Fatty Acid Catabolism Key topics: How fats are digested in animals
More informationSignal Transduction: G-Protein Coupled Receptors
Signal Transduction: G-Protein Coupled Receptors Federle, M. (2017). Lectures 4-5: Signal Transduction parts 1&2: nuclear receptors and GPCRs. Lecture presented at PHAR 423 Lecture in UIC College of Pharmacy,
More informationCell Membranes. Dr. Diala Abu-Hassan School of Medicine Cell and Molecular Biology
Cell Membranes Dr. Diala Abu-Hassan School of Medicine Dr.abuhassand@gmail.com Cell and Molecular Biology Organelles 2Dr. Diala Abu-Hassan Membrane proteins Major components of cells Nucleic acids DNA
More informationName: Date: Block: Biology 12
Name: Date: Block: Biology 12 Provincial Exam Review: Cell Processes and Applications January 2003 Use the following diagram to answer questions 1 and 2. 1. Which labelled organelle produces most of the
More information5/12/2015. Cell Size. Relative Rate of Reaction
Cell Makeup Chapter 4 The Cell: The Fundamental Unit of Life We previously talked about the cell membrane The cytoplasm is everything inside the membrane, except the nucleus Includes Cytosol = liquid portion
More informationCD82/ CD63 expression in human thyroid tissues
- 34-4 RESULTS 4.1 CD82/ CD63 expression in human thyroid tissues 4.1.1 Transcriptional analysis CD82 All investigated benign goiter tissues showed strong transcriptional level for CD82. Thyroid carcinoma
More informationBiosynthesis of Fatty Acids. By Dr.QUTAIBA A. QASIM
Biosynthesis of Fatty Acids By Dr.QUTAIBA A. QASIM Fatty Acids Definition Fatty acids are comprised of hydrocarbon chains terminating with carboxylic acid groups. Fatty acids and their associated derivatives
More informationI) Choose the best answer: 1- All of the following amino acids are neutral except: a) glycine. b) threonine. c) lysine. d) proline. e) leucine.
1- All of the following amino acids are neutral except: a) glycine. b) threonine. c) lysine. d) proline. e) leucine. 2- The egg white protein, ovalbumin, is denatured in a hard-boiled egg. Which of the
More informationChapter 5. Generation of lymphocyte antigen receptors
Chapter 5 Generation of lymphocyte antigen receptors Structural variation in Ig constant regions Isotype: different class of Ig Heavy-chain C regions are encoded in separate genes Initially, only two of
More informationT cell-mediated immunity
T cell-mediated immunity Overview For microbes within phagosomes in phagocytes.cd4+ T lymphocytes (TH1) Activate phagocyte by cytokines studies on Listeria monocytogenes For microbes infecting and replicating
More information(A) Urea cycle (B) TCA cycle (C) Glycolysis (D) Pyruvate oxidation (E) Respiratory chain
Biochemistry - Problem Drill 15: Citric Acid Cycle No. 1 of 10 1. Which of the following statements is not a metabolic pathway involved in carbohydrate catabolism and ATP production. (A) Urea cycle (B)
More informationFour melanocyte-stimulating hormones have the following amino acid sequences:
Assignment 14: Melanocyte-stimulating hormone belongs to a group called the melanocortins. This group includes ACTH, alpha-msh, beta-msh and gamma-msh; these peptides are all cleavage products of a large
More informationOrganelles of the Cell & How They Work Together. Packet #7
Organelles of the Cell & How They Work Together Packet #7 Introduction Introduction Organization of cells is basically similar in all cells. Additionally, most cells are tiny Ranging from 1 1000 cubic
More informationChapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002
Chapter 10 Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10: Integration and Control of Metabolism Press the space bar or click the mouse
More informationProteomic studies in Collagen Induced Arthritis (CIA) rats
V{tÑàxÜ@H Proteomic studies in Collagen Induced Arthritis (CIA) rats 5.1. Introduction Over the last few decades, both naturally occurring and genetically engineered animal models of human diseases have
More informationOrganic Compounds. Compounds that contain CARBON are called organic. Macromolecules are large organic molecules.
Macromolecules 1 Organic Compounds Compounds that contain CARBON are called organic. Macromolecules are large organic molecules. 2 Carbon (C) Carbon has 4 electrons in outer shell. Carbon can form covalent
More informationBIO 5099: Molecular Biology for Computer Scientists (et al)
BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 15: Being a Eukaryote: From DNA to Protein, A Tour of the Eukaryotic Cell. Christiaan van Woudenberg Being A Eukaryote Basic eukaryotes
More informationSUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
More informationWhat would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes.
What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. C. Mostly non-compact G1 chromosomes. D. Compact G1 and G2 chromosomes.
More informationProtein Classification based upon Biological functions
PROTEINS (a) The light produced by fireflies is the result of a reaction involving the protein luciferin and ATP, catalyzed by the enzyme luciferase. (b) Erythrocytes contain large amounts of the oxygen-transporting
More informationThe Structure and Function of Biomolecules
The Structure and Function of Biomolecules The student is expected to: 9A compare the structures and functions of different types of biomolecules, including carbohydrates, lipids, proteins, and nucleic
More informationPhotosynthesis in chloroplasts. Cellular respiration in mitochondria ATP. ATP powers most cellular work
Light energy ECOSYSTEM CO + H O Photosynthesis in chloroplasts Cellular respiration in mitochondria Organic molecules + O powers most cellular work Heat energy 1 becomes oxidized (loses electron) becomes
More informationTwo independent proteomic approaches provide a comprehensive analysis of the synovial fluid proteome response to Autologous Chondrocyte Implantation
Hulme et al. Arthritis Research & Therapy (2018) 20:87 https://doi.org/10.1186/s13075-018-1573-4 RESEARCH ARTICLE Two independent proteomic approaches provide a comprehensive analysis of the synovial fluid
More informationRevision. General functions of hormones. Hormone receptors. Hormone derived from steroids Small polypeptide Hormone
االله الرحمن الرحيم بسم Revision General functions of hormones. Hormone receptors Classification according to chemical nature Classification according to mechanism of action Compare and contrast between
More information