SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS

Size: px
Start display at page:

Download "SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS"

Transcription

1 SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi annexin A2 gi Phosphatidylethanolamine-binding protein 1(PEBP-1) gi glutathione S-transferase P gi Malate dehydrogenase gi serotransferrin precursor gi annexin I gi 74 8 fatty acid-binding protein, epidermal gi regucalcin gi glutathione S-transferase Mu 1 gi cathepsin D gi beta-2-glycoprotein I gi 6 13 superoxide dismutase [Cu-Zn] gi glutathione S-transferase mu 3 gi ectonucleotide pyrophosphatase/phosphodiesterase 5 gi (putative function) 16 Sperm adhesion molecule 1 (PH-20 hyaluronidase, zona gi pellucida binding) 17 acylphosphatase-1 gi acyl-coa-binding protein gi protein DJ-1 gi sialate O-acetylesterase gi Transaldolase gi leucine-rich alpha-2-glycoprotein gi alpha 3 type VI collagen, partial gi coactosin-like protein gi inter-alpha (globulin) inhibitor H4 (plasma Kallikreinsensitive gi glycoprotein) 26 glucosamine 6-phosphate N-acetyltransferase gi transgelin gi haptoglobin precursor gi plasma glutamate carboxypeptidase precursor gi epididymal secretory protein E1 precursor gi lumican precursor gi lysosomal Pro-X carboxypeptidase precursor gi annexin A5 gi rho GDP-dissociation inhibitor 1 gi acrosin gi cathepsin C gi rho GDP-dissociation inhibitor 2 gi glutathione S-transferase mu 1 gi N-acetylglucosamine-6-sulfatase precursor gi Huang et al., SUPPLEMENTAL TABLE I Page 1 of 2

2 No. Protein 40 alpha-1b-glycoprotein precursor gi SH3 domain-binding glutamic acid-rich-like protein gi annexin A3 gi alpha-1-acid glycoprotein precursor gi thioredoxin gi tubulin polymerization-promoting protein family gi member 2 46 Ig heavy chain precursor (B/MT.4A.17.H5.A5) - bovine gi immunoglobulin lambda light chain constant region 2 gi allotypic variant IGLC2a 48 cathepsin B precursor gi fatty acid-binding protein, adipocyte gi plastin-3 gi hemoglobin subunit beta gi phospholipase D3 gi UV excision repair protein RAD23 homolog B gi IGL@ gi putative phospholipase B-like 2 precursor gi kininogen I precursor gi microtubule-associated protein RP/EB family member 1 gi CD5 gi eppin gi PDZ and LIM domain protein 3 gi complement factor B precursor gi Y-box-binding protein 2 gi D-dopachrome decarboxylase gi eukaryotic translation initiation factor 3 subunit J gi macrophage migration inhibitory factor gi NAGA protein gi gamma-glutamylcyclotransferase gi Huang et al., SUPPLEMENTAL TABLE I Page 2 of 2

3 SUPPLEMENTAL TABLE II. Identified Proteins in Bovine Testicular Hyaluronidase Type IV-S via LC-MS/MS No. Protein 1 serum albumin precursor gi annexin A2 gi annexin I gi 74 4 Phosphatidylethanolamine-binding protein 1(PEBP-1) gi glutathione S-transferase P gi ectonucleotide pyrophosphatase/phosphodiesterase 5 gi (putative function) 7 cathepsin D gi beta-2-glycoprotein I gi 6 9 sialate O-acetylesterase gi fatty acid-binding protein, epidermal gi annexin A5 gi ANXA5 protein gi regucalcin gi acyl-coa-binding protein gi Sperm adhesion molecule 1 (PH-20 hyaluronidase, zona gi pellucida binding) 16 superoxide dismutase [Cu-Zn] gi N-acetylglucosamine-6-sulfatase precursor gi alpha 3 type VI collagen, partial gi cathepsin C gi putative phospholipase B-like 2 precursor gi glutathione S-transferase Mu 1 gi haptoglobin precursor gi leucine-rich alpha-2-glycoprotein gi lysosomal Pro-X carboxypeptidase precursor gi acylphosphatase-1 gi annexin A3 gi inter-alpha (globulin) inhibitor H4 (plasma Kallikreinsensitive gi glycoprotein) 28 transaldolase gi acrosin gi SH3 domain-binding glutamic acid-rich-like protein gi Malate dehydrogenase gi cathepsin B precursor gi glucosamine 6-phosphate N-acetyltransferase gi fatty acid-binding protein, heart gi kda glucose-regulated protein precursor gi phospholipase D3 gi plasma glutamate carboxypeptidase precursor gi tubulin polymerization-promoting protein family gi member 2 Huang et al., SUPPLEMENTAL TABLE II Page 1 of 3

4 No. Protein 39 coactosin-like protein gi Rsb-66 protein gi serotransferrin precursor gi epididymal secretory protein E1 precursor gi lumican precursor gi gamma-glutamylcyclotransferase gi gamma-glutamyl hydrolase precursor gi fatty acid-binding protein, adipocyte gi myosin light chain kinase, smooth muscle gi cysteine-rich secretory protein 2 gi IgG2a heavy chain constant region gi glutathione S-transferase mu 1 gi immunoglobulin lambda-like polypeptide 1-like gi alpha-1-acid glycoprotein precursor gi aminoacyl trna synthase complex-interacting gi multifunctional protein 1 54 talin 1 gi microtubule-associated protein RP/EB family member 1 gi protein NipSnap homolog 3A gi activated RNA polymerase II transcriptional coactivator gi p15 58 UV excision repair protein RAD23 homolog B gi anti-testosterone antibody gi glutathione S-transferase mu 3 gi peroxiredoxin-4 gi lymphocyte cytosolic protein 1 (L-plastin) gi phosphatidylethanolamine-binding protein 4 gi cathepsin L2 precursor gi alpha-1b-glycoprotein precursor gi cathepsin F gi heat shock-related 70 kda protein 2 gi pro-cathepsin H precursor gi plastin-3 gi heat shock cognate 71 kda protein gi complement factor B precursor gi thioredoxin gi spectrin beta chain, brain 1 gi rho GDP-dissociation inhibitor 1 gi mesencephalic astrocyte-derived neurotrophic factor gi precursor 76 palmitoyl-protein thioesterase 1 precursor gi cathepsin S gi protein DJ-1 gi LIM protein gi glucosylceramidase precursor gi Huang et al., SUPPLEMENTAL TABLE II Page 2 of 3

5 No. Protein 81 DNAJA4 protein gi interleukin enhancer binding factor 3, 90kDa gi ADP-ribosyltransferase 3 gi filamin A, alpha gi D-tyrosyl-tRNA(Tyr) deacylase 1 gi PDIA6 protein gi ganglioside GM2 activator gi Chain I, Trypsin gi immunoglobulin light chain variable region gi myristoyl CoA:protein N-myristoyltransferase gi gamma-inducible protein 30 gi lysozyme-like protein 1 precursor gi AMBP protein gi immunoglobulin lambda light chain constant region 3 gi allotypic variant IGLC3c 95 rho GDP-dissociation inhibitor 2 gi eppin gi serine carboxypeptidase vitellogenic-like gi CD5 gi tubulin polymerization-promoting protein family gi member vesicle-associated membrane protein-associated protein gi A 101 acid sphingomyelinase-like phosphodiesterase 3a gi precursor Huang et al., SUPPLEMENTAL TABLE II Page 3 of 3

6 SUPPLEMENTAL TABLE III. Identified Proteins in rhuph20 via LC-MS/MS No. Protein 1 hyaluronidase PH-20 isoform 2 [Homo sapiens] gi Huang et al., SUPPLEMENTAL TABLE I Page 1 of 1

Biological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase

Biological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase Full name Glyceraldehyde3 phosphate dehydrogenase Succinatesemialdehyde Glutamate dehydrogenase 1, Alcohol dehydrogenase [NADP+] 2',3'cyclicnucleotide 3' phosphodiesterase Dihydropyrimidinaserelated 2

More information

Supporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma

Supporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma Supporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma Jiejun Gao 1, Lu Lin 2, Alexander Wei 2,*, and Maria S. Sepúlveda 1,* 1 Department of Forestry and Natural

More information

Supplemental Information. Host-Microbiota Interactions in the Pathogenesis. of Antibiotic-Associated Diseases

Supplemental Information. Host-Microbiota Interactions in the Pathogenesis. of Antibiotic-Associated Diseases Cell Reports, Volume Supplemental Information Host-Microbiota Interactions in the Pathogenesis of -Associated Diseases Joshua S. Lichtman, Jessica A. Ferreyra, Katharine M. Ng, Samuel A. Smits, Justin

More information

Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A).

Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A). Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease

More information

SwissProt/ TrEmbl Acc. No. 1 Description. Found in Other Studies 5. MW (kda) 2 pi 3 Function 4

SwissProt/ TrEmbl Acc. No. 1 Description. Found in Other Studies 5. MW (kda) 2 pi 3 Function 4 P02774 Vitamin D-binding protein precursor 52.95 5.4 Cell communication c, a,b S,C P08833 Insulin-like growth factor binding protein 1 precursor 27.88 5.1 Cell communication c, a P02760 AMBP protein precursor

More information

TECHNICAL NOTE. Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive

TECHNICAL NOTE. Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive TECHNICAL NOTE Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive In this technical note you will learn about: Step-by-step set-up of parallel reaction monitoring (PRM)

More information

ACCESSORY PUBLICATION. Supplementary Table 1. Genes up regulated in the skin of both HR and LR animals. after tick larval challenge e

ACCESSORY PUBLICATION. Supplementary Table 1. Genes up regulated in the skin of both HR and LR animals. after tick larval challenge e ACCESSORY PUBLICATION Supplementary Table 1. Genes up regulated in the skin of both HR and LR animals after tick larval challenge e GenBank Accession a No. of elemen ts b t=0 Signal intensity c t=0 Description

More information

number Done by Corrected by Doctor F. Al-Khateeb

number Done by Corrected by Doctor F. Al-Khateeb number 23 Done by A. Rawajbeh Corrected by Doctor F. Al-Khateeb Ketone bodies Ketone bodies are used by the peripheral tissues like the skeletal and cardiac muscles, where they are the preferred source

More information

Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name

Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name 5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)

More information

GMI STUDY. COMPARATIVE PROTEOMIC STUDY BETWEEN GMI and STRAUMANN DENTAL IMPLANTS

GMI STUDY. COMPARATIVE PROTEOMIC STUDY BETWEEN GMI and STRAUMANN DENTAL IMPLANTS GMI STUDY. COMPARATIVE PROTEOMIC STUDY BETWEEN GMI and STRAUMANN DENTAL IMPLANTS 2 Hypothesis. Proteomic study of first protein layer Post-implantation, the biomaterial becomes in contact with the blood,

More information

Biosynthesis of Fatty Acids

Biosynthesis of Fatty Acids Biosynthesis of Fatty Acids Fatty acid biosynthesis takes place in the cytosol rather than the mitochondria and requires a different activation mechanism and different enzymes and coenzymes than fatty

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2018 Supporting Information Covalent functionalization of graphene oxide with

More information

Supporting Information. Synthesis of Zwitterionic Polymer Particles via Combined Distillation

Supporting Information. Synthesis of Zwitterionic Polymer Particles via Combined Distillation Supporting Information Synthesis of Zwitterionic Polymer Particles via Combined Distillation Precipitation Polymerization and Click Chemistry for Highly Efficient Enrichment of Glycopeptide Jianxi Liu,

More information

Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding

Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding Aleksei Krasnov, Nofima FHFs fiskehelsesamling 1.-2. september 2015 Smoltifiction and breeding suppress immunity in

More information

Receptor mediated Signal Transduction

Receptor mediated Signal Transduction Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third

More information

An#body structure & func#on

An#body structure & func#on An#body structure & func#on Objec&ves You should be able to: ü Define an&body ü Describe an&body structure ü Compare between different types or classes of an&body and their func&on An#bodies = Immunoglobulin

More information

Cell-Derived Inflammatory Mediators

Cell-Derived Inflammatory Mediators Cell-Derived Inflammatory Mediators Introduction about chemical mediators in inflammation Mediators may be Cellular mediators cell-produced or cell-secreted derived from circulating inactive precursors,

More information

Supplementary Data A

Supplementary Data A Supplementary Data A Proteomic data and MS/MS fragmentation spectra from 2-DE and GeLC-MS/MS analysis of the bovine teat canal lining and the outer teat skin epithelium Table A1: 2-DE proteins spots identified

More information

Glycolysis - Plasmodium

Glycolysis - Plasmodium Apicomplexan Biochemistry Basics Toxoplasma Good cell biology model Genome sequencing not completed Virtual pathways Cryptosporidium The strange one Genome sequence completed Virtual pathways Plasmodium

More information

Cellular functions of protein degradation

Cellular functions of protein degradation Protein Degradation Cellular functions of protein degradation 1. Elimination of misfolded and damaged proteins: Environmental toxins, translation errors and genetic mutations can damage proteins. Misfolded

More information

CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems

CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems Vasco Mota*, Tom Nilsen, Elizabeth Ytteborg, Grete Baeverfjord, Aleksei Krasnov, Jelena Kolarevic, Lars Ebbesson, Steven

More information

Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function

Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function 1 BPSL0024 26223 26621 + LrgA family BPSL0025 26690 27412 + hypothetical

More information

Multiple High-Abundant Protein Removal for Proteomics. Dr. Cory Szafranski, Product Manager

Multiple High-Abundant Protein Removal for Proteomics. Dr. Cory Szafranski, Product Manager Multiple High-Abundant Protein Removal for Proteomics Dr. Cory Szafranski, Product Manager Agilent Multiple Affinity Removal System - What is it? H L High-Abundant Proteins (Albumin, IgG, IgA, Transferrin,

More information

REGULATION OF ENZYME ACTIVITY. Medical Biochemistry, Lecture 25

REGULATION OF ENZYME ACTIVITY. Medical Biochemistry, Lecture 25 REGULATION OF ENZYME ACTIVITY Medical Biochemistry, Lecture 25 Lecture 25, Outline General properties of enzyme regulation Regulation of enzyme concentrations Allosteric enzymes and feedback inhibition

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

Ahmad Ulnar. Faisal Nimri ... Dr.Faisal

Ahmad Ulnar. Faisal Nimri ... Dr.Faisal 24 Ahmad Ulnar Faisal Nimri... Dr.Faisal Fatty Acid Synthesis - Occurs mainly in the Liver (to store excess carbohydrates as triacylglycerols(fat)) and in lactating mammary glands (for the production of

More information

Table S1. CRC case Pool Control Pool Name UniProt No. FC b VIP value d Spectral Counts Spectral Counts

Table S1. CRC case Pool Control Pool Name UniProt No. FC b VIP value d Spectral Counts Spectral Counts Table S1. page 1/4 Phase 1 Exploratory Study, List of proteins identified by LC-ESI-MS/MS after 1DE separation and their relative quantitation by spectral count UniProt Entry SwissProt- CRC case Pool Control

More information

Model Answer. M.Sc. Zoology (First Semester) Examination Paper LZT 103 (Endocrinology)

Model Answer. M.Sc. Zoology (First Semester) Examination Paper LZT 103 (Endocrinology) Model Answer M.Sc. Zoology (First Semester) Examination-2013 Paper LZT 103 (Endocrinology) Section A 1. (i) d (ii) b (iii) b (iv) c (v) c (vi) a (vii) c (viii) a (ix) d (x) b Section B Q.2 Answer Hormonal

More information

Lecture 13 (10/13/17)

Lecture 13 (10/13/17) Lecture 13 (10/13/17) Reading: Ch6; 187-189, 204-205 Problems: Ch4 (text); 2, 3 NXT (after xam 2) Reading: Ch6; 190-191, 194-195, 197-198 Problems: Ch6 (text); 5, 6, 7, 24 OUTLIN NZYMS: Binding & Catalysis

More information

Sphingosine-1-phosphate signaling and cardiac fibrosis. Department of Physiology, Kanazawa University School of Medicine, Kanazawa, Japan

Sphingosine-1-phosphate signaling and cardiac fibrosis. Department of Physiology, Kanazawa University School of Medicine, Kanazawa, Japan 96 Special Issue: Cellular and Molecular Bases for Fibrotic Diseases Review Article Sphingosine-1-phosphate signaling and cardiac fibrosis Noriko Takuwa 1, 2, ), Yasuo Okamoto 1), Kazuaki Yoshioka 1) and

More information

LECTURE: 21. Title IMMUNOGLOBULINS FUNCTIONS & THEIR RECEPTORS LEARNING OBJECTIVES:

LECTURE: 21. Title IMMUNOGLOBULINS FUNCTIONS & THEIR RECEPTORS LEARNING OBJECTIVES: LECTURE: 21 Title IMMUNOGLOBULINS FUNCTIONS & THEIR RECEPTORS LEARNING OBJECTIVES: The student should be able to: Determine predominant immunoglobulin isotypes in serum. Determine the predominant immunoglobulin

More information

Energy storage in cells

Energy storage in cells Energy storage in cells Josef Fontana EC - 58 Overview of the lecture Introduction to the storage substances of human body Overview of storage compounds in the body Glycogen metabolism Structure of glycogen

More information

CELLS. Cells. Basic unit of life (except virus)

CELLS. Cells. Basic unit of life (except virus) Basic unit of life (except virus) CELLS Prokaryotic, w/o nucleus, bacteria Eukaryotic, w/ nucleus Various cell types specialized for particular function. Differentiation. Over 200 human cell types 56%

More information

LIPID METABOLISM

LIPID METABOLISM LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-

More information

BIOLOGY 103 Spring 2001 MIDTERM LAB SECTION

BIOLOGY 103 Spring 2001 MIDTERM LAB SECTION BIOLOGY 103 Spring 2001 MIDTERM NAME KEY LAB SECTION ID# (last four digits of SS#) STUDENT PLEASE READ. Do not put yourself at a disadvantage by revealing the content of this exam to your classmates. Your

More information

ESTUDIO GMI. ESTUDIO PROTEÓMICO-COMPARACIÓN IMPLANTES DENTALES

ESTUDIO GMI. ESTUDIO PROTEÓMICO-COMPARACIÓN IMPLANTES DENTALES ESTUDIO GMI. ESTUDIO PROTEÓMICO-COMPARACIÓN IMPLANTES DENTALES 2 Hypothesis. Proteomic study of first protein layer Post-implantation, the biomaterial becomes in contact with the blood, resulting in protein

More information

Amino acids. Side chain. -Carbon atom. Carboxyl group. Amino group

Amino acids. Side chain. -Carbon atom. Carboxyl group. Amino group PROTEINS Amino acids Side chain -Carbon atom Amino group Carboxyl group Amino acids Primary structure Amino acid monomers Peptide bond Peptide bond Amino group Carboxyl group Peptide bond N-terminal (

More information

Phospholipids Metabolism

Phospholipids Metabolism Chapter VI: Phospholipids Metabolism Dr. Sameh Sarray Hlaoui Phospholipids Features: Amphipatic: - Hydrophobic head: fatty acids - Hydropholic head: P group+ alcohol Composed of alcohol attached by a phosphodiester

More information

Levels of organization

Levels of organization The Cell 1.The cell the basic structural and functional unit of living organisms 2.Prokaryotic and Eukaryotic Cells 3.Cellular organization: external morphology cell size, shape and color internal structure

More information

MBBS First Professional (Part-I Examination) BIOCHEMISTRY Model Paper

MBBS First Professional (Part-I Examination) BIOCHEMISTRY Model Paper MBBS FIRST PROFESSIONAL (PART I) Biochemistry (MCQs) Maximum Marks: 35 Time Allowed: 45 minutes Q 1. What is not correct about cell membrane? A. Contains two layers of phospholipids B. May contain receptor

More information

Chapter 19: IgE-Dependent Immune Responses and Allergic Disease

Chapter 19: IgE-Dependent Immune Responses and Allergic Disease Allergy and Immunology Review Corner: Chapter 19 of Cellular and Molecular Immunology (Seventh Edition), by Abul K. Abbas, Andrew H. Lichtman and Shiv Pillai. Chapter 19: IgE-Dependent Immune Responses

More information

Separation of Main Proteins in Plasma and Serum

Separation of Main Proteins in Plasma and Serum BCH 471 Experiment (2) Separation of Main Proteins in Plasma and Serum PLASMA PROTEINS Mw The main plasma proteins are: þ Albumin (36-50 g/l), Mw 66.241kDa. þ Globulins (18-32 g/l), Mw of globulins Cover

More information

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

More information

FIRST BIOCHEMISTRY EXAM Tuesday 25/10/ MCQs. Location : 102, 105, 106, 301, 302

FIRST BIOCHEMISTRY EXAM Tuesday 25/10/ MCQs. Location : 102, 105, 106, 301, 302 FIRST BIOCHEMISTRY EXAM Tuesday 25/10/2016 10-11 40 MCQs. Location : 102, 105, 106, 301, 302 The Behavior of Proteins: Enzymes, Mechanisms, and Control General theory of enzyme action, by Leonor Michaelis

More information

Metabolism of acylglycerols and sphingolipids. Martina Srbová

Metabolism of acylglycerols and sphingolipids. Martina Srbová Metabolism of acylglycerols and sphingolipids Martina Srbová Types of glycerolipids and sphingolipids 1. Triacylglycerols function as energy reserves adipose tissue (storage of triacylglycerol), lipoproteins

More information

III. Metabolism The Citric Acid Cycle

III. Metabolism The Citric Acid Cycle Department of Chemistry and Biochemistry University of Lethbridge III. Metabolism The Citric Acid Cycle Slide 1 The Eight Steps of the Citric Acid Cycle Enzymes: 4 dehydrogenases (2 decarboxylation) 3

More information

MOLECULAR WEIGHT OF DIFFERENT PROTEINS PRESENT IN ZEBRAFISH EMBRYO DURING GASTRULATION PERIOD

MOLECULAR WEIGHT OF DIFFERENT PROTEINS PRESENT IN ZEBRAFISH EMBRYO DURING GASTRULATION PERIOD MOLECULAR WEIGHT OF DIFFERENT PROTEINS PRESENT IN ZEBRAFISH EMBRYO DURING GASTRULATION PERIOD 1) 37% molecular weight of about 97KDa 2) 14.6% molecular weight of about 45 KDa 3+4) 27.4% molecular weight

More information

Levels of organization

Levels of organization The Cell 1.The cell the basic structural and functional unit of living organisms 2.Prokaryotic and Eukaryotic Cells 3.Cellular organization: external morphology cell size, shape and color internal structure

More information

Signal Transduction Cascades

Signal Transduction Cascades Signal Transduction Cascades Contents of this page: Kinases & phosphatases Protein Kinase A (camp-dependent protein kinase) G-protein signal cascade Structure of G-proteins Small GTP-binding proteins,

More information

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve

More information

Biochemistry 423 Final Examination NAME:

Biochemistry 423 Final Examination NAME: Biochemistry 423 Final Examination NAME: 1 Circle the single BEST answer (3 points each) 1. At equilibrium the free energy of a reaction G A. depends only on the temperature B. is positive C. is 0 D. is

More information

Amino Acids and Proteins (2) Professor Dr. Raid M. H. Al-Salih

Amino Acids and Proteins (2) Professor Dr. Raid M. H. Al-Salih Amino Acids and Proteins (2) Professor Dr. Raid M. H. Al-Salih 1 Some important biologically active peptides 2 Proteins The word protein is derived from Greek word, proteios which means primary. As the

More information

INTERACTION DRUG BODY

INTERACTION DRUG BODY INTERACTION DRUG BODY What the drug does to the body What the body does to the drug Receptors - intracellular receptors - membrane receptors - Channel receptors - G protein-coupled receptors - Tyrosine-kinase

More information

Protein Trafficking in the Secretory and Endocytic Pathways

Protein Trafficking in the Secretory and Endocytic Pathways Protein Trafficking in the Secretory and Endocytic Pathways The compartmentalization of eukaryotic cells has considerable functional advantages for the cell, but requires elaborate mechanisms to ensure

More information

Cell Signaling part 2

Cell Signaling part 2 15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,

More information

Supporting Information

Supporting Information Comparative Proteomic Study of Fatty Acid-treated Myoblasts Reveals Role of Cox-2 in Palmitate-induced Insulin Resistance Supporting Information Xiulan Chen 1#, Shimeng Xu 2,3#, Shasha Wei 1,3, Yaqin Deng

More information

Antibody-Cytokine- Autoimmune

Antibody-Cytokine- Autoimmune Antibody-Cytokine- Autoimmune Surasak Wongratanacheewin, Ph.D Dean, Graduate School, KKU Microbiology, Faculty of Medicine, KKU sura_wng@kku.ac.th การอบรมหล กส ตรประกาศน ยบ ตรการข นทะเบ ยนช วว ตถ ว นท

More information

Proteomic Analysis of Glomeruli in Diabetes 1

Proteomic Analysis of Glomeruli in Diabetes 1 Proteomic Analysis of Glomeruli in Diabetes 1 Table 1: Identified Proteins from Mouse Glomerular Proteome Map spot# ; Regulation Functional swiss prot mass with group Protein entry (kda) pi Diabetes* Cytoskeletal

More information

Quiz #1. BIO200 January 11, point each

Quiz #1. BIO200 January 11, point each Quiz #1 January 11, 2013 1. The primary amine group of an amino acid has a pka of 10 and the carboxylic acid group of an amino acid has a pka of 2. The side chain of the amino acid alanine is a methyl

More information

Sarah Jaar Marah Al-Darawsheh

Sarah Jaar Marah Al-Darawsheh 22 Sarah Jaar Marah Al-Darawsheh Faisal Mohammad Receptors can be membrane proteins (for water-soluble hormones/ligands) or intracellular (found in the cytosol or nucleus and bind to DNA, for lipid-soluble

More information

GENERAL CHARACTERISTICS OF THE ENDOCRINE SYSTEM FIGURE 17.1

GENERAL CHARACTERISTICS OF THE ENDOCRINE SYSTEM FIGURE 17.1 GENERAL CHARACTERISTICS OF THE ENDOCRINE SYSTEM FIGURE 17.1 1. The endocrine system consists of glands that secrete chemical signals, called hormones, into the blood. In addition, other organs and cells

More information

Bio Metabolism. Metabolism Life is a bag of biochemistry. Chloroplasts and mitochondria. What is food?

Bio Metabolism. Metabolism Life is a bag of biochemistry. Chloroplasts and mitochondria. What is food? Metabolism Life is a bag of biochemistry 1 Chloroplasts and mitochondria Heat Carbohydrate O 2 CO 2 + H 2 O Heat Chloroplast Mitochondria 2 What is food? Proteins - polymers of amino acids Carbohydrates

More information

Supplementary Data. References

Supplementary Data. References Supplementary Data Materials and Methods Sample collection from acute kidney injury patients Urine samples were obtained from patients who had cardiac surgery at one academic medical center and two local

More information

SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.

SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body

More information

Activation of the endocannabinoid system by organophosphorus nerve agents

Activation of the endocannabinoid system by organophosphorus nerve agents 1 Supplementary Information Activation of the endocannabinoid system by organophosphorus nerve agents Daniel K. Nomura, 1 Jacqueline L. Blankman, 2 Gabriel M. Simon, 2 Kazutoshi Fujioka, 1 Roger S. Issa,

More information

Multiplex Protein Quantitation using itraq Reagents in a Gel-Based Workflow

Multiplex Protein Quantitation using itraq Reagents in a Gel-Based Workflow Multiplex Protein Quantitation using itraq Reagents in a Gel-Based Workflow Purpose Described herein is a workflow that combines the isobaric tagging reagents, itraq Reagents, with the separation power

More information

Proteins are sometimes only produced in one cell type or cell compartment (brain has 15,000 expressed proteins, gut has 2,000).

Proteins are sometimes only produced in one cell type or cell compartment (brain has 15,000 expressed proteins, gut has 2,000). Lecture 2: Principles of Protein Structure: Amino Acids Why study proteins? Proteins underpin every aspect of biological activity and therefore are targets for drug design and medicinal therapy, and in

More information

Posttranslational Modification of Proteins

Posttranslational Modification of Proteins Posttranslational Modification of Proteins Expanding Natures Inventory Christopher T. Walsh Harvard Medical School RoBERTS AND CoMPANY PuBLISHERS Englewood, Col ~1 ado,. Brief Contents Preface xv Reviewers

More information

BCM 221 LECTURES OJEMEKELE O.

BCM 221 LECTURES OJEMEKELE O. BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX

More information

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.

More information

BIOL 158: BIOLOGICAL CHEMISTRY II

BIOL 158: BIOLOGICAL CHEMISTRY II BIOL 158: BIOLOGICAL CHEMISTRY II Lecture 5: Vitamins and Coenzymes Lecturer: Christopher Larbie, PhD Introduction Cofactors bind to the active site and assist in the reaction mechanism Apoenzyme is an

More information

Synthesis and elongation of fatty acids

Synthesis and elongation of fatty acids Synthesis and elongation of fatty acids A molecular caliper mechanism for determining very long-chain fatty acid length Vladimir Denic and Jonathan S. Weissman (2007) Cell 130, 663-677 February 28, 2008

More information

Supplementary Tables 1

Supplementary Tables 1 Supplementary Tables 1 Supplementary Table 1: The 11 genes in the geneset for Case Study 1 At1g62570 At1g09350 At1g60470 At2g47180 At4g17090 At5g20830 At2g16890 At3g51240 At3g55120 At4g27560 At5g08640

More information

PHM142 Lecture 4: Platelets + Endothelial Cells

PHM142 Lecture 4: Platelets + Endothelial Cells PHM142 Lecture 4: Platelets + Endothelial Cells 1 Hematopoiesis 2 Platelets Critical in clotting - activated by subendothelial matrix proteins (e.g. collagen, fibronectin, von Willebrand factor) and thrombin

More information

Lehninger 5 th ed. Chapter 17

Lehninger 5 th ed. Chapter 17 Lehninger 5 th ed. Chapter 17 December 26, 2010 Prof. Shimon Schuldiner Email: Shimon.Schuldiner@huji.ac.il Phone: 6585992 CHAPTER 17 Fatty Acid Catabolism Key topics: How fats are digested in animals

More information

Signal Transduction: G-Protein Coupled Receptors

Signal Transduction: G-Protein Coupled Receptors Signal Transduction: G-Protein Coupled Receptors Federle, M. (2017). Lectures 4-5: Signal Transduction parts 1&2: nuclear receptors and GPCRs. Lecture presented at PHAR 423 Lecture in UIC College of Pharmacy,

More information

Cell Membranes. Dr. Diala Abu-Hassan School of Medicine Cell and Molecular Biology

Cell Membranes. Dr. Diala Abu-Hassan School of Medicine Cell and Molecular Biology Cell Membranes Dr. Diala Abu-Hassan School of Medicine Dr.abuhassand@gmail.com Cell and Molecular Biology Organelles 2Dr. Diala Abu-Hassan Membrane proteins Major components of cells Nucleic acids DNA

More information

Name: Date: Block: Biology 12

Name: Date: Block: Biology 12 Name: Date: Block: Biology 12 Provincial Exam Review: Cell Processes and Applications January 2003 Use the following diagram to answer questions 1 and 2. 1. Which labelled organelle produces most of the

More information

5/12/2015. Cell Size. Relative Rate of Reaction

5/12/2015. Cell Size. Relative Rate of Reaction Cell Makeup Chapter 4 The Cell: The Fundamental Unit of Life We previously talked about the cell membrane The cytoplasm is everything inside the membrane, except the nucleus Includes Cytosol = liquid portion

More information

CD82/ CD63 expression in human thyroid tissues

CD82/ CD63 expression in human thyroid tissues - 34-4 RESULTS 4.1 CD82/ CD63 expression in human thyroid tissues 4.1.1 Transcriptional analysis CD82 All investigated benign goiter tissues showed strong transcriptional level for CD82. Thyroid carcinoma

More information

Biosynthesis of Fatty Acids. By Dr.QUTAIBA A. QASIM

Biosynthesis of Fatty Acids. By Dr.QUTAIBA A. QASIM Biosynthesis of Fatty Acids By Dr.QUTAIBA A. QASIM Fatty Acids Definition Fatty acids are comprised of hydrocarbon chains terminating with carboxylic acid groups. Fatty acids and their associated derivatives

More information

I) Choose the best answer: 1- All of the following amino acids are neutral except: a) glycine. b) threonine. c) lysine. d) proline. e) leucine.

I) Choose the best answer: 1- All of the following amino acids are neutral except: a) glycine. b) threonine. c) lysine. d) proline. e) leucine. 1- All of the following amino acids are neutral except: a) glycine. b) threonine. c) lysine. d) proline. e) leucine. 2- The egg white protein, ovalbumin, is denatured in a hard-boiled egg. Which of the

More information

Chapter 5. Generation of lymphocyte antigen receptors

Chapter 5. Generation of lymphocyte antigen receptors Chapter 5 Generation of lymphocyte antigen receptors Structural variation in Ig constant regions Isotype: different class of Ig Heavy-chain C regions are encoded in separate genes Initially, only two of

More information

T cell-mediated immunity

T cell-mediated immunity T cell-mediated immunity Overview For microbes within phagosomes in phagocytes.cd4+ T lymphocytes (TH1) Activate phagocyte by cytokines studies on Listeria monocytogenes For microbes infecting and replicating

More information

(A) Urea cycle (B) TCA cycle (C) Glycolysis (D) Pyruvate oxidation (E) Respiratory chain

(A) Urea cycle (B) TCA cycle (C) Glycolysis (D) Pyruvate oxidation (E) Respiratory chain Biochemistry - Problem Drill 15: Citric Acid Cycle No. 1 of 10 1. Which of the following statements is not a metabolic pathway involved in carbohydrate catabolism and ATP production. (A) Urea cycle (B)

More information

Four melanocyte-stimulating hormones have the following amino acid sequences:

Four melanocyte-stimulating hormones have the following amino acid sequences: Assignment 14: Melanocyte-stimulating hormone belongs to a group called the melanocortins. This group includes ACTH, alpha-msh, beta-msh and gamma-msh; these peptides are all cleavage products of a large

More information

Organelles of the Cell & How They Work Together. Packet #7

Organelles of the Cell & How They Work Together. Packet #7 Organelles of the Cell & How They Work Together Packet #7 Introduction Introduction Organization of cells is basically similar in all cells. Additionally, most cells are tiny Ranging from 1 1000 cubic

More information

Chapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002

Chapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10 Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10: Integration and Control of Metabolism Press the space bar or click the mouse

More information

Proteomic studies in Collagen Induced Arthritis (CIA) rats

Proteomic studies in Collagen Induced Arthritis (CIA) rats V{tÑàxÜ@H Proteomic studies in Collagen Induced Arthritis (CIA) rats 5.1. Introduction Over the last few decades, both naturally occurring and genetically engineered animal models of human diseases have

More information

Organic Compounds. Compounds that contain CARBON are called organic. Macromolecules are large organic molecules.

Organic Compounds. Compounds that contain CARBON are called organic. Macromolecules are large organic molecules. Macromolecules 1 Organic Compounds Compounds that contain CARBON are called organic. Macromolecules are large organic molecules. 2 Carbon (C) Carbon has 4 electrons in outer shell. Carbon can form covalent

More information

BIO 5099: Molecular Biology for Computer Scientists (et al)

BIO 5099: Molecular Biology for Computer Scientists (et al) BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 15: Being a Eukaryote: From DNA to Protein, A Tour of the Eukaryotic Cell. Christiaan van Woudenberg Being A Eukaryote Basic eukaryotes

More information

SUPPLEMENTARY FIG. S2. b-galactosidase staining of

SUPPLEMENTARY FIG. S2. b-galactosidase staining of SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived

More information

What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes.

What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. C. Mostly non-compact G1 chromosomes. D. Compact G1 and G2 chromosomes.

More information

Protein Classification based upon Biological functions

Protein Classification based upon Biological functions PROTEINS (a) The light produced by fireflies is the result of a reaction involving the protein luciferin and ATP, catalyzed by the enzyme luciferase. (b) Erythrocytes contain large amounts of the oxygen-transporting

More information

The Structure and Function of Biomolecules

The Structure and Function of Biomolecules The Structure and Function of Biomolecules The student is expected to: 9A compare the structures and functions of different types of biomolecules, including carbohydrates, lipids, proteins, and nucleic

More information

Photosynthesis in chloroplasts. Cellular respiration in mitochondria ATP. ATP powers most cellular work

Photosynthesis in chloroplasts. Cellular respiration in mitochondria ATP. ATP powers most cellular work Light energy ECOSYSTEM CO + H O Photosynthesis in chloroplasts Cellular respiration in mitochondria Organic molecules + O powers most cellular work Heat energy 1 becomes oxidized (loses electron) becomes

More information

Two independent proteomic approaches provide a comprehensive analysis of the synovial fluid proteome response to Autologous Chondrocyte Implantation

Two independent proteomic approaches provide a comprehensive analysis of the synovial fluid proteome response to Autologous Chondrocyte Implantation Hulme et al. Arthritis Research & Therapy (2018) 20:87 https://doi.org/10.1186/s13075-018-1573-4 RESEARCH ARTICLE Two independent proteomic approaches provide a comprehensive analysis of the synovial fluid

More information

Revision. General functions of hormones. Hormone receptors. Hormone derived from steroids Small polypeptide Hormone

Revision. General functions of hormones. Hormone receptors. Hormone derived from steroids Small polypeptide Hormone االله الرحمن الرحيم بسم Revision General functions of hormones. Hormone receptors Classification according to chemical nature Classification according to mechanism of action Compare and contrast between

More information